Articles on this page are available in 2 other languages: Spanish (8), Chinese (Simplified) (1) (learn more)

Overview

Distribution

Djibouti, Eritrea, Gulf of Mexico, Kenya, New Zealand Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Red Sea, Somalia, Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-(sub)tropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Brown Booby can be found throughout the pantropical oceans with few exceptions. Breeding sites include the Carribean, the Atlantic coasts of Brazil and Africa, oceanic islands off Madagascar, the Red Sea, northern Australia, many oceanic islands in the western and central Pacific, as well as off the coast of Mexico and Peru1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Brown boobies, Sula leucogaster, are common residents of Puerto Rico and the Virgin Islands. The distribution is described as pantropical, between latitudes 30 degrees North and 30 degrees South, though it extends to about 34 degrees South in the central Pacific. Brown boobies occur in the Caribbean Sea, Red Sea, and the Atlantic, Pacific, and Indian Oceans. They also inhabit seas north of Australia.  The subspecies Sula leucogaster brewslei and Sula leucogaster etesiaca live along the Pacific coast of Mexico and the Pacific coast of Central and South America, respectively.

Although brown boobies may have historically inhabited the Florida Keys, clear evidence is lacking. Tropical storms occasionally blow individuals of this species well outside of their typical geographic boundaries - such an example is the October 2008 observation of a lone Sula leucogaster at Claytor Lake (Pulaski County) in southwestern (interior) Virginia.

Biogeographic Regions: neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Mack, L., A. Larner. 2009. Fall reporting period August-November 2008. Virginia Birds, 5(2): 9.
  • Raffaele, H. 1989. A guide to the birds of Puerto Rico and the Virgin Islands. Princeton, NJ: Princeton University Press.
  • Schreiber, E., R. Norton. 2002. Brown Booby: Sula leucogaster. The Birds of North America, 17/1: 1-26.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: islands from Yucatan, Florida Keys (formerly), and Bahamas (Sprunt 1984) south through Antilles to northern South America; Cape Verde Islands to Brazil; Pacific: Gulf of California to Colombia, Hawaii (Kure to Niihau and Moku Manu) to Australia; Indian Ocean. Ranges at sea generally in breeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult feather coloration is similar between sexes. There are small differences among males of the subspecies S. leucogaster brewslei and S. leucogaster etesiaca.  Generally brown boobies have dark brown heads, necks, and backs with bright white underbellies. A sharp line separates the lower breast where the brown fades to white. The under wings are mostly white except for a variable dark bar that is relatively narrow and extends from armpit to carpal joints.  The subspecies mentioned earlier tend to have a light gray to white head that gradually turns brown at the neck. Overall their necks and upper backs are darker than other Sula leucogaster subspecies. Juveniles have no documented differences between sexes or subspecies. But are generally a brownish color on their head, neck, and back with a noticeable band across the lower breast which leads to the mottled brown and whitish underparts (underparts gradually attain full white color over first 2 years). The under wing-coverts (feathers that cover the bases of the quill feathers) are generally gray, which contrast significantly with the rest of the under wing. Adult soft part colors vary slightly between males and females, with no documented variation among subspecies. Males have gray-blue to steely-blue skin around the eyes and yellow to bright yellow skin at base of mandible. Females are much the same, except for face skin that is always bright yellow. In both genders the bills and feet range in color from bright yellow, bluish yellow, greenish yellow, light-pink, and gray.

Overall distinguishing booby species isn’t difficult, but juvenile red-footed boobies (Sula sula) look remarkably similar to juvenile brown boobies.  Overall length ranges from 64 to 85 cm, with females on average being a few cm longer. Their wingspan is in the range of 132 to 155 cm. There is a slight difference in weight between sexes, with females usually weighing about 300 g heavier. The ranges for males are 950 to 1700 g and for females is 1000 to 1800 g.

Range mass: 950 to 1800 g.

Average mass: 1300 g.

Range length: 64 to 85 cm.

Range wingspan: 132 to 155 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 76 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Length: 64-74 cm. Colour: adult sooty-brown above, on head, neck and breast; belly and undertail coverts white; underwing white except for dark brown leading and trailing edges and tip; bill yellow to greenish grey with pink or blue tip; facial skin yellow to greenish; legs and feet yellow to greenish; immature like adult but with brown wash on underparts; bill and face grey. Habitat: shallow waters around oceanic islands. (<313><316><318>)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is strictly marine, generally feeding on inshore waters. Its diet is comprised mainly of flying-fish and squid, but also some halfbeak (Hemiramphu), mullet (Mugil) and anchovy (Engraulis). Prey is usually caught by plunge-diving and it can also snatch prey off the surface of water. Kleptoparasitism has been observed, mostly by females. Breeding is seasonal in some reas by elsewhere it breeds opportunistically or more or less continuously. Nests are usually built on the ground in the midst of vegetation on rocky islands or coral atolls. Individuals form colonies that are usually smaller than other Sula species1.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brown boobies use coral atolls and volcanic stack islands for nesting in tropical or subtropical waters. When faced with little or no competition for space, they prefer wide open spaces at sea level. They have, however, been found on cliffs and hillsides.

Range elevation: 0 to 15 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: coastal

  • Chaves-Campos,, J., J. Torres. 2002. Distribution of the Brown Booby (Sula leucogaster) in relation to the inclination of terrain. Ornitologia Neotropical, 13: 205-208.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 328 specimens in 1 taxon.
Water temperature and chemistry ranges based on 220 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 14.435 - 28.903
  Nitrate (umol/L): 0.037 - 4.273
  Salinity (PPS): 32.479 - 36.410
  Oxygen (ml/l): 4.463 - 5.991
  Phosphate (umol/l): 0.054 - 0.486
  Silicate (umol/l): 0.982 - 3.304

Graphical representation

Temperature range (°C): 14.435 - 28.903

Nitrate (umol/L): 0.037 - 4.273

Salinity (PPS): 32.479 - 36.410

Oxygen (ml/l): 4.463 - 5.991

Phosphate (umol/l): 0.054 - 0.486

Silicate (umol/l): 0.982 - 3.304
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Pelagic, but commonly observed from shore; often rests on buoys or rocky cliffs (Raffaele 1983). Usually does not range far out to sea; most numerous around small offshore islands (Stiles and Skutch 1989). Nests on ground or on cliff on island; nests in open area or vegetated site (Kepler 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Generally remains near breeding island through year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brown boobies eat mainly fish. They consume most species of fish that are from 5 to 40 cm in length. Observed prey include flying fish (Exocoetus species), goat fish (Mullidae), squirrelfish (Sargocentron diadema), mackerel (Rastrelliger kanagurta), and ommastrephid squid (Ommastrephidae).

To acquire food, brown boobies use mainly plunge-diving. This is where they rise to 10 to 12 m above the water to search for prey before angling the body in such a way that it can enter the water as smoothly as possible. This position changes throughout the dive, starting with the initial descent. At the time of the descent the wings are folded in tightly next to the body, then thrust straight out over their back (prior to entering water) until their wings are touching over the center of their back. Depending on their altitude prior to diving, they are able to submerge themselves up to 2 m deep. They have also been known to pursue prey underwater using a combination of feet and wing motions.

Along with plunge-diving, some fledglings (about 1 in 100) and some adults (1 in 500) practice kleptoparasitism, where they steal prey from other seabirds. For example, brown boobies have been observed stealing prey from great frigatebirds (Fregata minor) as they transfer food to their young. It is thought that fledgling frigatebird calls for food are what attracts boobies.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Lewis, S., E. Schreiber, F. Daunt, G. Schenk, S. Wanless, K. Hamer. 2004. Flexible foraging patterns under different time constraints in tropical boobies. Animal Behaviour, 68(6): 1331-1337.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Food (fishes, squid) is obtained by diving from air to water surface; feeds more commonly in coastal waters (Terres 1980). Chicks are fed well-digested food by regurgitation, later given whole fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Richardson (2006) report that the presence of seabird nesting colonies (including Sula leucogaster on islands increases the productivity of certain trees (like mangroves) more than islands without nesting colonies.  Recently, this species, Sula leucogaster, has been found to be one of the many contributing factors (along with all other nesting seabird colonies) to eutrophication of the surrounding waters of the islands they inhabit. Their nutrient-rich feces causes lower species diversity and greater dominance of mostly epiphytic biota but also macro-algae and phytoplankton.  The rapid growth of the epiphytes blanket the sea grass beds and eventually causes them to die from lack of sunlight. Any organism in the area that depended on the sea grass that is unable to accommodate the change will soon die after it. However, no studies have examined direct effects of eutrophication on the nesting sea birds from presumed declines in fish in the surrounding water.

Brown boobies are also host to the parasite Babesia poelea. Work and Rameyer's (1997) research pointed to the possibility that avian piroplasms may be species specific and be transmitted by argasid ticks (Carios capensis).

Ecosystem Impact: biodegradation ; parasite

Commensal/Parasitic Species:

  • Richardson, O. 2006. Response of epiphytic foraminiferal communities to natural eutrophication in seagrass habitats off Man O'War Cay, Belize. Marine Ecology, 27(4): 404-416.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sally lightfoot crabs (Grapsus grapsus) are the only known predators of brown booby hatchlings. While these crabs mostly forage around nesting sites picking up feathers, egg shells, dead chicks, and dry bird excrement, they will on very rare occasions prey on recently hatched chicks that have been expelled from the nest. In these cases, adult birds do nothing to protect their young from the crabs and the crabs have never been seen going into the nests after a solitary chick. Brown booby young may also be preyed on by larger seabirds and nesting colonies may be threatened by introduced predators, such as rats, cats, and pigs.

Known Predators:

  • Gianuca, D., C. Vooren. 2007. Abundance and behavior of the sally lightfoot crab (Grapsus grapsus) in the colony of the Brown Booby (Sula leucogaster) in the São Pedro and São Paulo Archipelago. Investigaciones Marinas, 35(2): 121-125.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Often rather gregarious (Hilty and Brown 1986). Feeds singly or in small groups but many may congregate at schools of fishes or around fishing boats (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There has only been one study on the various calls of brown boobies. The results of that study suggest vocalizations are used for several different functions, including greeting mates, aggression, and chicks begging for food. Colonies as a whole are generally not noisy, as more communication is done through behavior. Males and females use vocalizations in different ways. Males emit a series of soft whistles while females are responsible for harsh quacking or honking. These sounds become more pronounced whenever they are faced with possible intrusion from another bird. Males calls become harsher and are held for longer while females emit a sound known as a “roar-call”. This is an emphatic shout that is intended to warn the intruder to stay away from the nest. When these birds greet their mates as they return from hunting, they use their typical sounds. However, these calls are made softly while still far out and tend to get louder as they approach the nest.

Hatchlings have their own range of sounds, starting with peeping while still in the egg. While very young there seems to be no discernible pattern to the food call, it is just a range of the noises they are able to make. As they get older it takes on a loud, raspy, repetitive craa-craaaa.

Most communication is accomplished through behaviors rather than sounds. An example of aggressive behavior will be seen mostly when claiming or maintaining breed sites. Aggressive behaviors are directed towards other birds as well as inanimate objects (shrubs or rocks). When performing aggressive behaviors against other birds, brown boobies hop towards the intruder with their neck and head stretched forward. When they get closer they bow and usually emit a honk. If the intruder does not back down the defending booby will perform a more exaggerated bow. If the intruder still doesn’t back down, then the territory owner may rattle its bill towards the intruder. This can escalate to bill jabbing with a downward slap of the wings. Sometimes the defender will grab onto others bill or neck.

Only males have been observed performing mating behaviors, which include sky-pointing and parading. Sky-pointing is done when a female first approaches. The male will stand up and throw his head into the air with neck stretched out as far as it can go. This is usually accompanied by a unique whistle. This ritual is slightly different from the other booby species as it doesn’t involve a use of the wings. Parading is really just an exaggerated form of walking. The body posture is unusually erect with an exaggerated sway. Other behaviors that are thought to reinforce pair bonding are mutual preening, bill touching, and bowing. Mutual preening is where each pair bond will clean the other’s feathers. Bill touching is done whenever mates return to their own territory after bowing. It has been noted that the mate reentering the territory will make their arrival call and then perform a slight bow (similar to bow described in aggressive behavior) unless the bird reentering is flying in and its partner is on a nest. In which case that bird will perform a seated bow. This action is thought to be a form of greeting.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Usually feeds in daytime (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Adult mortality per year has been reported to be between 3.3 and 7.7%. The maximum known lifespan in the wild is 27.2 years. There have been no studies to document average lifespans in the wild or captivity.

Range lifespan

Status: wild:
27.2 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.2 years (wild) Observations: Most animals breed when 3-4 years of age, but some have been known to breed after 8 months. The oldest banded bird was 27.2 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm). Others have suggested a life expectancy of at least 30 years and possibly up to 50 years. Annual adult mortality has been reported to be around 3.3%-7.7% (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Brown boobies are monogamous. Males are the only gender observed performing mating behaviors, including sky-pointing and parading. In sky-pointing, when a female first approaches, the male will stand up and throw his head into the air with neck stretched out as far as it can go. This is usually accompanied by a unique whistle. This ritual is slightly different from the other booby species, as it doesn’t involve a use of the wings. Parading is just an exaggerated form of walking, in which body posture is unusually erect with an exaggerated sway.  Other behaviors that are thought to reinforce pair bonding are mutual preening, bill touching, and bowing. Mutual preening is where each pair bond will clean the other’s feathers. Bill touching is done whenever mates return to their own territory after bowing. It has been noted that the mate reentering the territory will make their arrival call and then perform a slight bow (similar to the bow described in aggressive behavior) unless the bird reentering is flying in and its partner is on a nest, in which case that bird will perform a seated bow. This is thought to be a form of greeting.

Mating System: monogamous

Brown booby breeding season is dependent upon food availability. Events such as El Nino can drastically shift normal breeding season for a few years. In the Caribbean and east Pacific, peak breeding months are December to February. In the central Pacific, the breeding season lasts from December to March, but it's not uncommon to find them breeding year round. In Hawaii brown boobies breed from March to May. After eggs are laid, parents take turns incubating for 42 days.  Usually brown boobies lay 2 eggs but only raise one chick past the fledgling stage. It is thought that having a second egg is for insurance purposes, in case one egg doesn't make it. The first chick hatches about 2 to 4 days before the second. This chick will then push the other young from the nest with no interference from either parent. The expelled chick will usually die from heat exposure, lack of food, or predation.  The surviving chick will continue to be cared for in the pre-fledgling stage for close to 100 days, during which time both parents continue to feed and protect it.  In the post-fledgling stage, it is not uncommon for young birds to go out on their own to learn how to hunt and socialize and then return to their parents nest to be fed. This sort of behavior has been observed up to a year after reaching post-fledgling stage, but it typically lasts 50 days. This variability is thought to be the result of food availability.

Breeding interval: Brown boobies breed once yearly.

Breeding season: Brown booby breeding times vary across the world, with most breeding occuring from December to March, although breeding may be year-round in some areas.

Range eggs per season: 1 to 3.

Range time to hatching: 40 to 47 days.

Average time to hatching: 42 days.

Range fledging age: 96 to 120 days.

Average fledging age: 100 days.

Range time to independence: 42 to 365 days.

Average time to independence: 50 days.

Range age at sexual or reproductive maturity (female): 240 (low) days.

Average age at sexual or reproductive maturity (female): 1278 days.

Range age at sexual or reproductive maturity (male): 240 (low) days.

Average age at sexual or reproductive maturity (male): 1278 days.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (External )

Both male and female brown boobies incubate the eggs. Time on the nest is split evenly, with varying amount of hours per sitting. Once eggs hatch, both parents participate in feeding the young. There are no records about which gender feeds more often. When chick gets older and bigger the parents might roost away from nest but will often return to defend their nest territory and chick. This pre-fledgling care can continue up to 100 days.  Post-fledgling care can vary from 42 days up to 259 days with rare occurrences of juveniles returning to parents nest up to a year after to beg for food. This factor is thought to be controlled by local fishing conditions. If food is plentiful and easy for juveniles to catch and learn how to hunt efficiently, then it will be shorter.  There have been no documented cases of adult brown boobies showing post-fledgling chicks how to dive or hunt. However, in an experiment by Yoda et al. (2007), hand-raised chicks were often much slower to reach peak diving levels than chicks raised by parents.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); extended period of juvenile learning

  • Mellink, E. 2000. Breeding of Brown Boobies in the Gulf of California: Seasonality and apparent effects of El Nino. Waterbirds: The international Journey of Waterbird Biology, 23(3): 494-499.
  • Schreiber, E., R. Norton. 2002. Brown Booby: Sula leucogaster. The Birds of North America, 17/1: 1-26.
  • Tershey, B., D. Breese, Croll. 2003. Insurance eggs versus additional eggs: Do Brown Boobies practice obligate siblicide?. The Auk, 117(3): 817-820.
  • Yoda, K., H. Kohno, Y. Naito. 2007. Ontogeny of plunge diving behaviour in brown boobies: Application of a data logging technique to hand-raised seabirds. Deep-Sea Research Part II, Topical Studies in Oceanography, 54/3-4: 321-329.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In West Indies and Hawaii, breeding season is long, may vary annually (Kepler 1978). Egg laying occurs early December-late April in Panama (Hilty and Brown 1986), nesting probably peaks September-April in Costa Rica (Stiles and Skutch 1989). Clutch size usually is 2; normally 1 chick survives. Incubation, by both sexes in turn, lasts 40-43 days. Young can fly by about 105 days. Not highly colonial.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sula leucogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCCTGAGCTGGTATAGTTGGAACAGCACTCAGCCTACTCATCCGAGCAGAACTAGGCCAACCTGGAACTCTCCTAGGAGACGATCAAATCTACAACGTAATTGTTACCGCCCATGCCTTCGTAATAATCTTTTTTATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTAGTGCCACTCATAATTGGTGCCCCTGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCACCATCCTTCCTACTTCTTCTAGCCTCATCAACGGTAGAAGCAGGCGCGGGTACGGGATGAACTGTATACCCCCCATTAGCTGGAAACCTAGCCCACGCTGGAGCTTCAGTCGACCTAGCCATCTTCTCCCTTCACCTGGCAGGTGTATCCTCCATCCTAGGAGCAATCAACTTTATTACAACTGCAATCAACATAAAACCTCCAGCTCTCTCACAATACCAAACCCCACTATTCGTTTGATCAGTCCTCATTACCGCCGTCCTACTGCTACTCTCACTCCCAGTCCTCGCCGCTGGCATTACCATACTCTTAACGGACCGAAACCTAAACACCACATTTTTCGACCCTGCAGGAGGAGGAGACCCAGTACTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sula leucogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status in Egypt

Resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brown boobies are not considered endangered at this time and no programs promoting their conservation are in progress. Brown booby populations are considered globally stable currently.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • VanderWerf, E., K. Wood, C. Swenson, M. LeGrande, H. Eijzenga, R. Walker. 2007. Avifauna of Lehua Islet, Hawai'i: Conservation value and management needs. Pacific Science, 61(1): 39-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NHB - Possibly Extirpated

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Still widespread, but with significant historical declines.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Most colonies not visited in past 3 to 5 decades, so rangewide trend information not available (Schreiber and Norton 2002). Caribbean population has declined over past several decades (van Halewyn and Norton 1984). Extirpated from four sites in Bahamas; from Pedro Cays, Jamaica; Desecheo, Puerto Rico; Grenadines and Grenada; and possibly 3-5 other sites in West Indies (Schreiber 2000). Hawaii population apparently stable (Harrison et al. 1984).

Global Long Term Trend: Decline of 30-50%

Comments: Populations may be only 1-10 percent of those before arrival of humans (Steadman 1989; Steadman et al. 1984, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Sula leucogaster on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

According to Spennemann (1999), at the turn of the 20th century brown booby feathers were in high demand from the European and American fashion industry. These feathers were used to adorn women's hats and the "take" of such feathers led to 2 million bird deaths (not all Sula leucogaster). This demand has since died down and regulations are in place to prevent over-harvesting for the fashion industry or any other products. Several countries (e.g., Japan and Madagascar) are turning to ecotourism as a source of income and have set aside several islands with very strict regulations to preserve the natural environment. Ichiki (2003) reports that the draw of ecotourism comes from tourists wanting to see animals in their natural environment. Conveniently, brown boobies nest on these protected islands (e.g., Ogasawara Islands, Japan) and its presence be another selling point for tourists with an interest in bird-watching.

Positive Impacts: body parts are source of valuable material; ecotourism

  • Ogasawara Whale-watching Association & Bonin Ecotourism Commission. Ecotourism in Ogasawara Islands. 100-2101. Japan: Ogasawara Whale-watching Association & Bonin Ecotourism Commission. 2003. Accessed April 21, 2010 at http://www.airies.or.jp/publication/ger/pdf/07-01-03.pdf.
  • Spennemann, D. 1999. Exploitation of bird plumages in the German Mariana Islands. Micronesica, 31/2: 309-318.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown Booby

The Brown Booby (Sula leucogaster) is a large seabird of the booby family, Sulidae. They present sexual dimorphism. The female Booby reaches about 80 centimetres (31 in) in length, its wingspan measures up to 150 cm (4.9 ft), and they can weigh up to 1,300 g (2.9 lb). The male Booby reaches about 75 centimetres (30 in) in length, its wingspan measures up to 140 cm (4.6 ft), and they can weigh up to 1,000 g (2.2 lb).[2]

The Booby's head and upper body (back) is covered in dark brown or black, with the remainder (belly) being a contrasting white. The juvenile form is gray-brown with darkening on the head, wings and tail. While these birds are typically silent, bird watchers have reported occasional sounds similar to grunting or quacking. Their beaks are quite sharp and contain many jagged edges. They have short wings and long, tapered tails.

This species breeds on islands and coasts in the pantropical areas of the Atlantic and Pacific oceans. They frequent the breeding grounds of the islands in the Gulf of Mexico and the Caribbean Sea. This bird nests in large colonies, laying two chalky blue eggs on the ground in a mound of broken shells and vegetation. It winters at sea over a wider area.

Brown Booby pairs may remain together over several seasons. They perform elaborate greeting rituals, and area also spectacular divers, plunging into the ocean at high speed. They mainly eat small fish or squid which gather in groups near the surface and may catch leaping fish while skimming the surface. Although they are powerful and agile fliers, they are particularly clumsy in takeoffs and landings; they use strong winds and high perches to assist their takeoffs.

Contents

Subspecies [edit]

The 4 subspecies recognised are:

  • Sula leucogaster brewsteri Goss 1888
  • Sula leucogaster etesiaca Thayer & Bangs 1905
  • Sula leucogaster leucogaster (Boddaert) 1783
  • Sula leucogaster plotus (Forster,JR) 1844

Gallery [edit]

References [edit]

  1. ^ BirdLife International (2012). "Sula leucogaster". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Ospina-Alvarez, A. 2008. Coloniality of Brown booby (Sula leucogaster) in Gorgona National Natural Park, Eastern Tropical Pacific. Onitología Neotropical 19: 517–529.
  • Harrison, Peter (1996). Seabirds of the World. Princeton: Princeton University Press. ISBN 0-691-01551-1. 
  • Bull, John; Farrand, John, Jr (1984). The Audubon Society Field Guide to North American Birds, Eastern Region. New York: Alfred A. Knopf. ISBN 0-394-41405-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!