Overview

Distribution

Range

Australia and Tasmania; winters to New Guinea region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australia, New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Australian pelicans (Pelecanus conspicillatus) are native to Australia, Indonesia, Papua New Guinea, Solomon Islands, and Timor-Leste and vagrant to Fiji, Nauru, New Caledonia, New Zealand, Palau, and Vanuatu.

Biogeographic Regions: australian (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Australian pelicans are one of the largest flying birds. They feature a wingspan of 2.3 to 2.5 m and can weigh from 4 to 6.8 kg. They have the longest bill length of any extant bird ranging from 36 to cm. The average bill length of males is between 42 and 46 cm and in females from 36 to 41 cm. Between the bones on the lower bill is a stretchy patch of skin called the gular pouch. The gular pouch will stretch when it is filled with water and can hold up to three gallons. Pelicans also have a large nail on the tip of the upper part of the bill. They have short legs and large feet with webbing between all four toes.

Non-breeding adults have primarily white plumage. The lower back, primary wing feathers are all black. These pelicans have dark brown eyes. The bill is light pink, as is the gular pouch. The beak can also feature a dark blue stripe and the nail on the tip of the bill is yellow to orange. Their legs, feet and webbing are grey to blue-grey.

Juvenile Australian pelicans are primarily brown in color. The plumage on the head can vary from white to brown. The bill and the gular pouch are a light pink in color. Unlike non-breeding adult Australian pelicans the feet and legs are brownish grey in color instead of blueish grey.

Sexual dimorphism in this species only applies to size not plumage. Males are larger than females, but the plumage in both sexes is identical.

Range mass: 4 to 6.8 kg.

Range length: 1.6 to 1.9 m.

Range wingspan: 2.3 to 2.5 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Christie, J. 2003. Pelecaniformes (Pelicans and cormorants). Pp. 183-186 in J Jackson, W Bock, D Olendorf, M Hutchins, eds. Grzimek's Animal life Encyclopedia, Vol. 8/BIRDS 1, 2 Edition. New York: Thomson and Gale.
  • Johnsgard, P. 1993. Cormorants, darters, and Pelicans of the World. Washington: Smithsonian Institution Press.
  • Vestjens, W. 1997. Breeding Behaviour and ecology of the Australian Pelican, Pelecanus conspicillatus, in New South Wales. Australian Wildlife Research, 4/1: 37-58.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australian pelicans live very close to water in coastal inlets, shorelines, lakes, swamps and rivers of the interior. They will reside in almost any area that supports a large abundance of fish, but their major habitat is the marine intertidal zone including sandy shoreline, sandbars and spits.

Average elevation: 0 m.

Average depth: 0 m.

Habitat Regions: tropical ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fish is the main bulk of Australian pelicans' diet. They also have been known to eat prawns, amphibians, small reptiles and small mammals. These pelicans eat fish that are between 60 to 247 mm long and weigh 17 to 320 grams. Crustaceans make up a minor part of the diet, but it includes freshwater crayfish and shrimp.

Australian pelicans feed by primarily using a bill thrusting technique commonly used in other pelican species. This technique consists of tipping forward and thrusting their bill underwater to grab fish or other food items. Other times Australian pelicans will scoop the food up with their bills from shallow waters or while swimming and even when they are flying low over the surface of the water. Every so often this species is reported being seen plunging into the water from a meter or so in the air. When flocks group together to forage they corral the fish into shallow or confined areas so that they can be easily captured. Australian pelicans have been described as an opportunistic feeder meaning they will scavenge and even pirate food from other animals. In times of scarce food resources, they will even eat the young of gulls and ducklings.

Animal Foods: birds; amphibians; reptiles; fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Smith, A., U. Munro. 2008. Cannibalism in the Australian Pelican (Pelecanus conspicillatus) and Australian White Ibis (Threskiornis molucca). Waterbirds, 31/4: 632-635.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Australian pelicans play a role in dispersing plant species across their habitat. They eat fish that eat vegetation in one area. Then when the pelican moves on to another location the plant propagules are transplanted to the new location through the pelican's feces. This allows for the movement of plant species and also recolonization of plant-lacking wetlands. This dispersal can also be problematic because this may allow for the invasion and spread of exotic plant species.

Several species of nematodes (Contracaecum pyripapillatum and Contracaecum multipapillatum) use Australian pelicans as hosts.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Australian pelicans have very few predators, but within ground-nesting breeding colonies the chicks are vulnerable. Australian ravens are common predators of Australian pelican chicks. As are certain mammalian predators such as domestic dogs. Another threat to chicks are courting adults. They will move through the colony and accidentally crush eggs and destroy nests.

Australian pelican chicks' primary anti-predator defense is their formation of creches. These groups can reach sizes of 100 individuals, which may deter predation by numbers alone.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Adult pelicans have few calls and they rarely use them. Their calls include hissing, blowing, groaning, grunting, or bill-clattering. The young are much more vocal than the adults and will loudly beg for food. Australian pelicans primarily communicate with visual cues using their wings, necks, bills, and pouches, especially in courtship displays. Like all birds, Australian pelicans perceive their environment through visual, auditory, tactile, and chemical stimuli.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Typically pelicans live between 15 and 25 years in the wild. Pelicans can live longer in captivity; the longest-lived captive Australian pelican was 50 years old.

Range lifespan

Status: captivity:
50 (high) years.

Typical lifespan

Status: wild:
15 to 25 years.

Typical lifespan

Status: captivity:
15 to 25 years.

  • Beletsky, L. 2006. Birds of the World. New York: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Australian pelicans breed in large colonies, usually on islands or inland where there are few predators. Pelicans are seasonally monogamous, meaning that every breeding season they pair up with a mate and then stay with that mate for the rest of the season. The following breeding season they may or may not be with the same mate.

Courtship occurs when the local breeding population gathers at the breeding site. The large group breaks away into smaller groups consisting of a single female and two or more males. Within these smaller groups, males compete against one another for the attention of the female. Females lead the males in her group on courtship walks, swims, and flights, all the while the males display for her. The subordinate males will slowly break away and join other groups. Generally by the end of the ritual, only one male will remain. The pair will then land and begin designating a nesting site.

While the female pelican sits on the nest site, the male will perform a ritualistic display which may be followed with copulation. In order to mate the male must get on the female's back and then copulation will last from 6 to 22 seconds. They will mate several times over several hours. In between copulations the male will stand next to the female while she starts building the nest. Only after several copulations will the couple begin foraging for nest materials away from the nest.

Mating System: monogamous

Breeding usually occurs in winter or early spring, but may occur at any point in the year. Timing of breeding season is dependent upon rainfall and usually after rain events.

Australian pelicans lay approximately two, 172.9 g eggs per season, but clutch size can vary from 1 to 3. The eggs are elliptical in shape and range from 90 by 59 mm in size. Incubation lasts 32 to 35 days. At the time of hatching birds are altricial, feather-less and with eyes closed. In multi-egg nests, often one chick out-competes the others and is the sole survivor. After chicks leave the nest, they join large groups of up to 100 chicks also known as 'creches'. Chicks remain in these groups until they reach 2 months of age and are able to fly. Chicks do not reach independence for four months after hatching, when the parents stop regular feeding. Juvenile Australian pelicans reach sexual maturity at 3 to 4 years old.

Breeding interval: Australian pelicans breed once a year.

Breeding season: Australian pelicans generally breed from winter to early spring, but can occur any time throughout the year.

Range eggs per season: 1 to 3.

Range time to hatching: 32 to 35 days.

Average time to hatching: 32 days.

Average fledging age: 2 months.

Average time to independence: 4 months.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

After pairs court and mate they then share the responsibilities of nest building, incubation, and feeding their offspring. During nest building both parents collect materials for the nest. Females will remain at the nesting site collecting nearby materials and forming a ground scrape, while the males will fly away as far as a mile to find materials for the nest.

After the eggs are laid, both parents share incubation responsibilities. Parents incubate by cradling the eggs on their feet. After hatching both parents alternate hunting for food. After 25 days chicks leave the nest and form creches and parents are able to leave the chicks alone for extended periods of time.

Australian pelican parents feed their young up to the first four months of the chick’s life. While still in the nest, chicks feed whenever they are hungry. When the chick leaves the nest to join a creche, they will only return to the nest when parents return to feed the chick After feeding, the chick will return to its creche. As the chick gets older the parents will feed their young on the edge of the creche. Once the chick becomes even larger it will leave the creche and join its parents some distance away to be fed.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Johnsgard, P. 1993. Cormorants, darters, and Pelicans of the World. Washington: Smithsonian Institution Press.
  • Vestjens, W. 1997. Breeding Behaviour and ecology of the Australian Pelican, Pelecanus conspicillatus, in New South Wales. Australian Wildlife Research, 4/1: 37-58.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pelecanus conspicillatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAGTTGGGACCGCCCTTAGCTTACTCATCCGAGCAGAACTAGGCCAACCCGGGACCCTCCTAGGAGATGACCAAATCTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGACTAGTCCCCCTCATAATTGGTGCCCCAGACATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTCCTGCCTCCATCCTTCCTACTCCTGCTAGCCTCATCCACAGTAGAAGCAGGTGCAGGAACAGGATGAACTGTGTACCCCCCACTAGCTGGCAACCTAGCCCATGCTGGGGCCTCAGTGGACCTAGCTATCTTCTCACTCCACCTAGCAGGAGTATCCTCCATCCTAGGCGCAATCAACTTCATTACAACTGCCATCAACATAAAACCACCAGCCCTATCACAGTACCAAACCCCACTATTCGTGTGGTCCGTACTTATCACTGCCGTCCTACTACTGCTATCCCTCCCAGTCTTGGCCGCCGGCATCACTATGCTACTTACCGACCGGAACCTGAACACTACATTCTTCGACCCTGCTGGAGGGGGAGACCCAGTCCTATATCAACATCTATTCTGATTCTTTGGCCACCCGGAAGTCTACATCCTAATTCTCCCAGGATTTGGAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pelecanus conspicillatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Australian pelicans are of least concern because they have a very large range, their population trend is fluctuating, and their population size is very large (between 100,000 and 1,000,000 individuals).

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Australian pelicans can be habituated to human activity quite easily. This can be problematic for humans because these pelicans will directly approach humans to be fed or steal from humans because they are opportunistic feeders. This is also problematic because they get caught on fishing lines and hooks, thus disrupting fishermen's catch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pelicans have been symbols of mutual aid and love of fellow human beings. Pelican guano is also used in fertilizer, which can be very beneficial to agricultural economies. Australian pelicans in particular have no significant impact on human beings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Australian Pelican

The Australian Pelican (Pelecanus conspicillatus) is a large waterbird of the family Pelecanidae, widespread on the inland and coastal waters of Australia and New Guinea, also in Fiji, parts of Indonesia and as a vagrant to New Zealand. It is a predominantly white bird with black wings and a pink bill. It has been recorded as having the longest bill of any living bird. It mainly eats fish, but will also consume birds and scavenges for scraps.

Contents

Taxonomy

The Australian Pelican was first described by Dutch naturalist Coenraad Jacob Temminck in 1824. Its specific epithet is derived from the Latin verb conspicere "to perceive", hence "conspicuous".

Description

An Australian Pelican in flight

The Australian Pelican is medium-sized by pelican standards, with a wingspan of 2.3 to 2.6 m (7.5 to 8.5 ft).[2] Weight can range from 4 to 13 kg (8.8 to 29 lb), although most of these pelicans weigh between 4.54 and 7.7 kg (10.0 and 17 lb).[3][4][5] The pale, pinkish bill is enormous, even by pelican standards, and is the largest bill in the avian world. The record-sized bill was 50 cm (20 in) long.[6] Females are slightly smaller with a notably smaller bill, which can measure as small as 34.6 cm (13.6 in) at maturity. The total length is boasted by the bill to 152–188 cm (60–74 in), which makes it rank alongside Dalmatian Pelican as the longest of pelicans.[7]

Overall, the Australian Pelican is predominantly white in colour. There is a white panel on upper-wing and white-V on rump set against black along the primaries. During courtship, the orbital skin and distal quarter of bill are orange-coloured with the pouch variously turning dark blue, pink and scarlet. The non-breeding adult has bill and eye-ring pale yellow, pouch pale pinkish. Juvenile similar to adult, but black replaced w brown and white patch on upper wing reduced. Overall, their appearance is somewhat similar to several other pelicans, though the species is allopatric.[7]

Distribution and habitat

Swimming

This species can occur in large expanses of Australia and Tasmania. Australian Pelicans occur primarily in large expanses of open water without dense aquatic vegetation. The habitats that can support them include large lakes, reservoirs, billabongs and rivers, as well as estuaries, swamps, temporarily flooded areas in arid zones, drainage channels in farmland, saltplans and coastal lagoons. The surrounding environment is unimportant: it can be forest, grassland, desert, estuarine mudflats, an ornamental city park, or industrial wasteland, provided only that there is open water able to support a sufficient supply of food. However, they do seem to prefer areas where disturbance is relatively low while breeding. They may also roost in mudflats, sandbars, beaches, reefs, jetties and piles.[7]

The species became first known to occur in New Zealand from a specimen shot at Jerusalem in 1890 and small numbers of subfossil bones, the first found at Lake Grassmere in 1947, followed by records of other stray individuals. The bones were later described as a new (sub)species, Pelecanus (conspicillatus) novaezealandiae (Scarlett, 1966: "New Zealand Pelican") as they appeared to be larger, but Worthy (1998), reviewing new material, determined that they were not separable from the Australian population. These fossils were first found in 1930.

Australian Pelicans follow no particular schedule of regular movement, simply following the availability of food supplies. Drought frequently precedes movements. When the normally barren Lake Eyre filled during 1974 to 1976, for example, only a handful of pelicans remained around the coastal cities: when the great inland lakes dried again, the population dispersed once more, flocks of thousands being seen on the northern coasts. On some occasions, they are simply blown by the wind to new locations. It is a fairly regular visitor to the southern coast of New Guinea, as well as the Bismarck Islands and Solomon Islands. It occurs as a vagrant to Christmas Island, Vanuatu, Fiji, Palau and New Zealand. A population irruption occurred in 1978 into Indonesia, with Australian Pelicans reaching Sulawesi, Java and possibly also Sumatra.[7]

Feeding

Australian Pelicans feed by plunge-diving while swimming on the surface of the water. They work in groups to drive fish to shallower water, where they stick their sensitive bills in to snatch their prey. Some feeding grounds in large bodies of water have included up to 1,900 individual birds. They will sometimes also forage solitarily. Their predominant prey is fish and they commonly feed on introduced species such as goldfish, European carp and European perch. When possible, they also predate native fish, with a seeming preference for the perch Leiopotherapon unicolour. However, the Australian Pelican seems to be less of a piscivore and more catholic in taste than other pelicans. It regularly feeds on insects and many aquatic crustaceans, especially the Common yabby and the shrimps in the Macrobrachium genus. This pelican also takes other birds with some frequency, such as Silver gulls and Grey teal, including eggs, nestlings, fledgings and adults, which they kill by pinning them underwater and drowning them. Reptiles and amphibians are also taken when available. Reportedly even small dogs have been swallowed. The Australian Pelican is an occasional kleptoparasitic of other water birds, such as cormorants.[7]

Breeding

Samsonvale Cemetery, SE Queensland, Australia

The Australian Pelican begins breeding at two or three years of age. Breeding season varies, occurring in winter in tropical areas (north of 26oS) and late spring in parts of southern Australia. Breeding may occur any time after rainfall in inland areas. The nest is a shallow depression in earth or sand, sometimes with some grass lining. Grassy platforms are constructed at Lake Alexandrina in South Australia. Rarely, slightly more elaborate nests have also been observed on top of Muehlenbeckia florulenta bushes.[7] Nesting is communal, with colonies located on islands (such as the North Peron Island) or sheltered areas in the vicinity of lakes or the sea. Breeding Australian pelicans will lay one to four (typically two) chalky-white eggs measuring 93 mm × 57 mm (3.7 in × 2.2 in), which often appear scratched and dirty.[8] The eggs are incubated for 32 to 35 days. The chicks are naked when they hatch, though quickly grow grey down feathers. After they hatch, the larger one will be fed more, and the smaller one will eventually die of starvation or siblicide. For the first two weeks the chicks will be fed regurgitated liquid, but for the remaining two months they will be fed fish and some invertebrates. Feeding pods are formed within colonies when the chicks are around 25 days. The young pelicans fledge at around three months of age.

Status

The Australian Pelican is not globally threatened. They are usually fairly common in proper habitats. At the afforementioned temporarily Lake Eyre in March 1990, over 200,000 adult birds were found to be breeding. The species is legally protected and does not seem to be showing any immediate adverse effects from pollution. In several areas, they may associate with humans and may even beg for hand-outs, although are quite sensitive to extensive human disturbances while nesting. It will readily adapt to artificial bodies of water such as reservoirs so long as there is no regular boating in them. Due to the popularity of open water spots, the habitat of this pelican has suffered considerably less than more vegetated wetlands throughout Australia.[7] The Australian Pelican is evaluated as Least Concern on the IUCN Red List of Threatened Species.[1]

References

  1. ^ a b BirdLife International (2012). "Pelecanus conspicillatus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106003813. Retrieved 16 July 2012.
  2. ^ Birds in Backyard
  3. ^ Australian Animals — Pelican (2010).
  4. ^ Species — Marine Biology (2010).
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5
  6. ^ [1] (2011).
  7. ^ a b c d e f g del Hoyo, J; Elliot, A; Sargatal, J (1996). Handbook of the Birds of the World 3. Barcelona: Lynx Edicions. ISBN 84-87334-20-2. 
  8. ^ Beruldsen, G (2003). Australian Birds: Their Nests and Eggs. Kenmore Hills, Qld: self. p. 187. ISBN 0-646-42798-9. 
  • Scarlett, R. J. (1966): A Pelican in New Zealand. Notornis 13(4): 204-217. PDF fulltext
  • Worthy, Trevor H. (1998): A remarkable fossil and archaeological fauna from Marfells Beach, Lake Grassmere, South Island, New Zealand. Records of the Canterbury Museum 12: 79-176.
  • Australian PelicanAustralian Museum Online

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!