Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Biology

Comb ducks are usually found in single pairs or small groups (harems) during the breeding season, and in groups of up to 30 to 40 birds at other times. The diet consists mainly of vegetable matter, such as aquatic vegetation, seeds of grasses and sedges, grain (including crops such as rice and corn), as well as various invertebrates, such as aquatic insect larvae and locusts (2) (8). Comb ducks usually nest close to water, in large tree cavities, holes in the walls of isolated buildings, abandoned nests of other birds, or sometimes on the ground. The nest is a rough structure built from twigs and course grass, and is lined with grass, leaves and feathers (2) (8). The breeding season is variable, but usually coincides with the rainy season (2). In some areas comb ducks are monogamous, while in others males may hold small harems of two to four females, which they defend against other males (5) (10). Between 6 and 20 eggs may be laid (2), though nests sometimes contain the eggs of more than one female (5). Incubation lasts 28 to 30 days, and is performed exclusively by the female (2) (10). Within just a day or two of hatching, the ducklings leap from the nest, which may be up to 12 metres above the ground (8), when summoned by the female (5). Fledging occurs at about ten weeks (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The goose-like comb duck gets its common name from the large, fleshy, dark grey growth or 'comb' on the top of the male's black beak (3) (5), an unusual and distinctive structure which enlarges during the breeding season (2) (6). Male comb ducks are large birds, with glossy blue-black or green-black upperparts, tail and wings, white underparts and pale grey flanks. The top of the head and back of the neck are black, and the rest of the head is white, speckled black, with yellow tinges on the sides and on the neck during the breeding season. Narrow black bands run along the sides of the upper breast. The comb duck's legs and feet are dark grey, and the eyes dark brown (3) (7). Females are slightly smaller than males, with less glossy plumage, less well-defined black breast bands, more speckling on the head, which lacks any yellowish tinge, and sometimes with brownish mottling on the underparts. Females also lack the male's 'comb' (3) (5) (7). Young comb ducks are brownish, with a dark eye-stripe, and attain adult plumage in the second year (2) (3) (7). There are two subspecies of comb duck: the Old World comb duck, Sarkidiornis melanotos melanotos, and the South American comb duck, Sarkidiornis melanotos sylvicola, which was previously treated as a separate species and is still considered a full species by some (2) (7) (8). South American comb ducks are distinguished from their Old World counterparts by their smaller size, smaller comb, and darker sides and flanks, which are glossy black in the male and dark grey or brown in the female (3) (7) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The comb duck has a wide distribution across sub-Saharan Africa, Madagascar, South and Central America, and tropical Asia, including Cambodia, China, India, Japan and Vietnam. S. m. sylvicola is found throughout South America, east of the Andes, as well as in Panama and Trinidad, while S. m. melanotos is found in Africa and Asia (2) (7) (8). In Africa, comb ducks are partially migratory, undertaking sometimes extensive seasonal journeys in response to dry season water availability (2) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an intra-African migrant6 undertaking poorly-understood1, 2, 6 seasonal movements in relation to water availability1, 2. It breeds during the wet season in single pairs or small groups1, 2 (harems)2, and outside of the breeding season usually occurs in small parties of up to 30-40 individuals4. Large flocks also gather in the dry (non-breeding) season2 on suitable waters4, but these break up and disperse to breeding grounds at the onset of the rains2. Habitat This species inhabits grassy ponds or lakes in savanna, open woodlands along large rivers and lakes3, swamps1, marshes, floodplains, river deltas2, 5, flooded forest, pastures and rice-paddies5 and occasionally sandbars and mudflats3. Diet Its diet consists largely of vegetable matter, including the seeds of grasses and sedges, the soft parts of aquatic plants (e.g. water-lilies)2, agricultural grain (e.g. rice, corn, oats3, wheat and groundnuts6) as well as aquatic insect larvae and locusts1, 2, 3. Breeding site The species nests close to water2, 4, 5, building rough structures of twigs and coarse grass1 in large hollow tree cavities4, 5, between 7 and 12 m high2, or in holes in the walls of isolated buildings4 (or other cavities with a floor diameter of c.200 mm5). It may also use the abandoned nests of other bird species, such as Hamerkop Scopus umbretta2, 4, 5, or nest on the ground1 in the shelter of tall grass or on tree stumps3. When the species is tree nesting, the same cavity may be used from year to year2.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Swamps, rivers and lakes in open or lightly wooded areas, as well as more open grassland, marshes, floodplains, flooded forest, pastures and rice-paddies (2) (7) (8). Comb ducks are also often seen away from water, flying over woodland or perched in dead trees (6). Although mainly found in lowlands, they have also been reported up to elevations as high as 3,500 metres (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sarkidiornis melanotos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTTATCTTTGGAGCATGAGCTGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCAGAGCTAGGCCAACCAGGGACCCTCCTAGGCGATGACCAAATTTACAACGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATCATAATTGGAGGATTTGGCAACTGATTAGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCGCCCTCATTCCTCCTACTACTCGCCTCATCCACCGTAGAAGCCGGCGCCGGCACAGGCTGAACCGTATACCCACCCCTAGCAGGCAACCTAGCCCATGCTGGAGCCTCAGTAGACCTGGCTATCTTCTCACTCCACTTAGCCGGCATCTCCTCCATCCTTGGGGCCATTAACTTTATCACCACAGCCATCAACATAAAACCCCCTGCGCTCTCACAATACCAAACCCCACTCTTCGTCTGATCCGTCCTAATCACCGCCATCCTGCTTCTCCTGTCACTACCTGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGAGGAGGGGACCCGATCCTGTACCAGCACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sarkidiornis melanotos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by hunting1 (e.g. in Madagascar)5, habitat destruction5 (e.g. from deforestation)1, and indiscriminate use of poison in rice-fields1. The species has declined in the Senegal Delta following the damming of the Senegal River (which has resulted in habitat degradation and loss from vegetation overgrowth, desertification processes and land conversion to agriculture)7. This species is also susceptible to avian influenza, so is potentially threatened by future outbreaks of the virus8.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although widely distributed, and with a large population in Africa, the comb duck is scarcer and probably declining in Asia, and is considered under threat in South America (2) (7). The main threats to the comb duck include habitat destruction, overhunting and, in South America, the use of poison against foraging wildfowl in rice fields (2) (7) (8). The comb duck is also susceptible to avian influenza, so is potentially threatened by future outbreaks of this virus (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The comb duck is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning international trade in comb ducks should be carefully monitored and controlled (4). It is also listed under Appendix II of the Convention on Migratory Species (CMS), which aims to conserve migratory species throughout their range and lists species that would benefit from international co-operation (11), and on Annex 2 of the associated African-Eurasian Waterbird Agreement (AEWA), which calls upon parties to engage in a range of conservation actions to help protect and conserve bird species that are dependent on wetlands for at least part of their annual cycle (12). The comb duck is currently part of a satellite tracking programme aimed at improving understanding of wild duck behaviour and migratory routes in light of the spread of Highly Pathogenic Avian Influenza (HPAI) H5N1 virus (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Knob-billed Duck

The Knob-billed Duck (Sarkidiornis melanotos), or Comb Duck, is an unusual, pan-tropical duck, found in tropical wetlands in sub-Saharan Africa, Madagascar and south Asia from Pakistan to Laos and extreme southern China. It also occurs in continental South America south to the Paraguay River region in eastern Paraguay, southeastern Brazil and the extreme northeast of Argentina,[2] and as a vagrant on Trinidad.

It is the only known species of the genus Sarkidiornis. The supposed extinct "Mauritian Comb Duck" is based on misidentified remains of the Mauritian Shelduck (Alopochen mauritianus); this was realized as early as 1897,[3] but the mistaken identity can still occasionally be found in recent sources.

Contents

Description and systematics [edit]

This common species is unmistakable. It is one of the largest species of duck. Length can range from 56 to 76 cm (22 to 30 in), wingspan ranges from 116 to 145 cm (46 to 57 in) and weight from 1.03 to 2.9 kg (2.3 to 6.4 lb).[4][5][6] Adults have a white head freckled with dark spots, and a pure white neck and underparts. The upperparts are glossy blue-black upperparts, with bluish and greenish iridescence especially prominent on the secondaries (lower arm feathers). The male is much larger than the female, and has a large black knob on the bill. Young birds are dull buff below and on the face and neck, with dull brown upperparts, top of the head and eyestripe.[7][8]

Immature Knob-billed Ducks look like a large greyish female of the Cotton Pygmy Goose (Nettapus coromandelicus) and may be difficult to tell apart if no other birds are around to compare size and hue. If seen at a distance, they can also be mistaken for a Fulvous Whistling-duck (Dendrocygna bicolor) or a female Maned Duck (Chenonetta jubata). The former is more vividly colored, with yellowish and reddish brown hues; the latter has a largely dark brown head with white stripes above and below the eye. However, Knob-billed Ducks in immature plumage are rarely seen without adults nearby and thus they are usually easily identified too.[7]

The Knob-billed Duck is silent except for a low croak when flushed.[8]

There are two easily distinguished subspecies.,[7] in fact, some taxonomists consider them to be distinct species:

Larger; flanks lighter (light grey, in females sometimes whitish)
Smaller; flanks darker (black in males, medium grey in females).

Uncertainty surrounds the correct systematic placement of this species. Initially, it was placed in the dabbling duck subfamily Anatinae. Later, it was assigned to the "perching ducks", a paraphyletic assemblage of waterfowl most of which are intermediate between dabbling ducks and shelducks. As the "perching ducks" were split up, the Knob-billed Duck was moved to the Tadorninae or shelduck subfamily.[7] In addition, Some taxonomists separate the two subspecies into distinct species.

Analysis of mtDNA sequences of the cytochrome b and NADH dehydrogenase subunit 2 genes, however, suggests that it is a quite basal member of the Anatidae, vindicating the earliest placement. But its closest living relatives cannot be resolved to satisfaction without further study.[10]

Ecology [edit]

It breeds in still freshwater swamps and lakes in the tropics. It is largely resident, apart from dispersion in the wet season.[7]

This duck feeds on vegetation by grazing or dabbling[7] and to a lesser extent on small fish, invertebrates, and seeds. It can become a problem to rice farmers. Knob-billed Ducks often perch in trees. They are typically seen in flocks, small in the wet season, up to 100 in the dry season. Sometimes they separate according to sex.[8][11]

The Knob-billed Duck is declining in numbers locally, but due to its wide range it is not considered globally threatened by the IUCN.[1] It is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds applies.

Reproduction [edit]

African birds breed during and after the rainy season and may not breed if the rain is scanty. Knob-billed Ducks nest mainly in tree holes,[7] also in tall grass. They line their nests with reeds, grass, or feathers, but not down.[11]

Males may have two mates at once or up to five in succession. They defend the females and young but not the nest sites. Unmated males perch in trees and wait for opportunities to mate.[11]

Females lay 7 to 15[7] yellowish-white eggs. Several females may lay in a single "dump nest" containing up to 50 eggs.[11]

References [edit]

  1. ^ a b BirdLife International (2012). Sarkidiornis melanotos. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2.
  2. ^ Bencke, Glayson Ariel (2007): Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais ["The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects"]. Talk held on 22 June 2007 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract
  3. ^ Andrews, C.W. (1897). "On some fossil remains of Carinate birds from central Madagascar". Ibis 7 (3): 343–359. doi:10.1111/j.1474-919X.1897.tb03281.x. 
  4. ^ Ogilvie & Young, Wildfowl of the World. New Holland Publishers (2004), ISBN 978-1-84330-328-2
  5. ^ Hilty, Steven L. (2002). Birds of Venezuela. Princeton University Press. pp. 197–. ISBN 978-1-4008-3409-9. 
  6. ^ Sarkidiornis melanotos (Comb duck, Knob-billed duck). biodiversityexplorer.org
  7. ^ a b c d e f g h Madge, Steve & Burn, Hilary (1987): Wildfowl: an identification guide to the ducks, geese and swans of the world. Christopher Helm, London. ISBN 0-7470-2201-1
  8. ^ a b c Zimmerman, Dale A.; Turner, Donald A., & Pearson, David J. (1999): Birds of Kenya and Northern Tanzania. Princeton University Press, Princeton. ISBN 0-691-01022-6
  9. ^ Presumably after Naak meaning nose.E. H. Johnston (1936) Bird-Names in the Indian Dialects. Bulletin of the School of Oriental Studies 8(2/3):599-601.
  10. ^ Johnson, Kevin P. & Sorenson, Michael D. (1999). PDF "Phylogeny and biogeography of dabbling ducks (genus: Anas): a comparison of molecular and morphological evidence". Auk 116 (3): 792–805. doi:10.2307/4089339. 
  11. ^ a b c d Honolulu Zoo (2007): Comb Duck. Retrieved 2007-06-08.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!