Overview

Brief Summary

Biology

The ruddy-headed goose is generally seen in flocks, often mixing with the upland goose (Chloephaga picta) and the ashy-headed goose (Chloephaga poliocephala) (5). Almost entirely vegetarian, the ruddy-headed goose feeds on roots, leaves, stems, and the seed-heads of grasses and sedges (8). These geese rarely swim, preferring instead to forage in natural grasslands, pastures and agricultural lands (5), where it often digs out food with its bill. While the Falkland Islands population is virtually sedentary, the mainland population moves north in winter, from Tierra del Fuego to the grasslands, pastures and croplands of southern Buenos Aires province (6) (9). The ruddy-headed goose breeds in September and October. Nests lined with down are constructed among vegetation or boulders. Five to eight eggs are laid into this nest and are incubated for around 30 days (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The ruddy-headed goose has boldly patterned plumage, with fine brown and blackish barring on the shoulders and breast, becoming more distinct on the flanks. From the shoulders, the barring merges into the grey-brown plumage of the back, blending into a dark grey tail (2). As its name suggests, the ruddy-headed goose has a reddish-brown head, with an indistinct white ring around the eye. Its relatively short bill is black, and the orange legs bear distinct black marks on the knee joints and on the feet. Male ruddy-headed geese can be distinguished by their larger size, and also by their high, whistling call, which contrasts with the female's lower, short, quacking sound (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species breeds on northern Tierra del Fuego Island (Chile and Argentina) and southern Santa Cruz, wintering in southern Buenos Aires, Argentina; there is also a virtually sedentary population on the Falkland Islands (Malvinas) (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Tierra del Fuego and Falkland Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The ruddy-headed goose is broadly divided into two populations. The mainland population breeds in southern Patagonia of Chile and Argentina, and winters at the southern end of Buenos Aires Province, Argentina. The Falkland Islands population remains on the islands all year round. Whilst the Falkland Islands population is not threatened, the mainland population has suffered serious declines (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is found in open country, frequenting coastal grassland and meadows, often with Upland Goose C. picta and Ashy-headed Goose C. poliocephala (Argentina only). It feeds on roots, leaves, stems and seed-heads of grasses and sedges in natural grasslands, pastures and agricultural lands (del Hoyo et al. 1992). It nests from late September to early November in the Falklands, with nests recorded until January on Tierra del Fuego (Woods and Woods 1997, Chebez 1994).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the Falklands, the ruddy-headed goose inhabits flooded meadows and open grasslands. On mainland Patagonia, the goose can be found in freshwater marshes (mallines and vegas), moving to the grasslands, pastures and croplands of southern Buenos Aires province in the winter (5) (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chloephaga rubidiceps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTCATCAATCGATGACTATTCTCTACCAACCACAAAGATATCGGCACCCTGTATCTCATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTATTAATCCGCGCAGAACTAGGCCAACCGGGAACCCTCCTGGGTGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCTTTTGTAATAATTTTCTTCATGGTAATGCCCATCATAATCGGGGGATTCGGCAACTGATTGGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTTCCACGGATGAACAATATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTACTCCTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCGCCCCTGGCAGGCAACCTAGCCCACGCTGGGGCCTCAGTAGATCTGGCCATCTTCTCGCTCCATTTAGCCGGCGTTTCCTCTATCCTCGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAGACCCCACTCTTCGTCTGATCCGTCCTAATCACCGCCATCCTGCTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATACTACTGACCGACCGAAACCTAAACACCACATTCTTTGACCCCGCTGGGGGAGGAGACCCGATCCTGTACCAGCACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCGGGATTCGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chloephaga rubidiceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/near threatened (LR/nt)
  • Threatened (T)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5