Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chloephaga picta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTCATCTTCGGGGCATGAGCCGGAATGATTGGCACAGCACTCAGCCTATTAATCCGCGCAGAACTAGGCCAACCAGGAACCCTTCTGGGTGACGACCAAATTTACAACGTAATCGTCACCGCCCACGCTTTTGTAATAATTTTCTTCATAGTAATGCCCATCATAATCGGAGGATTCGGCAACTGATTGGTCCCCCTAATAATCGGCGCCCCCGACATAGCATTCCCACGGATGAACAATATAAGCTTCTGACTCCTCCCGCCATCATTTCTCCTACTCCTCGCCTCATCCACCGTAGAAGCTGGCGCCGGCACAGGCTGAACCGTGTACCCACCCCTAGCAGGCAACCTGGCCCACGCTGGGGCCTCAGTAGACCTGGCCATCTTCTCGCTCCACTTAGCCGGCGTTTCCTCTATCCTCGGGGCCATTAACTTCATCACCACAGCCATCAACATAAAACCCCCTGCACTCTCACAATACCAGACCCCCCTCTTCGTCTGATCCGTCCTAATCACCGCTATCCTACTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATACTACTGACTGACCGAAACCTAAACACCACATTCTTTGACCCCGCCGGGGGAGGAGACCCGGTCCTGTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chloephaga picta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Upland goose

The upland goose or Magellan Goose (Chloephaga picta) is a sheldgoose of the shelduck-sheldgoose subfamily of the Anatidae, the biological family that includes the ducks and most duck-like waterfowl such as the geese and swans. This bird is indigenous to the southern part of South America.[1]

Description[edit]

female Upland goose caring for her offspring, El Calafate, Argentina

These birds are 60–72.5 centimetres (23.6–28.5 in) long and weigh 2.7–3.2 kilograms (6.0–7.1 lb).[2] Males have a white head and breast, whereas the females are brown with black-striped wings and yellow feet, and could be mistaken for ruddy-headed geese. A greenish-bronze speculum is located on the inner secondary flight feathers of the adult male.[3]

In Chapter VI of On the Origin of Species, author Charles Darwin noted that the upland goose has webbing between its toes that appeared to be "rudimentary in function, though not in structure", and concluded that this was a vestigial anatomical feature in this bird.[4]

Distribution and habitat[edit]

They are found in southern temperate grasslands, arid lowland scrubs, pastures and agricultural lands, from sea level up to around 1,500 meters.[3] There is also a sizeable introduced population on the sub-Antarctic South Georgia Island.[5]

References[edit]

  1. ^ a b BirdLife International (2012). "Chloephaga picta". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Wildlife Information Network (2013). "Chloephaga picta - Upland goose". Wildpro - the electronic encyclopaedia and library for wildlife. Wildlife Information Network. Retrieved 2013-02-17. 
  3. ^ a b Stang, D (2012). "Chloephaga picta (Magellan/Upland Goose)". ZipcodeZoo. Potomac Maryland: ZipcodeZoo.com. Retrieved 2013-02-17. 
  4. ^ Darwin, C (1859). "Difficulties on theory". On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life (Full image view 1st ed.). London: John Murray. pp. 171–206. 
  5. ^ A Field Guide to the Wildlife of South Georgia; Princeton University Press 2012


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!