Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

S Argentina and Chile; winters north to s Brazil and Paraguay.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oxyura vittata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTGTATCTTATCTTTGGGGCGTGAGCAGGAATGATCGGCACCGCACTCAGCCTGCTAATTCGCGCGGAACTAGGTCAACCAGGAACTCTTCTAGGAGACGACCAGATCTACAACGTAATTGTCACTGCCCATGCCTTCGTAATGATCTTCTTCATGGTTATGCCAATCATAATCGGGGGATTCGGCAACTGACTGGTCCCTCTCATAATCGGTGCCCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGACTCCTCCCACCCTCGTTCCTCCTACTATTAGCCTCATCCACCGTAGAAGCCGGCGCCGGCACAGGATGAACCGTCTATCCCCCCTTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTTCACCTAGCTGGTGTCTCATCCATCCTCGGAGCCATCAACTTCATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACACCTCTATTCGTCTGATCCGTCCTAATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTAGCCGCCGGCATCACAATACTACTCACTGACCGAAACCTAAACACTACGTTCTTTGACCCTGCAGGAGGGGGAGACCCAATCCTGTATCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oxyura vittata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lake Duck

Females

The Lake Duck (Oxyura vittata) is a small, South American stiff-tailed duck. It is also called the Argentine Blue-bill, Argentine Lake Duck, or Argentine Ruddy Duck.

The Lake Duck lives in Argentina, Chile, Paraguay, and Brazil in southern South America.[1]

It is notable for possessing, in relation to body length, the longest penis of all vertebrates; the penis, which is typically coiled up in flaccid state, can reach about the same length as the animal itself when fully erect, but more commonly is about half the bird's length.[2][3] It is theorized that the remarkable size of their spiny penises with bristled tips may have evolved in response to competitive pressure in these highly promiscuous birds, removing sperm from previous matings in the manner of a bottle brush.

Although most male birds have no penis,[4] ducks have a long corkscrew penis, and the females have a long corkscrew vagina, which spirals in the opposite direction.[5] The males often try to force copulation, but the complex mating geometry allows the females to retain control—most forced copulations do not result in successful fertilization.[6]

References[edit]

  1. ^ a b BirdLife International (2012). "Oxyura vittata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ McCracken, Kevin G. (2000). "The 20-cm Spiny Penis of the Argentine Lake Duck (Oxyura vittata)" (PDF). The Auk 117 (3): 820–825. 
  3. ^ McCracken, Kevin G.; Wilson, Robert E.; McCracken, Pamela J.; Johnson, Kevin P. (2001). "Sexual selection: Are ducks impressed by drakes' display?" (PDF). Nature 413: 128. doi:10.1038/35093160. 
  4. ^ Found! The longest bird penis ever › News in Science (ABC Science)
  5. ^ Duck genitals locked in arms race | COSMOS magazine
  6. ^ Brennan, Patricia L. R.; Prum, Richard O.; McCracken, Kevin G.; Sorenson, Michael D.; Wilson, Robert E.; Birkhead, Tim R. (2 May 2007). "Coevolution of Male and Female Genital Morphology in Waterfowl". PLoS ONE 2 (5): e418. doi:10.1371/journal.pone.0000418. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!