Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

The Mandarin duck breeds in eastern Siberia, China, and Japan and winters in southern China and Japan. There is a small free-flying population in Britain stemming from the release captive bred ducks.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Wooded ponds, swamps and streams of ne Asia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In full plumage, the male has a pair of "sail" feathers that are raised vertically above the back, a crest of orange and cream feathers, and a broad white eye-stripe that is bounded above and below by darker feathers. The female is duller in color and has an overall grey appearance marked by a curving white stripe behind the eye and a series of white blotches on the underparts. In flight, both sexes display a bluish-green iridescent speculum.

Range mass: 428 to 693 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Aix galericulata
Catalog Number: USNM 114766
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): F. Ringer
Locality: Kyushu, Japan, Asia
  • Type: Clark. May 11, 1914. Proc. Biol. Soc. Washington. 27: 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Aix galericulata
Catalog Number: USNM 114766
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): F. Ringer
Locality: Kyushu, Japan, Asia
  • Type: Clark. May 11, 1914. Proc. Biol. Soc. Washington. 27: 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Mandarin lives in the forests of China and Japan. They prefer wooded ponds and fast flowing rocky streams to swim, wade, and feed in.

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Mandarin Duck's basic diet consists of water plants, rice and other grains.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mandarin courtship display is very impressive and includes mock-drinking and shaking. Pairs are formed at the beginning of the winter and may continue for many seasons. Although the female chooses the exact nesting site, the male accompanies the female on nest searches. Nest are alway in a hole in a tree and can be up to thirty feet from the ground. In preparation for egg laying, the female lines the nest is with down. Clutch sizes range from nine to twelve white oval eggs that are laid at daily intervals. Incubation is solely performed by the female and last between 28 and 30 days. When all the eggs are hatched (they hatch within a few hours of each other), the mother calls to the chicks from the ground. Each chick then crawls out of the hole and launches itself into a free fall. Amazingly, all the chicks land unhurt and are en route to the nearest feeding ground. Once the chicks are able to fly (after 40-45 days), they leave to join a new flock.

Range eggs per season: 9 to 12.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aix galericulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTATTCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCGGAACTAGGCCAACCAGGAACCCTCCTAGGCGATGATCAAATCTATAACGTAATCGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATGGTGATACCCATCATAATTGGAGGATTCGGCAATTGACTAGTCCCCCTAATAATTGGCGCCCCTGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTTCCACCCTCATTCCTCCTACTGCTCGCCTCATCTACCGTGGAAGCTGGCGCCGGTACAGGCTGAACCGTGTACCCACCCCTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCACTTAGCCGGTGTTTCCTCCATCCTCGGAGCCATTAACTTCATTACTACGGCCATCAACATAAAACCTCCCGCACTCTCACAATACCAAACTCCACTCTTCGTCTGATCCGTCCTAATTACTGCCATCCTACTCCTCCTGTCCCTCCCCGTTCTTGCCGCTGGCATCACAATGCTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aix galericulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/near threatened (LR/nt)
  • Near Threatened (NT)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5