Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

The Mandarin duck breeds in eastern Siberia, China, and Japan and winters in southern China and Japan. There is a small free-flying population in Britain stemming from the release captive bred ducks.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Wooded ponds, swamps and streams of ne Asia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

In full plumage, the male has a pair of "sail" feathers that are raised vertically above the back, a crest of orange and cream feathers, and a broad white eye-stripe that is bounded above and below by darker feathers. The female is duller in color and has an overall grey appearance marked by a curving white stripe behind the eye and a series of white blotches on the underparts. In flight, both sexes display a bluish-green iridescent speculum.

Range mass: 428 to 693 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Aix galericulata
Catalog Number: USNM 114766
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): F. Ringer
Locality: Kyushu, Japan, Asia
  • Type: Clark. May 11, 1914. Proc. Biol. Soc. Washington. 27: 87.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The Mandarin lives in the forests of China and Japan. They prefer wooded ponds and fast flowing rocky streams to swim, wade, and feed in.

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Mandarin Duck's basic diet consists of water plants, rice and other grains.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mandarin courtship display is very impressive and includes mock-drinking and shaking. Pairs are formed at the beginning of the winter and may continue for many seasons. Although the female chooses the exact nesting site, the male accompanies the female on nest searches. Nest are alway in a hole in a tree and can be up to thirty feet from the ground. In preparation for egg laying, the female lines the nest is with down. Clutch sizes range from nine to twelve white oval eggs that are laid at daily intervals. Incubation is solely performed by the female and last between 28 and 30 days. When all the eggs are hatched (they hatch within a few hours of each other), the mother calls to the chicks from the ground. Each chick then crawls out of the hole and launches itself into a free fall. Amazingly, all the chicks land unhurt and are en route to the nearest feeding ground. Once the chicks are able to fly (after 40-45 days), they leave to join a new flock.

Range eggs per season: 9 to 12.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aix galericulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTATTCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTGCTAATCCGCGCGGAACTAGGCCAACCAGGAACCCTCCTAGGCGATGATCAAATCTATAACGTAATCGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATGGTGATACCCATCATAATTGGAGGATTCGGCAATTGACTAGTCCCCCTAATAATTGGCGCCCCTGACATGGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTTCCACCCTCATTCCTCCTACTGCTCGCCTCATCTACCGTGGAAGCTGGCGCCGGTACAGGCTGAACCGTGTACCCACCCCTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCACTTAGCCGGTGTTTCCTCCATCCTCGGAGCCATTAACTTCATTACTACGGCCATCAACATAAAACCTCCCGCACTCTCACAATACCAAACTCCACTCTTCGTCTGATCCGTCCTAATTACTGCCATCCTACTCCTCCTGTCCCTCCCCGTTCTTGCCGCTGGCATCACAATGCTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTTTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aix galericulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Derstruction of habitat has had a severe impact on the oriental populations of Mandarins. In 1911, the Tung Ling forest, a Mandarin stronghold, was opened up for settlement and thereafter forests were cleared. By 1928 few sufficient breeding areas remained. The current Asian population may be under 20,000 birds. One factor that has helped the Mandarin to survive is their bad taste. These ducks are not hunted for food.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c. 65,000-66,000 individuals (Wetlands International 2006), while national population estimates include: c.100-10,000 breeding pairs and
Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

They have been exported to the west, namely Britain, since 1745. They are bred in captivity by European avicultururalists.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mandarin duck

The Mandarin duck (Aix galericulata), or just Mandarin, is a perching duck species found in East Asia. It is medium-sized, at 41–49 cm long with a 65–75 cm wingspan. As the other member of the genus Aix, it is closely related to the North American wood duck.

Description[edit]

The adult male is a striking and unmistakable bird. It has a red bill, large white crescent above the eye and reddish face and "whiskers". The breast is purple with two vertical white bars, and the flanks ruddy, with two orange "sails" at the back. The female is similar to female wood duck, with a white eye-ring and stripe running back from the eye, but is paler below, has a small white flank stripe, and a pale tip to its bill.[2]

Mandarin ducklings are almost identical in look to wood ducklings, and appear very similar to mallard ducklings. The ducklings can be distinguished from mallard ducklings because the eye-stripe of Mandarin ducklings (and wood ducklings) stops at the eye, while in mallard ducklings it reaches all the way to the bill.[citation needed]

Mutations[edit]

There are various mutations of the Mandarin duck found in captivity. The most common is the white Mandarin duck. Although the origin of this mutation is unknown, it is presumed that the constant pairing of related birds and selective breeding led to recessive gene combinations leading to genetic conditions including albinism.[3]

Distribution and habitat[edit]

The native range of the Mandarin duck, and parts of its introduced range where it is established breeding. Yellow: breeding, dark green: native resident, light blue: migrant, dark blue: winter visitor, light green: introduced resident.

The species was once widespread in East Asia, but large-scale exports and the destruction of its forest habitat have reduced populations in eastern Russia and in China to below 1,000 pairs in each country; Japan, however, is thought to still hold some 5,000 pairs. The Asian populations are migratory, overwintering in lowland eastern China and southern Japan.[4]

Specimens frequently escape from collections, and in the 20th century a large feral population was established in Great Britain; more recently small numbers have bred in Ireland, concentrated in the parks of Dublin. There are now about 7,000 in Britain, and other populations on the European continent, the largest in the region of Berlin.[5] Isolated populations exist in the United States. The town of Black Mountain, North Carolina has a limited population,[6] and there is a free-flying feral population of several hundred mandarins in Sonoma County, California. This population is the result of several Mandarin ducks escaping from captivity, then going on to reproduce in the wild.[2]

The habitats it prefers in its breeding range are the dense, shrubby forested edges of rivers and lakes. It mostly occurs in low-lying areas, but it may breed in valleys at altitudes of up to 1,500 metres (4,900 ft). In winter, it additionally occurs in marshes, flooded fields, and open rivers. While it prefers freshwater, it may also be seen wintering in coastal lagoons and estuaries. In its introduced European range, it lives in more open habitat than in its native range, around the edges lakes, water meadows, and cultivated areas with woods nearby.[4]

Behaviour[edit]

Breeding[edit]

A female parent with ducklings in Richmond Park, London, England

In the wild, Mandarin ducks breed in densely wooded areas near shallow lakes, marshes or ponds. They nest in cavities in trees close to water and during the spring, the females lay their eggs in the tree's cavity after mating. A single clutch of nine to twelve eggs is laid in April or May. Although the male may defend the brooding female and his eggs during incubation, he himself does not incubate the eggs and leaves before they hatch. Shortly after the ducklings hatch, their mother flies to the ground and coaxes the ducklings to leap from the nest. After all of the ducklings are out of the tree, they will follow their mother to a nearby body of water.[4]

Food and feeding[edit]

Male flying in Dublin, Ireland.

Mandarins feed by dabbling or walking on land. They mainly eat plants and seeds, especially beech mast. The species will also add snails, insects and small fish to its diet.[7] The diet of Mandarin ducks changes seasonally; in the fall and winter, they mostly eat acorns and grains. In the spring they mostly eat insects, snails, fish and aquatic plants. In the summer, they eat dew worms, small fish, frogs, mollusks, and small snakes.[8] They feed mainly near dawn or dusk, perching in trees or on the ground during the day.[4]

Threats[edit]

Predation of the Mandarin duck varies between different parts of its range. Mink, raccoon dogs, otters, polecats, Eurasian eagle owls, and grass snakes are all predators of the Mandarin duck.[8] The greatest threat to the Mandarin duck is habitat loss due to loggers. Hunters are also a threat to the Mandarin duck, because often they are unable to recognize the Mandarin in flight and as a result, many are shot by accident. Mandarin ducks are not hunted for food, however they are still poached because their extreme beauty is prized.[8]

In culture[edit]

A Yuan Dynasty porcelain teapot representing a Mandarin duck pair

Chinese culture[edit]

Mandarin ducks are referred to by the Chinese as Yuan-yang (simplified Chinese: 鸳鸯; traditional Chinese: 鴛鴦; pinyin: yuān yāng), where yuan () and yang () respectively stand for male and female Mandarin ducks. In traditional Chinese culture, Mandarin ducks are believed to be lifelong couples, unlike other species of ducks. Hence they are regarded as a symbol of conjugal affection and fidelity, and are frequently featured in Chinese art. A Chinese proverb for loving couples uses the Mandarin duck as a metaphor: "Two mandarin ducks playing in water" (simplified Chinese: 鸳鸯戏水; traditional Chinese: 鴛鴦戲水; pinyin: yuān yāng xì shuǐ). A Mandarin duck symbol is also used in Chinese weddings because in traditional Chinese lore, they symbolize wedded bliss and fidelity. Because the male and female plumages of the Mandarin duck are so unalike, yuan-yang is frequently used colloquially in Cantonese to mean an "odd couple" or "unlikely pair" – a mixture of two different types of same category. For example, the drink yuanyang and yuan-yang fried rice.

Korean culture[edit]

See also: Wedding ducks

For Koreans, Mandarin ducks represent peace, fidelity, and plentiful offspring. Similar to the Chinese, they believe that these ducks mate for life. For these reasons, pairs of Mandarin ducks called wedding ducks are often given as wedding gifts and play a significant role in Korean marriage.[9]

Gallery[edit]

Pictures depicting the Mandarin duck
Portrait of a male at Martin Mere, UK. 
Mandarin Drake. 
Drake in Eclipse plumage
Duckling. 
Mating couple. 
Male in Richmond Park, London. 
Female in Richmond Park, London. 
A pair of Mandarin ducks in Switzerland. 

References[edit]

  1. ^ BirdLife International (2012). "Aix galericulata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Shurtleff, Lawton; Savage, Christopher (1996). The Wood Duck and the Mandarin: The Northern Wood Ducks. University of California Press. ISBN 0-520-20812-9. 
  3. ^ "What is Albinism?". The National Organization for Albinism and Hypopigmentation. Retrieved 4 February 2012. 
  4. ^ a b c d Madge, Steve; Burn, Hilary (1987). Wildfowl: An identification guide to the ducks, geese and swans of the world. London: Christopher Helm. pp. 188–189. ISBN 0-7470-2201-1. 
  5. ^ "Kunterbunte Einwanderer". Berliner Zeitung (in German). Retrieved 3 February 2012. 
  6. ^ Marcus, Mike (8 February 2012). "Let's Talk About Birds: Mandarin Ducks". Pittsburgh Post Gazette. Retrieved 8 February 2012. 
  7. ^ "Mandarin Duck Fact Sheet". Lincoln Park Zoo. 
  8. ^ a b c "Mandarin Duck". Honolulu Zoo. Retrieved 5 February 2012. 
  9. ^ Chira, Susan (5 October 1986). "The Happy Couple: Korean Wedding Ducks". The New York Times. Retrieved 30 June 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!