Overview

Brief Summary

Biology

This hawk is an active and versatile predator, feeding on invertebrates, small lizards, snakes, rodents, hatchling tortoises and sea turtles as well as the marine iguanas found on the Galapagos Islands. It also takes carrion and is often associated with human camps, where it takes food scraps (5). There are no natural predators of this species on the Galapagos, and they show very little fear of humans (3). Breeding may occur at any time of year (2). This species tends to form long-term groups consisting of one female and several males. The female mates with all of the males, and they all assist in chick rearing. This type of social structure is known as 'co-operative polyandry', polyandry meaning 'many males' (6). Nests are constructed in low branches, on an outcrop of larva or on the ground from sticks, and are lined with grass, bark, leaves and other available soft materials. They are used repeatedly for several years and become increasingly large, often up to 1.2 metres in diameter and three metres in height (3) (5). During courtship, pairs often rise to great heights and descend in criss-crossing flights (5). Mating occurs repeatedly during the day. Although up to two greenish-white eggs are laid, just one chick is usually reared (5). The incubation period lasts 37 to 38 days and the young are fully fledged at 50 to 60 days of age (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Galapagos hawk is a large, dark coloured hawk with broad wings, and a broad tail (2) (5). Adults are sooty brownish-black in colour with a grey tail barred with darker stripes (2). The legs and skin at the base of the beak are yellow (3) and the bill is greyish black (5). Immature birds have blackish-brown upperparts, mottled with buff and white; the tail is off-white with wavy dark bars and their underparts are buff-coloured with a white throat flecked with blackish-brown spots. Males are noticeably smaller than females (5). The most typical call is a series of short screams that have been described as 'keer, keeu'. Occasionally a rapid 'cher, cher, cher' is heard. When on the wing a scream is produced in bursts of three to five (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Galapagos Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Buteo galapagoensis was apparently once common on most of the main islands of the Galápagos, Ecuador. The population is difficult to measure except in terms of breeding territories, of which 130 were estimated in the early 1970s5. Following a serious population decline, it is now extinct on five islands, and present on Santiago (c.50 territories), Española (10), Isabela (c.25), Fernandina (10), Pinta (12-15), Marchena (5), Pinzón (5) and Santa Fe (17)5. Recent records of single birds on Santa Cruz are presumed to be stragglers from other islands7. The breeding system means that the population is larger than the number of territories suggests, for example, the population on Santiago may number 180 adults in the 50 territories, with a total of c.250 individuals1. The total population may number 400-500 adults and 300-400 juveniles7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Galapagos Hawks Buteo galapagoensis are indigenous to a group of islands called the Galapagos Islands. The islands are located 600 miles west of Peru and Ecuador and just south of the equator, covering a 200 square mile range. Currently, this species can be found on the islands of Charles, Chatham, Duncan and Indefatigable. Previously, they were also found on Baltra and Tower islands (Thornton 1971).

Biogeographic Regions: neotropical (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Ecuador (Galapagos Islands)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

As the common name suggests, this hawk is endemic to the Galapagos Islands, Ecuador (2). It was once common throughout these islands, but there has been a worrying population decline and the species has become extinct on five islands (2). It is thought that there are around 150 breeding pairs at present (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Galapagos Hawks are similar in size and shape to the Red-Tailed Hawk Buteo jamaicensis and the Swainson's Hawk Buteo swainsoni of North America. The hawks are about 55 cm (21.5 in) long and have a wingspan of 120 cm (47 in). The iris of the eye is brown, and the legs, cere and the soft skin at the base of the beak are yellow. The tail is buffy white with lightly barred tail feathers. Females are noticeably larger than the males (sexually dimorphic). Unlike the adults, juvenile hawks are spotted with dark brown specks and pale breasted. Like other members of the Buteo species, these hawks have superior eyesight (Thornton 1971, del Hoyo, J., et al.1994, Wheeler, et al. 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in all habitats, from shoreline to bare lava-fields, open, rocky, scrub country, deciduous forests and mountain peaks. It feeds on a wide variety of sea and landbirds, rats, lizards, iguanas, invertebrates and carrion. It breeds throughout the year. It nests on a stick platform on a prominent lava outflow, rocky outcrop or in a small tree3. It is cooperatively polyandrous, with one female typically mating with two or three males (up to eight males have been recorded), and all males helping in raising the chicks2. Genetic research indicates there is little movement between island populations9.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This bird can be found throughout all the geographical biomes on the Galapagos Islands. These regions include the shoreline, lava fields, deciduous forest and mountaintops (Thornton 1971, del Hoyo, J., et al. 1994).

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is found in all types of habitat on the Galapagos Islands, including lava-fields, shoreline, forest and mountains (2) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Galapagos Hawks are carnivorous and are skilled hunters. Their diet consists of lizards, rats, doves, centipedes, Audubon's Shearwaters Puffinus iherminieri iherminieri, both land and marine iguanas, small goats, boobies, and grasshoppers. They will also scavenge on almost any form of carrion with the exception of marine iguanas, seals and sea lions, the latter maybe due to the hide on the seals and sea lions being too thick to rip open. Galapagos Hawks will occasionally obtain a free meal by following fishing boats and goat hunters who toss out scraps (De Vries, in litt., Thornton 1971, del Hoyo. J., et al.1994, Howard, et al. 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The Galapagos Islands are tropical and do not have seasons; therefore, the breeding patterns of the Galapagos Hawk tend to revolve around the island's local weather conditions as opposed to its seasons. The nest is quite large ranging from 80-100 cm (31- 39 in) wide and up to three meters (10 ft) tall. The female will lay one to three eggs and the incubation period lasts for 37-38 days. The young hawks fledge at about 50- 60 days. Both the incubation and fledging periods are longer than other Buteo species. Juveniles will not enter territorial breeding areas until sexual maturity is reached at the age of three (Thornton 1971, del Hoyo, J., et al. 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo galapagoensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATCGATGATTATTCTCAACCAATCACAAAGACATCGGCACCCTATACCTAATCTTCGGTGCCTGAGCCGGTATAGTCGGCACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCAGGCACACTCCTAGGTGAC---GACCAGATCTACAACGTAATCGTTACCGCACATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATTGGAGGCTTCGGAAACTGACTTGTCCCACTCATAATCGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCTGGCAATATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTACACTTAGCCGGAGTCTCGTCCATTCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAACCCCCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Buteo galapagoensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D1

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Symes, A., Butchart, S.

Contributor/s
Wiedenfeld, D., Cruz, F., de Vries, T., Vargas, H.

Justification
This species is listed as Vulnerable because it has a small population. Trends are not clear, but are assumed to be stable. If threats, notably persecution, were shown to be causing a decline, this species would warrant uplisting to Endangered.

History
  • 2006
    Vulnerable
  • 2004
    Vulnerable
  • 2000
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status: Rare (del Hoyo, J., et al. 1994)

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Buteo galapagoensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) by the IUCN Red List (1). Listed under Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
T. de Vries in litt. (2000)

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The most probable cause of the species's historical decline is persecution by humans5, which still continues on Santa Cruz and south Isabela4. The largest island, Isabela, may support a comparatively small population owing to competition for food with introduced feral cats and other predators5. Similar scenarios may have been partly responsible for the local extinctions. Lack of genetic diversity9 has been suggested as a potential threat, and it has led to increased parasite loads and vulnerability to disease in certain island populations8, but the species has never had a large effective population size so this is unlikely to become a major threat to the species now10. The removal of goats and pigs from Santiago may reduce habitat for non-breeding individuals as vegetation recovers7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The most likely cause of the historical decline of the Galapagos hawk is persecution by humans, which continues today on a few islands (2). Competition for food with introduced predators such as cats is also a serious problem in some areas, particularly on the largest island, Isabella (2). The fact that this species is restricted to the Galapagos Islands, and has a small overall population, makes it inherently vulnerable. Although the population seems to be stable at present, if there be a further decline in numbers, the IUCN Red List status of the species should be upgraded to Endangered (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II. Most of the archipelago is under national park and marine reserve protection and, in 1979, was declared a World Heritage Site. The species has been protected by Ecuadorian law since 19595. The possibility of reintroduction to previously inhabited islands has been discussed1,6, but advised against as prey-supply may have declined, and the effects may be detrimental to other threatened species6. Ecological research is ongoing and will result in detailed information on each island population7.

Conservation Actions Proposed
Monitor the population. Minimise illegal persecution.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Galapagos hawk is protected from international trade by its listing under Appendix II of the Convention on International Trade in Endangered Species (CITES) (4). It has been protected by Ecuadorian law since 1959. Much of the Galapagos Islands are classed as a national park and a marine reserve, and the archipelago was deemed a UNESCO World Heritage Site in 1979 (2). Ecological work into each population of the species is underway, which will enable effective conservation measures to be taken (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Galapagos Hawks have posed a problem for the settlers of the islands by preying upon their poultry and livestock (Thornton 1971).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Settlers introduced rats to the Galapagos Islands. Galapagos Hawks now include the rats in their diet, which helps control the rat population. (Thornton 1971).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Galapagos Hawk

The Galapagos Hawk (Buteo galapagoensis) is a large hawk endemic to the Galapagos Islands.

Contents

Physical description

Juvenile

Similar in size to the Red-tailed Hawk (Buteo jamaicensis) and the Swainson's Hawk (Buteo swainsoni) of North America, the Galapagos Hawk is about 55 cm from beak to tail with a wingspan of 120 cm. The adult Hawk has various colouring within the species. The adult Galapagos Hawk is generally a sooty brownish black colour; the crown being slightly blacker than the back. Its feathers of the mantle are partially edged with paler brown, grey, or buff, with their white bases showing to some extent. Their tail coverts are also barred with white.The tail itself is silvery grey above, with about ten narrow black bars; below it is quite pale. The wing feathers are paler on inner webs, barred with white.

Below it has indistinct rufous edges to the feathers of the flanks and lower abdomen. The under-tail coverts are barred with white. Under-wing coverts are black, contrasting with the pale bases of the wing quills. The eyes are brown, the beak greyish black, paler at its base which is known as the 'cere', legs and feet are yellow. The male Hawk is smaller than the female hawk,as with many birds of prey. The young hawks however, appear quite different from the adults in that they are well camouflaged with an overall brown appearance with varying amounts of striping below and paler mottling above. Their eyes are light grey-brown, and the beak black, blue-grey at its base. The cere is grey-green, the feet pale yellow-green. When the immature plumage becomes badly worn, the pale areas become almost white.

The Galapagos Hawk has broad wings and a broad tail. It is an apex predator and possesses excellent vision. Their young appear different from adults because they are darker and have camouflage which aid them in remaining protected from potential predators until they are fully grown.

Habitat and diet

This hawk lives mainly on insects such as locusts and giant centipedes, as well as small lava lizards, snakes, and rodents. It is not uncommon for it to take young marine and land iguanas, and sea turtle and tortoise hatchlings. This predator has also been spotted near nesting areas of Swallow-tailed Gulls, where it steals eggs as well as young. Even extremely rancid carrion is picked apart by their sharp, forceful beaks. Their feet and talons are also strong like those of the closely related Red-backed Hawk and White-tailed Hawk.

Hunting in groups of two or three, the hawks soar at a height of 50 to 200 meters in the sky. When one of the birds spots prey or a rotting carcass, they signal to the other members. The dominant hawk of the group feeds from the prey until it is satisfied, as the other hawks in the family group submissively wait their turn to feed. It prefers to perch on a lava outcrop or high branch when hunting, yet it also spends some of its time on the ground.

Fearless of man, the young especially being quite curious, they often wander around human camps and scavenge for scraps of food. In 1845, Charles Darwin wrote:

"A gun is here almost superfluous; for with the muzzle I pushed a hawk out of the branch of a tree..."

Behavior and breeding

Because the seasons of the island are unchanging due to the close proximity of the equator, there is no regular mating season. Mating takes place a few times a day on a nearby perch or in flight. It begins when males make fake attacks on the female from behind by dive bombing her, and then the male follows the female as she descends to the trees below. While males tend to be monogamous, the females will mate with up to seven different males during mating season. Throughout the entire nesting period, the female and her males take turns protecting the nest and incubating the eggs, even participating in the feeding.

Nests are built low in trees, on lava ledges, or even on the ground at times. Used for many years and nesting periods, they become quite large, sometimes even four feet in diameter. Stick structures are lined with grass, bark, clumps of leaves, or other available soft materials. The mating pair is together the majority of the time at the prime of egg-laying season, and usually stays close to the nesting site. The nest is maintained constantly with fresh, green twigs. Normally one to three eggs are laid, green-white in color, but only one young is reared. Young hawks leave the nest around 50–60 days after hatching. Juvenile hawks will not enter the territorial breeding areas until they reach the age of three, becoming sexually mature. Although these birds are generally fearless, they will abandon their nest if it has been tampered with by humans.

Voice

The call of the Galapagos Hawk is a series of short screams similar to the call of the Red-shouldered Hawk that have been described as a “keer, keeu,” or an inflected “kwee”. Especially noisy during breeding season, their call softens to a “kilp, kilp, kilp”.

Status

Although the exact number of these birds is unknown, there are believed to be only around 150 mating pairs in existence today. This statistic has improved slightly from past years, but it is far from the abundance they were found in on all the islands of Galápagos when they were discovered. Due to human disturbance to their natural habitat, a dwindling food supply because of new predators introduced to the islands, and predation by humans, they are now extinct on the islands of Baltra, Daphne, Floreana, San Cristobal, and Seymour.

Evolution

Study of mtDNA haplotypes (Bollmer et al. 2005) of the Galapagos Hawk and its closest relative, Swainson's Hawk, indicates that the former's ancestors colonized the islands approximately 300,000 years ago, making the birds the most recent arrival known. (Compare to Darwin's finches, which are estimated to have arrived some 2–3 million years ago.)

References

  • Bollmer, Jennifer L.; Kimball, Rebecca T.; Whiteman, Noah Kerness; Sarasola, José Hernán & Parker, Patricia G. (2005): Phylogeography of the Galápagos hawk (Buteo galapagoensis): A recent arrival to the Galápagos Islands. Molecular Phylogenetics and Evolution 39(1): 237–247. doi:10.1016/j.ympev.2005.11.014 (HTML abstract)
  • Channing, Keith. “Galapagos Hawk- Buteo galapagoensis”. The Hawk Conservancy Trust. 2008. 5 Mar 2008.
  • Licon, Daniel. “Buteo galapagoensis: Galapagos Hawk”. University of Michigan Museum of Zoology Animal Diversity Web. 2008. 5 Mar 2008 <http://animaldiversity.ummz.umich.edu/site/accounts/information/Buteo_galapagoensis.html>.
  • Bollmer, Jennifer L., et al. “Population Genetics of the Galapagos Hawk (Buteo galapagoensis): Genetic Monomorphism Within Isolated Populations.” The Auk. 122.4 (2005): 1210-1214.
  • Delay, Linda S., et al. “Paternal Care in the Cooperatively Polyandrous Galapagos Hawk.” The condor. 98 (1996): 300-306.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!