Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

When attempting to attract a mate, male buzzards fly in a very distinguishing manner known as the rollar coaster. Buzzards mate for life. Both male and female contribute in building a new nest or rebuilding an old one. With their long, broad wings and short stubby tail, they are relatively sluggish flyers, constantly interchanging between short glides and flapping their wings. That is why they hunt mostly mice. However, they are fantastic gliders as they catch the currents. If you see a raptor slowly circling in the sky, it is often a buzzard.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 50-57cm;
Wingspan: 1.13-1.28m;
Weight: 0.55-1.2kg

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: John Bell

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Buteo buteo preys on:
Tyto alba
Arvicola terrestris
Myopus schisticolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Predation

Buzzards are know to feed on small mammals such as voles, mice and rabbits, birds including crows, invertebrates including beetles, earthworms and many insects. In southern parts of its' distribution, it also predates on reptiles such as lizards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: John Bell

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Buteo buteo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTTATCAATCGATGATTATTCTCAACCAATCACAAAGACATCGGCACCCTATACCTAATCTTCGGTGCCTGAGCCGGTATAGTCGGCACCGCCCTCAGCCTACTTATTCGTGCAGAACTCGGCCAACCAGGCACACTCCTAGGTGACGACCAGATCTACAACGTAATCGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTTATACCAATTATGATCGGAGGCTTCGGAAACTGACTTGTTCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTTCTCCTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCCGGCACTGGATGAACTGTCTATCCCCCACTAGCTGGCAACATAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACTTAGCCGGAGTCTCGTCCATTCTAGGAGCAATCAACTTTATCACAACCGCCATCAACATAAAGCCCCCAGCCCTCTCCCAGTACCAAACACCCCTATTCGTATGATCTGTCCTCATTACCGCTGTCCTTCTACTACTCTCACTCCCAGTCCTAGCCGCCGGCATTACCATACTACTTACAGACCGAAACCTAAACACAACATTCTTTGACCCCGCCGGCGGAGGTGATCCTATCCTATACCAACATCTCTTTTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCCTACCCGGCTTCGGAATTATCTCCCACGTAGTAACATACTATGCAGGCAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCCATACTATCAATCGGATTCCTAGGGTTCATCGTATGAGCTCATCACATATTTACAGTAGGGATAGACGTGGACACCCGAGCATACTTCACATCTGCTACTATAATCATTGCTATCCCAACTGGTATTAAAGTCTTCAGCTGACTAGCAACGCTCCACGGAGGAACTATCAAATGAGACCCTCCAATATTATGAGCCCTTGGCTTCATCTTCCTCTTTACCATCGGAGGCCTAACAGGAATCGTCCTAGCTAACTCCTCACTAGACATCGCTCTACACGACGCATACTATGTAGTTGCCCACTTCCACTACGTCCTCTCAATAGGAGCTGTCTTTGCCATTCTAGCAGGATTCACCCACTGATTCCCTCTATTAACTGGATTCACCCTCCACCCCACATGAGCTAAAGCCCACTTCGGGGTTATATTCACAGGAGTAAATCTAACTTTCTTCCCACAACACTTCCTAGGCCTCGCCGGAATACCTCGACGATATTCCGACTACCCAGACGCCTATACCCTATGAAACACCCTATCCTCTATCGGCTCACTAATCTCAATAACAGCCGTAATCATACTAATATTCATCATCTGAGAAGCCTTTGCCTCAAAACGAAAAATCCTACAACCAGAACTAACCACAACCAATGTCGAATGAATCCACGGCTGCCCACCTCCATACCACACCTTTGAAGAACCAGCCTTTGTTCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Buteo buteo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Not Recognized
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population is estimated at 4,000,000 individuals (Ferguson-Lees et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Buzzard

The Common Buzzard (Buteo buteo) is a medium to large bird of prey, whose range covers most of Europe and extends into Asia. It is usually resident all year, except in the coldest parts of its range, and in the case of one subspecies.

Contents

Description [edit]

The Common Buzzard measures between 40 and 58 cm (16 and 23 in) in length with a 109–136 cm (43–54 in) wingspan and a body mass of 427–1,364 g (0.94–3.01 lb), making it a medium-sized raptor.[2][3]

This broad-winged raptor has a wide variety of plumages, and in Europe can be confused with the similar Rough-legged Buzzard (Buteo lagopus) and the only distantly related European Honey Buzzard (Pernis apivorus), which mimics the Common Buzzard's plumage for a degree of protection from Northern Goshawks[citation needed]. The plumage can vary in Britain from almost pure white to black, but is usually shades of brown, with a pale 'necklace' of feathers.

Systematics [edit]

The Common Buzzard was first described by Linnaeus in his Systema naturae in 1758 as Falco buteo.[4] Buzzard subspecies fall into two groups. The western Buteo group is mainly resident or short-distance migrants. They are:

The eastern vulpinus group includes

Two resident forms on islands close to Africa are often assigned to the first group, but appear to be distinct species, more closely related to the African Long-legged Buzzard, based on biogeography and preliminary mtDNA cytochrome b sequence data (Clouet & Wink 2000):

At Hamerton Zoo, England

Behaviour [edit]

In flight, Devon, England. There are around 40,000 breeding pairs in the United Kingdom

The Common Buzzard breeds in woodlands, usually on the fringes, but favours hunting over open land. It eats mainly small mammals, and will come to carrion. A great opportunist, it adapts well to a varied diet of pheasant, rabbit, other small mammals to medium mammals, snakes and lizards, and can often be seen walking over recently ploughed fields looking for worms and insects. The birds have incredible strength and are therefore able to pick up food of all weights.[citation needed]

Buzzards do not normally form flocks, but several may be seen together on migration or in good habitat. The Victorian writer on Dartmoor, William Crossing, noted he had on occasions seen flocks of 15 or more at some places. Though a rare occurrence, as many as 20 buzzards can be spotted in one field area, approximately 30 metres apart, so cannot be classed as a flock in the general sense, consisting of birds without a mate or territory. They are fiercely territorial, and, though rare, fights do break out if one strays onto another pair's territory, but dominant displays of aggression will normally see off the interloper. Pairs mate for life. To attract a mate (or impress his existing mate) the male performs a ritual aerial display before the beginning of spring. This spectacular display is known as 'the roller coaster'. He will rise high up in the sky, to turn and plummet downward, in a spiral, twisting and turning as he comes down. He then rises immediately upward to repeat the exercise.

The call is a plaintive peea-ay, similar to a cat's meow.

Steppe Buzzard [edit]

The Steppe Buzzard, B. (b.) vulpinus breeds from east Europe eastward to the Far East, excluding Japan. It is a long-distance migrant, excepting some north Himalayan birds, and winters in Africa, India and southeastern Asia. In the open country favoured on the wintering grounds, steppe buzzards are often seen perched on roadside telephone poles.

Steppe Buzzard is some times split as a separate species, B. vulpinus. Compared to the nominate form, it is slightly smaller (45–50 cm long), longer winged and longer tailed. There are two colour morphs: the rufous form which gives this subspecies its scientific name (vulpes is Latin for "fox"), and a dark grey form.

The tail of vulpinus is paler than the nominate form, and often quite rufous, recalling North American Red-tailed Hawk. The upper wings have pale primary patches, and the primary flight feathers are also paler when viewed from below. Adults have a black trailing edge to the wings, and both morphs often have plain underparts, lacking the breast band frequently seen in B. b. buteo.

Forest Buzzard [edit]

The Forest Buzzard, B. (b.) trizonatus,[citation needed] is another form sometimes upgraded to a full species, though most recent authorities have placed it as a subspecies of another species, the Mountain Buzzard, B. oreophilus. This is a resident breeding species in woodlands in southern and eastern South Africa.

It is very similar to the abundant summer migrant Steppe Buzzard, but the adult can be distinguished with a good view by its whiter underparts and unbarred flanks. The juvenile differs from the same-age steppe buzzard by its white front and tear-shaped flank streaks.

The Forest Buzzard, as its name implies, inhabits evergreen woodlands, including introduced eucalyptus and pines, whereas the steppe buzzard prefers more open habitats. However, habitat alone is not a good indicator for these forms.

References [edit]

  1. ^ BirdLife International (2012). "Buteo buteo". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3.
  4. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 90. "F. cera pedibusque luteis, corpore fusco, abdomine paludo maculis fuscis." 
  • Clouet, Michel and Wink, Michael (2000): The Buzzards of Cape Verde (Buteo (buteo) bannermani) and Socotra (Buteo buteo spp.) - First results of a genetic analysis based on nucleotide sequences of the cytochrome b gene. Alauda 68(1): 55-58. PDF fulltext
  • Ferguson-Lees, Christie, Franklin, Mead and Burton Raptors of the World ISBN 0-7136-8026-1
  • Mullarney, Svensson, Zetterstrom and Grant, Collins Bird Guide ISBN 0-00-219728-6
  • Ian Sinclair, Phil Hockey and Warwick Tarboton, SASOL Birds of Southern Africa (Struik 2002) ISBN 1-86872-721-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!