Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

These robust geese brood in barren areas in the high north. Barnacle geese lay their eggs on ridges located high off the ground, unreachable for predators. Because the chicks are unable to fly right away, they need to eventually jump off the cliffs. It is a rocky bottom and not all chicks survive the ordeal. Since the end of the 20th century, more and more barnacle geese have been staying in the Netherlands to nest. This probably began with tame birds that went wild.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Maine, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Greenland to Novaya Zemlya; winters to n Mediterranean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A casual of accidental visitor to northeast seaboard of North America.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The species consists of four main migrant populations that utilize various wintering and breeding grounds. These main populations number in the tens of thousands with the largest consisting of well over 100,000 individuals. Other smaller populations have been identified but these populations number only in the few thousands. The wintering grounds of all of these populations are located in the British Isles and coastal Netherlands and are separated by relatively short distances, while their breeding grounds are widely separated in the northern European arctic. These four main populations range from their wintering grounds in northern Scotland to their breeding grounds on the east coast of Greenland:

Greenland population: This population consists of about 45,000 individuals. Their breeding grounds are located on the ice-free coasts of East Greenland. These individuals gather mostly on cliff ledges or on small islands that are close to the shores. In September, when the weather conditions in Greenland worsen, they head for their wintering grounds on the shores and islands of northern Scotland. On their way to Scotland, they make a stop at Iceland for about four weeks and then continue their migration.

Svalbard population: This population consists of about 25,000 individuals. They breed on the islands of the Svalbard archipelago and the small islands that surround it. They leave Svalbard in the middle of September and make a stop on the western coast of Norway before continuing on to their wintering grounds in Solway Firth on the west coast of England. This migration path is about 2,500 to 3,000 km in distance.

Russian population: This population consists of over 100,000 individuals. They breed on the north-west coast of arctic Russia. This population initially wintered in Western Germany, however due to increased interruption of wintering areas in Western Germany and the creation of new grazing areas in the coastal regions of Netherlands the entire population has had to shift their wintering grounds to the Netherlands.

Novaya Zemlya population: This population consists of about 10,000 individuals. They breed in the archipelago islands of Novaya Zemlya off the coast of western arctic Russian mainland. They migrate to the coastal regions of Netherlands to spend the winter.

Additionally, it is believed that an ancient population may also have lived on the north-east coast of Canada, however currently there is insufficient data to support this hypothesis.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Clements, J. 2007. The Clements Checklist of Birds of the World. Ithaca, New York: Cornell University Press.
  • Gosler, A. 2007. Birds of the World: A Photographic Guide. New York: Firefly Books.
  • Sale, R. 2006. A Complete Guide to Arctic Wildlife. New York: Firefly Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Branta leucopsis in adult plumage has a rounded body, a rounded head, and a relatively short neck. The white feathers on the head cover a greater portion of the face than that of Branta canadensis (Canada goose). Overall, the face patch is white or often creamy-white and also extends to the forehead and under the throat. The black coloration of the neck extends below the chest. The ventrum of this species is white colored towards the posterior end and light-gray colored towards the anterior side. A black colored thin strip of feathers joins the eye and the bill. The feet are entirely black colored. The dorsal feathers are dark, bluish-grey. The tail is completely black both on its dorsal and ventral sides. The bill is black colored and short. The feather coloration above the wing is dark grey while the coloration below the wing is light, silvery-grey and white. Plumage is the same in both males and females of the species. However, males are usually larger in body size and weight than females. Adults weigh between 1.4 and 2.2 kg and feature a wingspan of 130 to 145 cm. Body length ranges from 55 to 70 cm.

Young adult barnacle geese (in their first winter) look very much the same as adults with slight plumage color variations. The black feathers of the neck and chest will often have a duller color compared to those of adults. It is possible to see a few brown feathers in the neck region as well. The faces of young birds may have few dark fleckings which can be hard to detect from a distance.

Downy young barnacle geese have grey-brown feathers on their dorsal parts, neck, chest, and crown. The ventrum of the downy young is pale-yellow. The line of feathers that extends from the bill to the eye is dark-grey colored. The feet and the bill are dark-grey colored as well. White spots are common on the wings.

Variation of plumage in adults has been observed but is rare. Adults with entirely dark brown to entirely white feathers have been observed in the past.

Range mass: 1.4 to 2.2 kg.

Average mass: 1.9 kg.

Range length: 55 to 70 cm.

Average length: 64 cm.

Range wingspan: 130 to 145 cm.

Average wingspan: 141 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

  • Ogilvie, M. 1978. Wild Geese. South Dakota: Buteo Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory and travels on a narrow front2 between extremely localised breeding and wintering areas1. It is present on its breeding grounds from May or June to August or September2 where it breeds in small but often closely packed colonies1, 3 of 5-50 pairs, occasionally singly or in groups of up to 150 pairs6. It uses the same nesting sites year after year4 and sometimes nests among seabird colonies3. After the young hatch the adults undergo a flightless moult period near the breeding grounds between mid-July and mid-August that lasts for 3-4 weeks5. The species migrates to autumn staging areas in September2 from which it travels via regular stop-over sites3 to the wintering grounds, arriving in late-September2. The return migration begins in April or May, the species moving to spring staging areas where it may be present for 20-30 days before migrating northwards2. The species is highly gregarious outside of the breeding season, often feeding in dense concentrations on coastal grasslands during the winter3. In winter habitats it roosts on water3 or on sandbanks near saltmarshes and pastureland10. Habitat Breeding The species breeds in Arctic semi-desert tundra (fjellmark)2 on crags, rocky outcrops1, cliffs, rocky slopes4 and coastal islands (Svalbard)2 near wetlands such as lakes, rivers, marshes, the upper parts of fjords, coastlines4, wet meadows and mudflats2. In years when the snow is slow to melt the species first forages on grassy vegetation on south-facing mountain slopes fertilised by the droppings of cliff-nesting seabirds before moving down to breeding areas2. It also returns to these slopes after the moulting period before autumn migration2. After the young hatch families may disperse away from rocky ground to more vegetated areas surrounding tundra lakes and rivers2. Non-breeding During the non-breeding season the species frequents tidal mudflats, saltmarshes2, 4 and adjacent coastal meadows1, 4 (especially improvedrough pasturesand arable land1, 2), with agricultural fields becoming increasingly more important as winter feeding areas5. Diet The species is herbivorous1 its diet consisting of the leaves, stems and seed-heads of grasses, sedges, aquatic plants1, 2, mosses2, various herbs (especially white clover Trifolium repens in the winter)8, 10 and shrubs (e.g. arctic willow Salix arctica)4. It may also take agricultural grain and vegetables during the winter1. Breeding site The nest is a shallow depression in a low mound of vegetation6 positioned on rocky ground1, 2, rocky outcrops4, 6, among rocky crags, on steep cliffs3, 4, 6, on the tops of low hills4, or on low vegetation hummocks and snow-free patches on islands in river channels6. Nesting sites accumulate nesting materials as they are often used year after year4, and the species may sometimes nest among seabird colonies3. Management information An investigation carried out in one of the species's wintering areas (UK) found that it was most likely to forage on improved grasslands with high abundances of the grass Lolium perenne and white clover Trifolium repens8 (the growth of which is greatly influenced by the amount of summer grazing, which controls the grass height)10. Preferred fields were between 4 and 10 ha in area (the species avoided fields of less than 2-3 ha), and at an optimal distance of less than 5 km away from roosting sites (maximum 7 km away)8. The species was also found to show a preference for grasslands with swards less than 10 cm in height (optimum 2 cm) in fields that had been cut for silage and then grazed (although there was no major difference in feeding intensity on pastures grazed with different livestock)8. Overall winter use of grassland fertilised with large amounts of nitrogen was significantly greater than the use of unfertilised grassland by the species8. The Barnacle Goose Management Scheme (BGMS) in Scotland, UK recommends fertilising farmland adjacent to reserves containing wintering groups of this species at times when geese are present (e.g. autumn or winter) and grazing stock (sheep or cattle) are absent9. The BGMS also awards payments to farmers who manage pastures outside of established reserves for reducing the level of disturbance (e.g. scaring away feeding flocks) on their land9.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The species often occupies pasture land, salt marshes, and grassy fields near the coastal regions of the European arctic and the British Isles. Although conservation efforts have allowed the generation of designated areas from which the species can benefit, they have been known to graze in farming and suburban areas. During the breeding season, females are known to construct their nests in rocky areas on hillsides. Areas with an abundance of tundra vegetation, coastal dunes, and marshes are preferred by this species.

Range elevation: 0 to 40 m.

Average elevation: 15 m.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra

Wetlands: marsh

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 205 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.632 - 10.887
  Nitrate (umol/L): 6.523 - 12.829
  Salinity (PPS): 32.748 - 35.253
  Oxygen (ml/l): 6.189 - 6.507
  Phosphate (umol/l): 0.479 - 0.734
  Silicate (umol/l): 2.463 - 8.436

Graphical representation

Temperature range (°C): 10.632 - 10.887

Nitrate (umol/L): 6.523 - 12.829

Salinity (PPS): 32.748 - 35.253

Oxygen (ml/l): 6.189 - 6.507

Phosphate (umol/l): 0.479 - 0.734

Silicate (umol/l): 2.463 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The species is herbivorous and mainly feeds on grass, aquatic vegetation, or human agricultural crops. On their breeding grounds, they will eat vegetation that is available in the tundra. In their wintering grounds they will often occupy fields and farmlands to feed on grass. This often causes a conflict with farmers.

Plant Foods: leaves; roots and tubers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The species acts as a seed-dispersant for many grasses and is also a prey item for other species such as peregrine falcons, polar bears, and Arctic foxes.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

During the breeding season in the arctic, top predators of this species are polar bears and Arctic foxes. Barnacle geese parents are known to aggressively physically defend their nests and young. Peregrine falcons are also known to hunt this species. During flight, if barnacle geese are threatened by aerial predators such as peregrine falcons, the flock adopts initiate fast turns in synchrony to confuse the attacker and avoid predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Barnacle geese generate monosyllabic, rapid, loud calls to warn nearby geese of approaching predators. These calls often resemble the yapping of small dogs. They may generate loud calls to warn of aerial predators during flight as well.

Duets are usually performed during the mating season and serve the purpose of strengthening pair bonds between mates. A duet is often initiated by the male who makes short, rapid, loud calls. These calls are followed by similar loud calls from an interested female. Duets may also be initiated right after the initial mate selection in young barnacle geese. Vocal duets are often accompanied by visual displays by the male, who points his beak in alternating directions or holds his head close to the ground. If the female accepts his display, she allows him to approach and touch her with his bill.

During migration, barnacle geese are presumed to utilize magnetic fields to direct their flights.

Like most birds, barnacle geese perceive their environments through tactile, auditory, visual and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: duets

Perception Channels: magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, Branta leucopsis may live up to 25 years of age. In captivity where they are protected from predators and are provided sufficient food, they may live up to 30 years of age.

Range lifespan

Status: wild:
18 to 25 years.

Range lifespan

Status: captivity:
24 to 30 years.

Typical lifespan

Status: wild:
20 to 23 years.

Typical lifespan

Status: captivity:
23 to 28 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Barnacle geese that have reached sexual maturity will choose their partners in early spring. Partner retention in Branta leucopsis is lifelong and monogamous. This partnership is believed to be established with a triumph ceremony in which the male will vocalize and change postures to impress the female. During this ceremony, the male will make loud calls and change the orientation and angle of his head relative to ground. If the female is willing to participate, she responds with loud calls and the male will increase the intensity of his movements and later try to approach the female. At times during the triumph ceremony, if a male catches the attention of a nearby female, he may exaggerate his displays by flicking his wings and lowering his head closer and more parallel to the ground. The goal of the male in this ceremony is to make contact with the female with his bill. If the female does not draw herself away, the male takes it as a sign of acceptance and forces all nearby males away. It is also believed that pairs may engage in the triumph ceremony each year to strengthen their partnership.

Mating System: monogamous

The breeding season occurs in spring, spanning from late May to June. Barnacle geese reaches sexual maturity at two years of age. However, rarely, males will be observed breeding at one year of age with females that are older. Barnacle geese that have mated for the first time at four years of age have also been recorded. It is believed that the age in which these geese mature may be related to environmental factors such as food availability and overall weather conditions. The female usually lays one egg per day until the desired clutch size (4 to 5 eggs) can be obtained. These eggs are pale gray colored. The clutch is incubated for 24 to 26 days and the young typically fledge 40 days after hatching.

Breeding interval: Barnacle geese breed once a year in spring.

Breeding season: Breeding occurs in the spring, usually between late May and June.

Range eggs per season: 3 to 6.

Average eggs per season: 4 to 5.

Range time to hatching: 24 to 26 days.

Range fledging age: 40 to 45 days.

Average age at sexual or reproductive maturity (female): 2 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Nests are constructed by females, often on cliff edges to avoid predators such as the arctic fox (Vulpes lagopus). Nest building materials include mud and dead foliage. Prior to laying her eggs the female lines the nest with down. The female will incubate the eggs for 24 to 26 days. During this time, the male will guard the nest and the female. During the incubation period, it is energetically costly to incubate and defend the eggs as the parents cannot forage far away from the nest. This causes both the female and the male to lose 30% to 40% of their total body weight. Barnacle goose hatchlings are precocial and leave the nest as soon as their downy feathers have dried. Parents lead their brood to marshes with abundant vegetation, but the young are entirely responsible for feeding themselves. The young are aggressively defended by both parents until they fledge and become independent after 40 to 45 days. Families remain together even after the young are considered independent. These family groups will perform their first migration together to the wintering grounds, but will disperse before the following breeding season as parents become increasingly territorial.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female); post-independence association with parents

  • Attenborough, D. 1998. The Life of Birds. Princeton, New Jersey: Princeton University Press.
  • Bigot, E., M. Hausberger, J. Black. 1995. Exuberant youth: The example of triumph ceremonies in Barnacle geese (Branta leucopsis). Ethology Ecology & Evolution, 7: 79-85. Accessed April 14, 2011 at http://www.fupress.net/index.php/eee/article/viewFile/686/632.
  • Goodfellow, P. 1977. Birds as Builders. New York: Arco Publishing.
  • Jonker, R., M. Kuiper, L. Snijders, S. Van Wieren, R. Ydenberg, H. Prins. 2011. Divergence in timing of parental care and migration in barnacle geese. Behavioral Ecology, 22 (2): 326-331.
  • Ogilvie, M. 1978. Wild Geese. South Dakota: Buteo Books.
  • Skutch, A. 1976. Parent Birds and Their Young. Austin: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branta leucopsis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTACTAACCACAAAGATATCGGCACCCTATACCTCATCTTCGGAGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGGACTCTCCTAGGTGACGACCAAATTTACAATGTAATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATGATCGGAGGATTCGGCAACTGATTAGTACCCCTCATAATCGGCGCCCCCGACATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCACCATCATTCCTCCTACTACTAGCCTCGTCCACGGTAGAAGCTGGCGCCGGTACAGGCTGAACTGTATACCCTCCCCTGGCAGGTAACCTCGCCCACGCCGGGGCTTCAGTAGACCTGGCTATTTTCTCACTTCACTTAGCCGGTGTCTCCTCCATCCTTGGGGCCATCAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCMCACTATTCGTCTGATCCGTCCTGATCACTGCCATCCTACTCCTCCTATCGCTCCCCGTACTCGCCGCCGGAATCACAATACTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCCGGAGGGGGAGACCCAGTCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Branta leucopsis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barnacle geese are considered Least Concern by the International Union for Conservation of Nature and Natural Resources' (IUCN) Red List. Population sizes range from a few thousand to well over 100,000 and they are protected throughout their range. The Barnacle Goose Management Scheme in Scotland, United Kingdom makes efforts to protect barnacle geese from persecution by farmers during the wintering periods when the geese are frequent visitors to croplands. This conservation group helps farmers to make their land more suitable to supporting barnacle geese and also gives financial rewards to those that refrain from disturbing the birds on their property.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Today the species is fully protected throughout its range, although adults, eggs and down were once exploited by humans2, and the species may be disturbed by shooting even though it is not directly hunted10. The species faces possible threats from persecution (disturbance) by farmers as in winter it favours grasslands and pastures used for grazing livestock9. The species also suffers from nest predation by arctic fox Vulpes lagopus in Svalbard7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species is known to be considered pests by farmers in the British Isles and Netherlands. Barnacle geese often graze farmlands during their wintering months and reduce the soil quality, preventing farmers from obtaining high yields from their crops in the summer and early fall.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Until the late 18th century, barnacle geese were considered to be non-meat food sources (due to beliefs that they were grown from barnacles) and was edible during Lent. Outside of Lent, the species was also hunted and consumed during their wintering stay in the British Isles by the coastal human populations. Currently, hunting and consumption of barnacle geese is prohibited by many governing bodies in both the British Isles and the European Arctic regions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barnacle Goose

The Barnacle Goose (Branta leucopsis) belongs to the genus Branta of black geese, which contains species with largely black plumage, distinguishing them from the grey Anser species. Despite its superficial similarity to the Brent Goose, genetic analysis has shown it is an eastern derivative of the Cackling Goose lineage.

Contents

Taxonomy and naming

The head of a Barnacle Goose

The Barnacle Goose was first classified taxonomically by Johann Matthäus Bechstein in 1803. Its specific epithet is from the Ancient Greek leuko- "white", and opsis "faced".

In English, the term "barnacle" originally referred only to this species of goose and only later to the crustacean barnacles. It is sometimes claimed that the word comes from a Celtic word for "limpet", but the sense-history seems to go in the opposite direction.[2]

Description

In flight

The Barnacle Goose is a medium-sized goose, 55–70 cm (22–28 in) long,[3] with a wingspan of 130–145 cm (51–57 in) and a body mass of 1.21–2.23 kg (2.7–4.9 lb).[4][5] It has a white face and black head, neck, and upper breast. Its belly is white. The wings and its back are silver-gray with black-and-white bars that look like they are shining when the light reflects on it. During flight a V-shaped white rump patch and the silver-gray underwing linings are visible.

Distribution

A flock of Barnacle Geese feeding at Helsinki, Finland

Barnacle Geese breed mainly on the Arctic islands of the North Atlantic. There are three main populations, with separate breeding and wintering ranges; from west to east:

Small numbers of feral birds, derived from escapes from zoo collections, also breed in other north European countries. Occasionally, a wild bird will appear in the Northeastern United States or Canada, but care must be taken to separate out wild birds from escaped individuals, as Barnacle Geese are popular waterfowl with collectors.

Ecology, behavior and life history

Flock on autumn migration

Barnacle Geese frequently build their nests high on mountain cliffs; away from predators (primarily Arctic Foxes and Polar Bears) but also away from food. Like all geese, the goslings are not fed by the adults. Instead of bringing food to the newly hatched goslings, the goslings are brought to the ground. Unable to fly, the three day old goslings jump off the cliff and fall; their small size, feathery down, and very light weight helps to protect some of them from serious injury when they hit the rocks below, but many die from the impact. Arctic foxes are attracted by the noise made by the parent geese during this time and capture many dead or injured goslings. The foxes also stalk the young as they are led by the parents to wetland feeding areas.[citation needed]

Its call is a "kaw".

Conservation

In Helsinki Zoo, Finland

The Barnacle Goose is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.[6] According to Sveriges ornitologiska förening the geese began breeding in Sweden in 71, and according to Skansen it was 40 years ago, more or less, when the entire population of Barnacle Geese left in the autumn to return in spring, soon after they began breeding in the wild.

Folklore

Barnacle Geese from the 1552 Cosmographia of Sebastian Münster.

The natural history of Barnacle Goose was long surrounded with a legend claiming that they were born of driftwood:

Nature produces [Bernacae] against Nature in the most extraordinary way. They are like marsh geese but somewhat smaller. They are produced from fir timber tossed along the sea, and are at first like gum. Afterwards they hang down by their beaks as if they were a seaweed attached to the timber, and are surrounded by shells in order to grow more freely. Having thus in process of time been clothed with a strong coat of feathers, they either fall into the water or fly freely away into the air. They derived their food and growth from the sap of the wood or from the sea, by a secret and most wonderful process of alimentation. I have frequently seen, with my own eyes, more than a thousand of these small bodies of birds, hanging down on the sea-shore from one piece of timber, enclosed in their shells, and already formed. They do not breed and lay eggs like other birds, nor do they ever hatch any eggs, nor do they seem to build nests in any corner of the earth.[7]

The legend was widely repeated in, for example, Vincent of Beauvais's great encyclopedia. However, it was also criticized by other medieval authors, including Albertus Magnus.[7]

Juvenile

This belief may be related to the fact that these geese were never seen in summer, when they were supposedly developing underwater (they were actually breeding in remote Arctic regions) in the form of barnacles—which came to have the name "barnacle" because of this legend.

Based on these legends—indeed, the legends may have been invented for this purpose[8]—some Irish clerics considered Barnacle Goose flesh to be acceptable fast day food, a practice that was criticized by a contemporary Welsh author:

...Bishops and religious men (viri religiosi) in some parts of Ireland do not scruple to dine off these birds at the time of fasting, because they are not flesh nor born of flesh.... But in so doing they are led into sin. For if anyone were to eat of the leg of our first parent (Adam) although he was not born of flesh, that person could not be adjudged innocent of eating meat.[7]

At the Fourth Council of the Lateran (1215), Pope Innocent III explicitly prohibited the eating of these geese during Lent, arguing that despite their unusual reproduction, they lived and fed like ducks and so were of the same nature as other birds.[9]

The question of the nature of Barnacle Geese also came up as a matter of Jewish dietary law in the Halakha, and Rabbeinu Tam (1100–71) determined that they were kosher (even if born of trees) and should be slaughtered following the normal prescriptions for birds.[7]

References

  1. ^ BirdLife International (2012). "Branta leucopsis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Oxford English Dictionary, 2nd Edition, 1989
  3. ^ Soothill, Eric; Whitehead, Peter (1978). Wildfowl of the World. London: Peerage Books. ISBN 0-907408-38-9. 
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ [1] (2011).
  6. ^ "Annex 2: Waterbird species to which the Agreement applies" (PDF). UNEP/AEWA (United Nations Environment Programme/African-Eurasian Waterbird Agreement). Retrieved 2008-07-20. 
  7. ^ a b c d Giraldus Cambrensis "Topographica Hiberniae" (1187), quoted in Edward Heron-Allen, Barnacles in Nature and in Myth, 1928, reprinted in 2003, p. 10. ISBN 0-7661-5755-5 full text at Google Books
  8. ^ Edwin Ray Lankester, Diversions of a Naturalist, 1915, reprinted 1970. full text at Google Books. ISBN 0-8369-1471-6: "this identification was due to the exercise of a little authority on the part of the clergy in both France and Britain, who were thus enabled to claim the abundant "barnacle goose" as a fish in its nature and origin rather than a fowl, and so to use it as food on the fast-days of the Church" (p. 119)
  9. ^ Edwin Ray Lankester, Diversions of a Naturalist, 1915, p. 119 full text
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!