Overview

Comprehensive Description

Description

Typical body shape of a pipid frog; tentacle below eye 0.5 of the eye diameter; foot with three horny claws.

A medium-sized clawed frog with button-like protruding eyes situated dorsally. Body flattened. Adults measure 38-60mm (SVL). The subocular tentacles are well developed, reaching about 0.6-1 of the eye diameter. The skin is almost smooth. Starting at the posterior border of the eye, a double line of elongate unpigmented flat sensory tubercles (lateral line sense organs) is arranged in roughly alternating order. The outer line comprises 20-29 tubercles set at right angles to the body axis. The inner one runs parallel to the latter, comprising about 16-20 tubercles. Furthermore, 3-7 pairs of these tubercles appear in the neck region, and 10-14 ones are found on the border of the lower jaw, set at right angles to the mouth. Like all of the dorsal surface, this part of the skin is scattered with numerous minute asperities which are equally unpigmented. Some of these may also be found on the fingers which are covered with numerous minute grooves. On breeding males, the outer part of the fingers is black. The dermal lobes above the vent are better developed in females. The web of the hind limbs is fully developed. Toes 3-5 have black horny claws. Metatarsal tubercle without claw. 2n = 36.

According to Stewart (1967), males from Malawi reach a SVL of 58 mm, females 72 mm. Concurring measurements were published by Nieden (1923), Poynton (1964a), Arnoult & Lamotte (1968), Lamotte & Xavier (1981) and Lambiris (1988). Poynton & Broadley (1985a) even specify a SVL of up to 80 mm. Smaller frogs, concerning animals from Cameroon, were measured by Mertens (1938a); SVL: males 38 mm; females 57 mm) and by Perret (1966); SVL: males 40-49 mm; females 54-63 mm). Nieden (1915) mentions a specimen from Tanzania showing traces of a fourth claw.

Coloration: Dorsal parts of body and limbs drab olive with large black patches that are sometimes vaguely defined. The iris shows a silver-grey glimmer. The venter is whitish to orange yellow. Some darker patches occasionally appear on the throat and on the thighs. A single female had the belly scattered with black spots. Distinctive ventral designs were reported from Ghanian frogs (Poynton 1964c). According to Loumont (1984), the dorsal patches of animals from Tanzania, Malawi and Zimbabwe are often arranged in two longitudinal rows. Mertens (1955b) mentions a female from Tanzania whose venter showed smoky-gray patches and a young specimen whose venter was plain white. In alcohol the dorsum turns almost completely gray olive, and the original black patches are hardly visible. The venter turns gray white, and black spots remain visible.

Voice: So far, it has not yet been registered at Comoé National Park. According to Schiøtz (1963), the call sounds like a rather low "pink-pink" resembling the sound produced by a spoon knocking against a pan. According to Vigny (1979), animals from Malawi produce a sequence of rattling "trra-trra" calls lasting 0.15-0.21 sec, the dominant frequency being 1.1 kHz. She describes two types of calls. Picker (1983) has also published sonagrams. These calls lasts 0.15 to 0.20 sec, comprising 5-6 pulses (dominant frequency: 0.8-0.9 kHz). Wager (1986) describes the call as "turrr", comparing it to the sound produced by a pencil vibrating against a glass pane. According to Lambiris (1988), two soft calls per second are uttered under water. Passmore & Carruthers (1995) report short "metallic" calls produced under water at intervals of 0.15 seconds. The vocal apparatus of the male has been examined by Loumont (1981).

This account was taken from Rödel, M.-O. (2000), Herpetofauna of West Africa vol. I. Amphibians of the West African Savanna, with kind permission from Edition Chimaira publishers, Frankfurt am Main.
For references in the text, see here

  • Frost, D. R. and Savage, J. M. (1987). ''Gender of Hemisus and correct formation of the family-group name.'' Journal of the Herpetological Association of Africa, 33, 24.
  • Lambiris, A. J. L. (1988). Frogs and Toads of the Natal Drakensberg, Ukhahlamba Series No. 3. University of Natal Press, Pietermaritzburg, South Africa.
  • Loumont, C. (1981). ''L'appareil vocal des males Xenopus (Amphibia Anura).'' Monitore Zoologico Italiano, N.S. Supplemento, 15(2), 23-28.
  • Loumont, C. (1986). ''Xenopus pygmaeus, a new diploid pipid frog from rain forest of equatorial Africa.'' Revue Suisse de Zoologie, 93(33), 735-764.
  • Loveridge, A. (1929). ''East African reptiles and amphibians in the United States National Museum.'' Smithsonian Institution, U.S. National Museum Bulletin, 151, 1-135.
  • Loveridge, A. (1930). ''A list of the Amphibia of the British territories in East Africa (Uganda, Kenya Colony, Tanganyika Territory, and Zanzibar), together with keys for the diagnosis of the species.'' Proceedings of the Zoological Society of London, 1930, 7-32.
  • Loveridge, A. (1932). ''New frogs of the genera Arthroleptis and Hyperolius from Tanganyika Territory.'' Proceedings of the Biological Society of Washington, 45, 61-64.
  • Loveridge, A. (1935). ''Scientific results of an expedition to rain forest regions in Eastern Africa, I. New reptiles and amphibians from East Africa.'' Bulletin of the Museum of Comparative Zoology, Harvard, 79, 1-19.
  • Loveridge, A. (1941). ''South African frogs of the genus Hyperolius in the Museum of Comparative Zoology, Cambridge, Massachusetts.'' Annals of the Transvaal Museum, 20, 283-291.
  • Loveridge, J.P. (1976). ''Strategies of water conservation in Southern African frogs.'' Zoologica Africana, 11, 319-333.
  • Mertens, R. (1938). ''Herpetologische Ergebnisse einer Reise nach Kamerun.'' Abhandlungen Senckenbergischen Naturforschenden Gesellschaft, 442, 1-52.
  • Mertens, R. (1968). ''Zur Kenntnis der Herpetofauna von Kamerun und Fernando Poo.'' Bonner Zoologische Beitrage, 19, 69-84.
  • Nieden, F. (1908). ''Die Amphibienfauna von Kamerun. Mit einer Bestimmungstabelle.'' Mitteilungen des zoologischen Museums Berlin, 3, 489-518.
  • Nieden, F. (1923). ''Anura I, Subordo Aglossa und Phaneroglossa sectio 1 Arcifera.'' Das Tierreich, 46, 1-584.
  • Nieden, F. (1926). ''Anura II, Engystomatidae.'' Das Tierreich , 49, 1-110.
  • Noble, G.K. (1926). ''The importance of larval characters in the classification of South African Salientia.'' American Museum Novitates, 237, 1-10.
  • Passmore, N.I. and Telford, S.R. (1981). ''The effect of chorus organization on mate localization in the Painted Reed Frog, Hyperolius marmoratus.'' Behavioral Ecology and Sociobiology, 9, 291-293.
  • Pfeffer, G. (1893). ''Ostafrikanische Reptilien und Amphibien, gesammelt von Herrn Dr. F. Stuhlmann im Jahre 1888 und 1889.'' Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten, 1893, 4(1), 69-105.
  • Picker, M.D. (1983). ''Hormonal induction of the aquatic phonotactic responses of Xenopus.'' Behaviour, 84, 74-90.
  • Poynton, J.C. (1964). ''Relationships between habitat and terrestrial breeding in amphibians.'' Evolution, 18, 131.
  • Poynton, J.C. (1966). ''Amphibia of Northern Mozambique.'' Mems. Inst. Invest. cient. Mocamb., Ser. A, 8, 13-33.
  • Poynton, J.C. and Broadley, D.G. (1985). ''Amphibia Zambesiaca 2. Ranidae.'' Annals of the Natal Museum, 27, 115-181.
  • Wake, M.H. (1980). ''The reproductive biology of Nectophrynoides malcolmi (Amphibia: Bufonidae), with comments on the evolution of reproductive modes in the genus Nectophrynoides.'' Copeia, 1980(2), 193-209.
  • Rödel, M. O. (2000). Herpetofauna of West Africa, Vol. I. Amphibians of the West African Savanna. Edition Chimaira, Frankfurt, Germany.
  • Arnoult, J. and Lamotte, M. (1968). ''Les Pipidae de l'Ouest africain et du Cameroun.'' Bulletin de l’Institut fondamental d’Afrique noire, Série A, 30, 270-306.
  • Lamotte, M. and Zuber-Vogeli, M. (1953). ''Contribution a l'étude des batraciens de l'Ouest Africain I. Le développement larvaires de Rana oxyrhynchus gribinguinensis Angel.'' Bulletin de l'Institut fondamental d'Afrique noire, Série A, 15, 178-184.
  • Loumont, C. (1983). ''Deux espèces nouvelles de Xenopus du Cameroun (Amphibia, Pipidae).'' Revue Suisse de Zoologie, 90, 169-177.
  • Perret, J.-L. (1971). ''Les espèce du genre Nectophrynoides d'Afrique (Batraciens Bufonides).'' Annales de la Faculté des Sciences du Cameroun, 6, 99-109.
  • Schiøtz, A. (1964). ''A preliminary list of amphibians collected in Ghana.'' Vedenskabelige Meddelelser fra Dansk Naturhistorisk Forening, 127, 1-17.
  • Vuattoux, R. (1968). ''Le peuplement du Palmier rônier (Borassus aethiopum) d’une savane de Côte d’Ivoire.'' Annales de l'Université d'Abidjan, Série E, 1, 1-138.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species appears to occur in three separate populations: from eastern Côte d’Ivoire and Burkina Faso eastward across Sudan-Guinea zone to northeastern Democratic Republic of Congo, South Sudan westwards to Dahomey, the Mozambique plain and its fringes northwards from Lake St Lucia in Zululand, Malawi and Zambia lowlands, Okavango area, Tanganyika, Zanzibar and Kenya; from the Kenyan coast, south to northeastern South Africa, Swaziland, northern Botswana, northeastern Namibia, and southeastern Angola; and from the Ennedi in northeastern Chad (Poynton 1964). It seems likely that many records from the inland parts of Tanzania currently assigned to this species should in fact be referred to Xenopus borealis, and the distribution maps probably records this species as occurring much too widely in this country. It is mainly a lowland species, but probably occurs up to at least 2,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

This species is quite common in most African savanna regions, south of the Sahara. According to Frost (1985), the range of X. muelleri comprises comparatively arid savannas, from Burkina Faso across the Sudan-Guinea zone to northern Zaire and the East African coast, thus reaching the Republic of South Africa. An isolated population has been recorded from north-eastern Chad. In particular, the species has been recorded from the following countries: Burkina Faso, Ivory Coast, Ghana, Benin, Nigeria, Cameroon, Congo, ?Gabon, Angola, Chad, R.D. Congo, Central African Republic, southern Sudan, Ethiopia, Uganda, Kenya, Tanzania, Zanzibar, Malawi, Zambia, Zimbabwe, Mozambique, Botswana, Swaziland, South Africa, Namibia (Peters 1882c, Nickel 1901, Lönnberg 1910, Nieden 1915, Noble 1924, Loveridge 1925, 1929, 1930, 1933, 1936, 1957, Parker 1930, Witte 1934, Mertens 1938a, 1955b, Laurent 1961b, Schiøtz 1963, 1964a, 1967, Poynton 1964a, c, 1966, 1993, Gorham 1966, Lamotte 1966, Perret 1966, Stewart 1967, Arnoult & Lamotte 1968, Walker 1968, Broadley 1971, Böhme 1975, Vigny 1977b, Joger 1981, 1982, 1990, Loumont 1984, Poynton & Broadley 1985a, Lambert 1987, Branch 1988, Hughes 1988, Lambiris 1988, 1989, Channing 1989, Channing & Griffin 1993, Simbotwe & Mubemba 1993, Pickersgill 1994, Passmore & Carruthers 1995, Böhme et al. 1996, Rödel 1996, 1998b).
This species inhabits savanna ponds of highly variable size. During the dry season, X. muelleri is found at the banks of rivers. The data found in the available literature almost exclusively refer to savanna habitats (e.g. Schiøtz 1967, Walker 1968, Joger 1981, Hughes 1988, Böhme et al. 1996). Only Schiøtz (1963) mentions a dry forest habitat where X. muelleri occurs in syntopy with Silurana tropicalis. However, the two species were never found in the same pond, thus resembling very much the situation in Comoé National Park. The data concerning the preferred habitat types are somewhat contradictory. For example, small ephemeral ponds are mentioned by Noble (1924), Loveridge (1933), Schiøtz (1963), Joger (1981, 1982) and Böhme et al. (1996), whereas Walker (1968), Broadley (1971), Lamotte & Xavier (1981), Poynton & Broadley (1985a), Lambiris (1988), and Passmore & Carruthers (1995) refer to permanent ponds and lowland rivers as preferred habitats. According to Channing (1989) X. muelleri in Namibia inhabits pans and deep pools, often even in the presence of large fish. Finally, Arnoult & Lamotte (1968) state
semi-permanent waters. It is very difficult to decide which habitat type is really preferred, as most studies exclusively refer to the actual state of the respective habitat, which may have appeared totally different as it was colonized by clawed frogs. Residuary puddles are mentioned quite regularly, but these are often situated in the dry beds of brooks and rivers. In the Comoé National Park, large but temporary pools are apparently preferred, at least during the breeding season.

  • Frost, D. R. and Savage, J. M. (1987). ''Gender of Hemisus and correct formation of the family-group name.'' Journal of the Herpetological Association of Africa, 33, 24.
  • Lambiris, A. J. L. (1988). Frogs and Toads of the Natal Drakensberg, Ukhahlamba Series No. 3. University of Natal Press, Pietermaritzburg, South Africa.
  • Loumont, C. (1981). ''L'appareil vocal des males Xenopus (Amphibia Anura).'' Monitore Zoologico Italiano, N.S. Supplemento, 15(2), 23-28.
  • Loumont, C. (1986). ''Xenopus pygmaeus, a new diploid pipid frog from rain forest of equatorial Africa.'' Revue Suisse de Zoologie, 93(33), 735-764.
  • Loveridge, A. (1929). ''East African reptiles and amphibians in the United States National Museum.'' Smithsonian Institution, U.S. National Museum Bulletin, 151, 1-135.
  • Loveridge, A. (1930). ''A list of the Amphibia of the British territories in East Africa (Uganda, Kenya Colony, Tanganyika Territory, and Zanzibar), together with keys for the diagnosis of the species.'' Proceedings of the Zoological Society of London, 1930, 7-32.
  • Loveridge, A. (1932). ''New frogs of the genera Arthroleptis and Hyperolius from Tanganyika Territory.'' Proceedings of the Biological Society of Washington, 45, 61-64.
  • Loveridge, A. (1935). ''Scientific results of an expedition to rain forest regions in Eastern Africa, I. New reptiles and amphibians from East Africa.'' Bulletin of the Museum of Comparative Zoology, Harvard, 79, 1-19.
  • Loveridge, A. (1941). ''South African frogs of the genus Hyperolius in the Museum of Comparative Zoology, Cambridge, Massachusetts.'' Annals of the Transvaal Museum, 20, 283-291.
  • Loveridge, J.P. (1976). ''Strategies of water conservation in Southern African frogs.'' Zoologica Africana, 11, 319-333.
  • Mertens, R. (1938). ''Herpetologische Ergebnisse einer Reise nach Kamerun.'' Abhandlungen Senckenbergischen Naturforschenden Gesellschaft, 442, 1-52.
  • Mertens, R. (1968). ''Zur Kenntnis der Herpetofauna von Kamerun und Fernando Poo.'' Bonner Zoologische Beitrage, 19, 69-84.
  • Nieden, F. (1908). ''Die Amphibienfauna von Kamerun. Mit einer Bestimmungstabelle.'' Mitteilungen des zoologischen Museums Berlin, 3, 489-518.
  • Nieden, F. (1923). ''Anura I, Subordo Aglossa und Phaneroglossa sectio 1 Arcifera.'' Das Tierreich, 46, 1-584.
  • Nieden, F. (1926). ''Anura II, Engystomatidae.'' Das Tierreich , 49, 1-110.
  • Noble, G.K. (1926). ''The importance of larval characters in the classification of South African Salientia.'' American Museum Novitates, 237, 1-10.
  • Passmore, N.I. and Telford, S.R. (1981). ''The effect of chorus organization on mate localization in the Painted Reed Frog, Hyperolius marmoratus.'' Behavioral Ecology and Sociobiology, 9, 291-293.
  • Pfeffer, G. (1893). ''Ostafrikanische Reptilien und Amphibien, gesammelt von Herrn Dr. F. Stuhlmann im Jahre 1888 und 1889.'' Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten, 1893, 4(1), 69-105.
  • Picker, M.D. (1983). ''Hormonal induction of the aquatic phonotactic responses of Xenopus.'' Behaviour, 84, 74-90.
  • Poynton, J.C. (1964). ''Relationships between habitat and terrestrial breeding in amphibians.'' Evolution, 18, 131.
  • Poynton, J.C. (1966). ''Amphibia of Northern Mozambique.'' Mems. Inst. Invest. cient. Mocamb., Ser. A, 8, 13-33.
  • Poynton, J.C. and Broadley, D.G. (1985). ''Amphibia Zambesiaca 2. Ranidae.'' Annals of the Natal Museum, 27, 115-181.
  • Wake, M.H. (1980). ''The reproductive biology of Nectophrynoides malcolmi (Amphibia: Bufonidae), with comments on the evolution of reproductive modes in the genus Nectophrynoides.'' Copeia, 1980(2), 193-209.
  • Rödel, M. O. (2000). Herpetofauna of West Africa, Vol. I. Amphibians of the West African Savanna. Edition Chimaira, Frankfurt, Germany.
  • Arnoult, J. and Lamotte, M. (1968). ''Les Pipidae de l'Ouest africain et du Cameroun.'' Bulletin de l’Institut fondamental d’Afrique noire, Série A, 30, 270-306.
  • Lamotte, M. and Zuber-Vogeli, M. (1953). ''Contribution a l'étude des batraciens de l'Ouest Africain I. Le développement larvaires de Rana oxyrhynchus gribinguinensis Angel.'' Bulletin de l'Institut fondamental d'Afrique noire, Série A, 15, 178-184.
  • Loumont, C. (1983). ''Deux espèces nouvelles de Xenopus du Cameroun (Amphibia, Pipidae).'' Revue Suisse de Zoologie, 90, 169-177.
  • Perret, J.-L. (1971). ''Les espèce du genre Nectophrynoides d'Afrique (Batraciens Bufonides).'' Annales de la Faculté des Sciences du Cameroun, 6, 99-109.
  • Schiøtz, A. (1964). ''A preliminary list of amphibians collected in Ghana.'' Vedenskabelige Meddelelser fra Dansk Naturhistorisk Forening, 127, 1-17.
  • Vuattoux, R. (1968). ''Le peuplement du Palmier rônier (Borassus aethiopum) d’une savane de Côte d’Ivoire.'' Annales de l'Université d'Abidjan, Série E, 1, 1-138.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The distribution of X. muelleri in sub-Saharan Africa is divided into two distinct areas containing animals that are morphologically similar but probably represent allopatric sibling species (Kobel et al. 1996). One of these forms, X. muelleri-East, extends from southeastern Kenya to South Africa (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Males are up to 50 mm and females up to 90 mm in snout-vent length (Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This is a large aquatic frog. The dorsum is gray with scattered darker blotches, and the ventral surface is light with bright yellow below the legs. Some faint gray shading is often present in the pectoral region. The eyes are small with round pupils and a conspicuous sub-ocular tentacle that is greater than ½ the diameter of the eye. Lateral line organs are clearly visible, appearing as a series of 22 – 27 ‘stitches’ along each side. The toes are fully webbed and the tips of the inner three toes end in darkly pigmented claws (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Comparisons

The sub-ocular tentacle of X. borealis is much shorter than ½ the diameter of the eye while that of X. muelleri is greater than ½ the diameter of the eye (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a water-dependent species, using both temporary and permanent ponds, and also streams and rivers in the dry season. In West Africa it occurs mainly in the dry savannah and northern humid savannah zones, preferring drier condition to Xenopus laevis. It is found in agricultural and other altered habitats. It seldom occurs in forests. It also prefers hotter conditions compared with X. laevis, and uses muddier waters. It breeds in still water pools.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Tinsley et al. (1996) records that X. muelleri inhabits all types of water bodies, including lowland rivers, lagoons, dams and pans (Poynton and Broadley 1985a), mainly in the Grassland and Savanna biomes. It is seldom found in pristine forest habitats, but readily moves into deforested areas (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

This aquatic species is found in lowland savanna, including permanent and temporary ponds, streams and rivers. It occurs primarily in lowland areas, but it may occur up to 2000 m. It tolerates habitat modification and can be found in agricultural areas (Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda; Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Xenopus meulleri tested positive for Batrachochytrium dendrobatidis in Swaziland in 1991 and 1998 (Weldon et al. 2004)

Fischer et al. (2000) recorded mixed populations and hybridization between X. muelleri and laevis in South Africa, the two species are largely allopatric. Prey items include beetles, beetle larvae and frogs’ eggs (Barbour and Loveridge 1928), while Loverridge (1953a) found predators include Hammerkop Scopus umbretta (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bergmann, Travis; Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Advertisement Call

Males call while under water, and lack a visible vocal sac. The call is a series of clicks emitted at a rate of two per second (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding takes place in muddy pools. The breeding behavior of this species is not well known. It is likely similar to that of other species in the genus in which eggs are attached to submerged rocks or vegetation. The eggs are small and darkly pigmented. Tadpoles are large with long tentacles that are at least ¼ the total length. Tadpoles lack keratinized mouthparts and form schools, feeding on unicellular algae in the water column. All Xenopus spp. lack tongues, and feed by sucking in aquatic prey, sometimes with the aid of their long fingers (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Zimkus, Breda

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Xenopus muelleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATTTTTGGTGCTTGAGCAGGCATGGTGGGTACAGCATTAAGTCTATTAATTCGAGCTGAATTAAGTCAACCCGGAACTTTACTAGGAGACGATCAGATTTATAACGTTATCGTTACAGCACATGCCTTTATTATAATTTTCTTCATAGTAATACCCATCATAATTGGTGGTTTTGGAAACTGACTAGTTCCATTAATGATCGGAGCACCTGACATGGCCTTTCCTCGAATAAATAATATAAGCTTCTGACTCTTACCTCCATCATTTCTTCTTTTATTAGCCTCATCTGGGGTCGAAGCAGGTGCAGGAACTGGTTGAACCGTCTATCCACCCTTGGCTGGAAACTTAGCACATGCTGGGGCATCAGTAGATTTAACTATTTTCTCTCTCCATTTAGCCGGTGTATCTTCCATTTTGGGTGCAATTAACTTCATTACCACCACTATTAACATAAAACCACCCGCTATATCCCAGTATCAAACACCCTTATTCGTCTGGTCTGTGTTAATTACCGCCGTTCTGCTGCTCTTATCTCTACCAGTCTTAGCTGCAGGTATCACAATACTTTTAACTGATCGAAATCTAAACACCACCTTTTTCGACCCTGCCGGAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Xenopus muelleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group

Reviewer/s
Stuart, S.N.

Contributor/s
Measey, J., Minter, L., Rödel , M.-O. & Tinsley, R.

Justification
Listed as Least Concern in view of its very wide distribution, its tolerance of a broad range of habitats and its presumed large population.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category and Justification of Conservation Status

X. muelleri is not threatened, and does not warrant conservation action (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Measey, G.J.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Spawn: Eggs have not yet been found at Comoé National Park. According to Arnoult & Lamotte (1968), eggs were attached singly to aquatic plants. Swisher (1969) reports that eggs were deposited on rocks and on leaves. Data concerning egg and clutch size are not published. In Xenopus laevis the egg diameter is 3 mm (Rose 1950).
Tadpoles: A typical pipid larva whose broad mouth resembles that of a catfish, lacking both horny beaks and teeth. Long, thin tentacles are situated on both sides of the mouth, reaching beyond the dorsal base of the tail fins when held against the body. The dorsal fin is considerably less broader than the ventral one. The ventral emargination of the fin between body and vent is rather marked. The tip of the tail is curved upward more visibly than in Silurana tropicalis. The coloration of larvae inhabiting muddy pools is transparent or cream. In rather somber habitats, the entire tail fin shows a blackish hue. Total length is 2.6-3 times the body length. The tail height is 2-2.3 times the body length. The intestines often shows a silvery glimmer. A paired spiracle is present on the venter.
In 1993, two weeks after the rainy season had set in, we found a larva measuring 60mm (TL) whose limbs had not yet emerged. Two weeks later, the tadpole metamorphosed, having reached a length of 21.8 mm. Some example measures and weights (TL in mm, weight in g): 42/ 0.24; 45/ 0.48; 48/ 0.75; 55/ 0.68; 58/ 1.44; 63/ 1.53; 68/ 1.38; 72/ 1.75. Metamorphosis set in when the tadpoles had reached a TL of more than 5 cm. The largest tadpole ever collected in Comoé National Park measured 100mm, showing fully developed hind limbs. Freshly metamorphosed young measured more than 20 mm. The largest tadpole collected by Noble (1924) measured 87mm. Stewart (1967) writes that the length of the tentacles corresponds to more than ¼ of the TL. According to Lambiris (1988), tadpoles reach a TL of 70 mm, whereas Arnoult & Lamotte (1968) mention animals measuring 98 mm (TL). According to the latter, the tentacles begin to emerge at a TL of 7 mm (BL: 2.5 mm). At this stage, exterior gills have already been reduced almost completely. Freshly metamorphosed animals are reported to measure 40 mm (SVL, Arnoult & Lamotte 1968).
X. muelleri spends the dry season in the bank zone of the rivers, migrating into the savanna as soon as heavy rainfall sets in. I have found them in the gallery forest only during those migrations. As X. muelleri reappears almost immediately even in ponds far away from the permanent rivers, it seems highly probable that some frogs survive the dry season in the mud of those ponds. In Nigeria, Schiøtz (1963) found animals under humid layers of leaf litter in the dry season. According to Noble (1924) they buried themselves in the mud when ponds dried out. If it happens to rain at night, the frogs often move between different ponds. Drift fences with pitfall traps arranged at one pool have shown that even well-filled ponds are often left and/or re-colonized by these animals. Short migrations made by adult specimens are referred to in Walker (1968), too. According to this author, the species call both during day and night.
Reproduction apparently takes place exclusively in a rather restricted number of ponds, so I seldom succeeded in recording tadpoles of X. muelleri (Rödel 1998b). They seem to be comparatively common in large ponds, but occur occasionally in puddles containing less than 200 l or in residuary ponds, e.g. those found in the dry beds of seasonal brooks. As the tadpoles inhabiting large ponds always form larger swarms whereas those found in puddles are less numerous or even solitary, it is highly probable that the latter have been washed accidentally into these habitats during periods of heavy rainfall. Like the tadpoles of S. tropicalis, those of X. muelleri filter their food in mid-water, swimming either on the spot, or moving forward rather slowly. In flight, however, these animals can reach astonishingly high speeds, jumping occasionally even above the surface. According to Stewart (1967) and Lambiris (1988), the tadpole of this species usually swim horizontally. In Comoé National Park I observed them always with the head directed downward. Stewart (1967) confirms that swarms of 20-30 specimens are found mostly in mid-water.
The observations made by Joger (1982) apparently speak in favor of a rather extended breeding season: he found various stages of development in one and the same pond. At Comoé National Park, tadpoles occur throughout the rainy season. The breeding ponds in Ghana are said to dry up before September (Arnoult & Lamotte 1968). In Nigeria, Walker (1968) found numerous mummified tadpoles, mainly during the months of November-December. Noble (1924) identified green algae and diatoms as food items in the alimentary tracts of tadpoles. Adults’ stomachs contained arthropods and small Xenopus tadpoles. Haagner & Haagner (1997) report on storks preying on X. muelleri in Natal.

  • Frost, D. R. and Savage, J. M. (1987). ''Gender of Hemisus and correct formation of the family-group name.'' Journal of the Herpetological Association of Africa, 33, 24.
  • Lambiris, A. J. L. (1988). Frogs and Toads of the Natal Drakensberg, Ukhahlamba Series No. 3. University of Natal Press, Pietermaritzburg, South Africa.
  • Loumont, C. (1981). ''L'appareil vocal des males Xenopus (Amphibia Anura).'' Monitore Zoologico Italiano, N.S. Supplemento, 15(2), 23-28.
  • Loumont, C. (1986). ''Xenopus pygmaeus, a new diploid pipid frog from rain forest of equatorial Africa.'' Revue Suisse de Zoologie, 93(33), 735-764.
  • Loveridge, A. (1929). ''East African reptiles and amphibians in the United States National Museum.'' Smithsonian Institution, U.S. National Museum Bulletin, 151, 1-135.
  • Loveridge, A. (1930). ''A list of the Amphibia of the British territories in East Africa (Uganda, Kenya Colony, Tanganyika Territory, and Zanzibar), together with keys for the diagnosis of the species.'' Proceedings of the Zoological Society of London, 1930, 7-32.
  • Loveridge, A. (1932). ''New frogs of the genera Arthroleptis and Hyperolius from Tanganyika Territory.'' Proceedings of the Biological Society of Washington, 45, 61-64.
  • Loveridge, A. (1935). ''Scientific results of an expedition to rain forest regions in Eastern Africa, I. New reptiles and amphibians from East Africa.'' Bulletin of the Museum of Comparative Zoology, Harvard, 79, 1-19.
  • Loveridge, A. (1941). ''South African frogs of the genus Hyperolius in the Museum of Comparative Zoology, Cambridge, Massachusetts.'' Annals of the Transvaal Museum, 20, 283-291.
  • Loveridge, J.P. (1976). ''Strategies of water conservation in Southern African frogs.'' Zoologica Africana, 11, 319-333.
  • Mertens, R. (1938). ''Herpetologische Ergebnisse einer Reise nach Kamerun.'' Abhandlungen Senckenbergischen Naturforschenden Gesellschaft, 442, 1-52.
  • Mertens, R. (1968). ''Zur Kenntnis der Herpetofauna von Kamerun und Fernando Poo.'' Bonner Zoologische Beitrage, 19, 69-84.
  • Nieden, F. (1908). ''Die Amphibienfauna von Kamerun. Mit einer Bestimmungstabelle.'' Mitteilungen des zoologischen Museums Berlin, 3, 489-518.
  • Nieden, F. (1923). ''Anura I, Subordo Aglossa und Phaneroglossa sectio 1 Arcifera.'' Das Tierreich, 46, 1-584.
  • Nieden, F. (1926). ''Anura II, Engystomatidae.'' Das Tierreich , 49, 1-110.
  • Noble, G.K. (1926). ''The importance of larval characters in the classification of South African Salientia.'' American Museum Novitates, 237, 1-10.
  • Passmore, N.I. and Telford, S.R. (1981). ''The effect of chorus organization on mate localization in the Painted Reed Frog, Hyperolius marmoratus.'' Behavioral Ecology and Sociobiology, 9, 291-293.
  • Pfeffer, G. (1893). ''Ostafrikanische Reptilien und Amphibien, gesammelt von Herrn Dr. F. Stuhlmann im Jahre 1888 und 1889.'' Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten, 1893, 4(1), 69-105.
  • Picker, M.D. (1983). ''Hormonal induction of the aquatic phonotactic responses of Xenopus.'' Behaviour, 84, 74-90.
  • Poynton, J.C. (1964). ''Relationships between habitat and terrestrial breeding in amphibians.'' Evolution, 18, 131.
  • Poynton, J.C. (1966). ''Amphibia of Northern Mozambique.'' Mems. Inst. Invest. cient. Mocamb., Ser. A, 8, 13-33.
  • Poynton, J.C. and Broadley, D.G. (1985). ''Amphibia Zambesiaca 2. Ranidae.'' Annals of the Natal Museum, 27, 115-181.
  • Wake, M.H. (1980). ''The reproductive biology of Nectophrynoides malcolmi (Amphibia: Bufonidae), with comments on the evolution of reproductive modes in the genus Nectophrynoides.'' Copeia, 1980(2), 193-209.
  • Rödel, M. O. (2000). Herpetofauna of West Africa, Vol. I. Amphibians of the West African Savanna. Edition Chimaira, Frankfurt, Germany.
  • Arnoult, J. and Lamotte, M. (1968). ''Les Pipidae de l'Ouest africain et du Cameroun.'' Bulletin de l’Institut fondamental d’Afrique noire, Série A, 30, 270-306.
  • Lamotte, M. and Zuber-Vogeli, M. (1953). ''Contribution a l'étude des batraciens de l'Ouest Africain I. Le développement larvaires de Rana oxyrhynchus gribinguinensis Angel.'' Bulletin de l'Institut fondamental d'Afrique noire, Série A, 15, 178-184.
  • Loumont, C. (1983). ''Deux espèces nouvelles de Xenopus du Cameroun (Amphibia, Pipidae).'' Revue Suisse de Zoologie, 90, 169-177.
  • Perret, J.-L. (1971). ''Les espèce du genre Nectophrynoides d'Afrique (Batraciens Bufonides).'' Annales de la Faculté des Sciences du Cameroun, 6, 99-109.
  • Schiøtz, A. (1964). ''A preliminary list of amphibians collected in Ghana.'' Vedenskabelige Meddelelser fra Dansk Naturhistorisk Forening, 127, 1-17.
  • Vuattoux, R. (1968). ''Le peuplement du Palmier rônier (Borassus aethiopum) d’une savane de Côte d’Ivoire.'' Annales de l'Université d'Abidjan, Série E, 1, 1-138.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its range includes many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

X. muelleri is the second most traded frog species in Nigeria. In Burkina Faso, however, they seem to be avoided, so while they appear in the area, they are not a major source of animal protein. Frogs are an integral part of the economy in areas with large frog populations. Villagers are employed to catch and prepare frogs because they are an "important international trading item." Aside from their value as an essential food source, frogs and, more commonly, toads may also be used for cultural reasons and as traditional medicine in areas where Western medicine is not available. Though they are among the most traded frog species in Nigeria, only a few people interviewed "perceived a decline" (Mohneke, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Manalel, Jasmine

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Muller's Platanna

Müller's platanna (Xenopus muelleri) is a species of frog in the Pipidae family found in Angola, Benin, Botswana, Burkina Faso, Cameroon, the Central African Republic, Chad, the Republic of the Congo, the Democratic Republic of the Congo, Ivory Coast, Ghana, Kenya, Malawi, Mozambique, Namibia, Nigeria, South Africa, Sudan, Swaziland, Tanzania, Togo, Uganda, Zambia, and Zimbabwe. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical moist lowland forests, dry savanna, moist savanna, subtropical or tropical dry shrubland, subtropical or tropical moist shrubland, subtropical or tropical dry lowland grassland, subtropical or tropical seasonally wet or flooded lowland grassland, subtropical or tropical high-altitude grassland, rivers, intermittent rivers, swamps, freshwater lakes, intermittent freshwater lakes, freshwater marshes, intermittent freshwater marshes, freshwater springs, arable land, pastureland, rural gardens, water storage areas, ponds, open excavations, and canals and ditches.[1]

References[edit]

  1. ^ Measey, J., Tinsley, R., Minter, L. & Rödel, M.-O. 2004. Xenopus muelleri. 2006 IUCN Red List of Threatened Species. Downloaded on 23 July 2007.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!