Overview

Comprehensive Description

Description

Pseudacris crucifer is a small species of frog, ranging from .75 of an inch to 1.25 inches in total length. A characteristic 'X' mark can usually be seen on the back of the frog. While P. crucifer displays no distinct color patterns on its surface, its observed color may be yellow, brown, gray or olive. This species may be distinguished from other members of the genus by its lack in distinct stripes, mottling, spotting, and the characteristic 'X' mark. P. c. bartramiana. and P. c. crucifer are subspecies

There are two described subspecies, the Northern Spring Peeper and the Southern Spring Peeper. The Northern subspecies has a virtually plain stomach while the southern one has prominent dark spots on the belly. This species account was based on the account written by Conart and Collins, 1991.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Distribution and Habitat

Geographically, this species may be found from the Canadian Maritime Provinces to northern Florida, and from southeast Manitoba all the way to eastern Texas. One isolated (but natural) population exists in Kansas and an introduced population exists into Cuba. P. crucifer tends to be found in large numbers near ponds or swamps in brushy growth or cutover woodlands. Small, temporary or semipermanent lentic environments are ideal water sources for P. crucifer. Standing trees or shrubs provide a popular habitat for the choral groups to form.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern Spring Peepers are only native to the Nearctic region. They can be found from southeastern Canada, in Ontario and Quebec, throughout the eastern United States as far south as northern Georgia. In the United States they are restricted to east of the Mississippi river. Their cousins, Southern Spring Peepers, inhabit the southern parts of Georgia and northern Florida.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs throughout the eastern USA and adjacent southeastern Canada (east to Labrador, Bergman 1999), west to Manitoba, Minnesota, Iowa, eastern Kansas, Oklahoma, and eastern Texas (Conant and Collins 1991). It is absent from southern Florida. It was formerly believed to have been introduced in Cuba (Schwartz and Henderson 1991), but it has not been found there (Powell and Henderson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pseudacris crucifer is native to eastern North American. It is found from southeast Manitoba east to the Atlantic Ocean, and south to eastern Texas and mainland Florida (but not on the Florida Peninsula). It is reported to have been introduced to Cuba as well.

Biogeographic Regions: nearctic (Native ); neotropical (Introduced )

  • Conant, R., J. Collins. 1998. A Field Guide to Reptiles and Amphibians. Boston, Massachusetts, USA: Houghton Mifflin Company.
  • Skelly, D. 1996. Pond Drying, Predators, and the Distribution of Pseudacris Tadpoles. Copeia, 1996(3): 599-605. Accessed August 24, 2007 at http://www.jstor.org/view/00458511/ap050444/05a00100/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends throughout the eastern United States and adjacent southeastern Canada east to Labrador (Bergman 1999), west to Manitoba, Minnesota, Iowa, eastern Kansas, Oklahoma, and eastern Texas, south to the Gulf Coast and northern Florida (Conant and Collis 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

The Northern Spring Peeper is a frog that varies in size from 19 to 35 mm at maturity. These frogs range in color from shades of brown to gray or olive, and occasionally may be yellow or reddish. Like many frogs, their color can vary with temperature and other conditions of their surroundings. Their bellies are cream or white, and they are marked by a dark cross on their backs and dark bands on their legs. Their coloration makes them very difficult to see on the tree bark and leaf litter where they are normally found. Northern Spring Peepers have slightly webbed feet and noticeable disks on their fingers and toes. Females tend to be slightly larger and lighter in color. Males also often have a flap beneath their throats where their vocal pouches are. This flap can become much darker than normal during breeding season when they are calling the most.

Range length: 19.0 to 35.0 mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 4 g.

Average basal metabolic rate: 0.00105 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The average spring peeper varies in size from 20 - 25 mm at maturity. This frog is usually some shade of brown, gray, or olive, and occasionally may be yellow or reddish. Its belly is cream or white, and it is marked by a dark cross on its back and dark bands on its legs. Pseudacris crucifer has moderately webbed feet and noticeable disks on its fingers and toes.

Range mass: 3 to 5 g.

Range length: 20 to 25 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.00105 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 4 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

These frogs are found in marshy woods, non-wooded lowlands, and near ponds and swamps. Although they are good climbers, Northern Spring Peepers seem to prefer to be on the ground or burrowed into the soil. Because they breed in permanent or temporary water, they need to have pools in their habitat.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Typically it is found in moist wooded areas, especially near breeding pools. The species is mostly terrestrial and it hides under logs, rocks, or other objects when inactive. Eggs are laid and larvae develop in small temporary or permanent waters of ponds (including those in fields with nearby forest), marshes, ditches, and swamps, especially those with standing plants, sticks, or other debris. Males call usually from among herbaceous vegetation adjacent to or standing in water. In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This frog is found in marshy woods and non-wooded lowlands near ponds and swamps. Although it is a good climber, spring peepers seem to prefer to be on the ground or hiding in leaf litter. Spring peepers breed in freshwater ponds or pools, and prefer to use ponds where there are no fish. They often use temporary ponds that dry up after the larvae (tadpoles) have transformed into adult frogs and left the water.

One study found that during a drought in Arkansas, spring peepers were one of the most commonly discovered anuran in caves. The authors suggest this species used these caves in late summer (late July/early August) because the relative humidity in the caves was high (avg = 79%).

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; temporary pools

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; riparian ; caves

  • Prather, J., J. Briggler. 2001. Use of small caves by anurans during a drought period in the Arkansas Ozarks. Journal of Herpetology, 35 (4): 675-678.
  • Blair, J., R. Wassersug. 2000. Variation in the pattern of predator-induced damage to tadpole tails. Copeia, 2000: 390-401. Accessed October 15, 2007 at http://www.jstor.org/view/00458511/ap050459/05a00060/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Spring peepers inhabit moist wooded areas near breeding pools. They are mostly ground dwelling, and they hide under logs, rocks, or other objects when not active on the surface, such as during the cold winter months in the north. Eggs are laid and larvae develop in small temporary or permanent waters of ponds (including those in fields with nearby forest), marshes, ditches, and swamps, especially those with standing plants, sticks, or other debris. In northern Minnesota, successful reproduction in acidic bog water either does not occur or is a rare event (Karns 1992). Males call from among vegetation adjacent to or standing in water, or while perched low in woody vegetation away from water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between breeding pools and adjacent nonbreeding terrestrial habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern spring peepers eat mainly small insects and other arthropods, including Formicidae, Coleoptera, Diptera, Acari, Acari, Oniscidea, Lepidoptera, Collembola, and Araneae. They will eat almost any animal small enough to fit in their mouth. As tadpoles, however, northern spring peepers graze on algae or decaying plant material in ponds and pools.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Pseudacris crucifer is insectivorous, eating mainly small insects including ants, beetles, flies, and spiders. It is believed that food is chosen more by availability and size than by actual preference.

Subadult peepers are know to feed most often in the early morning hours and in the late afternoon, while adults more often fed in the late afternoon into the early evening hours.

Larvae graze on algae, detritus, and micro-organisms.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: algae

Other Foods: detritus ; microbes

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

  • Buell, M., W. Marshall. 1955. A study of the occurence of amphibians in relation to bog sucession, Itasca State Park, Minnesota. Ecology, 3: 381-387.
  • Oplinger, C. 1967. Food habits and feeding activity of recently transformed and adult Hyla crucifer crucifer Weid.. Herpetologica, 23: 209-217.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Metamorphosed frogs feed opportunistically on various small terrestrial invertebrates. Larvae eat suspended matter, organic debris, algae, and plant tissue.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Northern Spring Peepers are abundant predators or small insects and other arthropods, so help to control populations of these animals. They also help to support populations of the animals which prey on them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many animals will eat northern spring peeper tadpoles and adults, including large, aquatic Insecta, Squamata, larger Anura, Actinopterygii, and Aves. Their coloration makes them hard to see, allowing them to escape some predation. Also, their habit of congregating to mate at cool ponds in early spring reduces the number of predators that will be around to eat them.

Known Predators:

  • Actinopterygii
  • large Anura 
  • Squamata
  • Aves
  • Coleoptera
  • Heteroptera
  • Araneae
  • Anisoptera

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

The spring peepers' role (as adults) is to feed on insects, which put it in competition with other amphibians as well as different spider species that feed on insects as well. Vernal pond predators such as leeches, large insects, and salamander larvae may depend on the spring peeper as a source of food.

Spring peepers are hosts to parasites, including a protozoan species called Opalina obtrigonoidea.

Commensal/Parasitic Species:

  • Delvinquier, B., S. Desser. 1996. Opalinidae (Sarcomastigophora) in North American Amphibia: genus Opalina Purkinje and Valentin, 1835. Systematic Parasitology, 33 (1): 33-51.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many predators attack adult peepers, including salamanders, owls, large spiders, snakes, and other birds.

Predaceous aquatic invertabrates in vernal pools prey upon the spring peeper tadpole. The invertebrates include the predaceous diving beetle (Family Dytiscidae), leeches (Hirundinea), dragonfly larvae (Odonata) and giant water bugs ( Belastoma spp.). In response to the presence of predators, peepers in larval stage travel short distances in a darting fashion, then remains completely inactive for long bouts of time.

There has been a wealth of work examining tadpole phenotypic plasticity in common frogs like the spring peeper. With their short bodies and deep tails, peepers tend to sacrifice part of their tails during tadpole development. One study found that 62.7% of peeper individuals lost part of their tails during Gosner developmental stages 26-34. The proportion of the tail that was damaged was 8.5%. In later Gosner stages (35 - 43), only 34% of peepers exhibited tail damage, suggesting either that individuals can rehabilitate tails or that injured individuals do not survive to the next stage. However, spring peepers are one of the few species in this study that could tolerate tail loss exceeding 25% (sometimes >50%).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout most of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but is very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Michigan, nonbreeding home range diameters, established around forest debris and vegetation, ranged from 1.2 to 5.5 m (Delzell 1958).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male Northern Spring Peepers have a unique call. They make a single high-pitched note that lasts about a tenth of a second. They can make this sound because their vocal sacs are bigger than many other frogs. They repeat this note in rapid succession. Their call sounds very much like the peep of a chick and, when they are singing in chorus, they may be mistaken for the sound of sleigh bells.

Though Spring Peepers usually call during mating season, they have a separate call that they use when involved in a conflict or fight. They have also been known to call after rain storms and before hibernation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Mating calls are heard during early April - May, and greatest during warm, wet nights. They start calling when the ambient temperature is 28C. Calls (peeps) often end with a high pitched slur, and is repeated about 20 times/minute.

Communication Channels: acoustic

Other Communication Modes: duets ; choruses

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Peepers are most active at dusk and at night but are also active diurnally, especially in wet weather.

In autumn, long after the breeding season, spring peepers regularly call from upland areas that are far from water. The significance of these nonbreeding vocalizations has not been clearly established.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

After hatching from their eggs in ponds or pools, Northern Spring Peepers develop as tadpoles for 2 to 3 months. They then undergo metamorphosis, in which they transform into small frogs and begin their life on land.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Eggs are generally laid in temporary ponds. Embryos and larvae may die when the pH of the habitat ranges from 4.2 to 4.5. The larval stage can last from 45 to 90 days, and is partially dependent on the availability of water in vernal pools. Compared to a related species, Pseudacris triseriata, the spring peeper has a longer development time (a prolonged larval period), in which metamorphosis is delayed.

  • Smith, D., J. VanBurskirk. 1995. Phenotypic design, plasticity, and ecological performance in two tadpole species. American Naturalist, 145(2): 211-233.
  • Zampella, R., J. Bunnell. 2000. The distribution of anurans in two river systems of a Coastal Plain watershed. Journal of Herpetology, 34: 210-221. Accessed September 05, 2007 at http://www.jstor.org/view/00221511/ap050122/05a00080/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about lifespan in Northern Spring Peepers, but it is unlikely that most live longer than 3 years.

Typical lifespan

Status: wild:
3.0 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The longest known lifespan in wild is unknown. In captivity, peepers will live to 3 - 4 years.

Range lifespan

Status: captivity:
3 to 4 years.

Typical lifespan

Status: captivity:
3 to 4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals may live up to 4 years (Smirina 1994). Longevity in captivity has not exceeded 2.2 years, but with few animals being kept. Their maximum lifespan is likely underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: polygynous

Northern Spring Peepers begin breeding in the first year after they have hatched. The breeding period lasts from early spring to June, depending on the region. Most breeding occurs in April, although males may continue to call through June.

Females lay between 750 and 1300 eggs. The eggs are laid in small clusters, usually in rows attached to submerged vegetation. The tadpoles hatch in 4 to 15 days and then go through metamorphosis at between 45 and 90 days old.

Breeding interval: Northern Spring Peepers breed every year in the spring.

Breeding season: Breeding typically occurs from March to June.

Range number of offspring: 750.0 to 1300.0.

Range time to hatching: 15.0 (high) days.

Range : 45.0 to 90.0 days.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Northern Spring Peepers have no parental involvement after the eggs are laid.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males begin mating rituals shortly after the end of hibernation. The males will gather at small pools by the hundreds. Each male establishes a small territory and begins calling quite frequently. This call is described as a shrill "peep peep peep." The louder and faster he peeps, the better his chances of attracting a receptive female. Males usually compete in trios, and the male with the lowest-pitched call usually starts the vocal competition.

The spring peeper is usually about three years old before it reaches the breeding stage. The species is one of the first anurans to begin breeding after winter hibernation. The breeding period lasts from March - June, when 800 - 1000 eggs per female are laid in shallow ponds. The eggs hatch within 6 to 12 days, and tadpoles transform to adults during July (range 45 - 90 days).

Female spring peepers typically choose mates in a size-selective fashion -- larger males are preferred and are more successful breeders.

Breeding interval: Once yearly

Breeding season: April and May

Average number of offspring: 900.

Range time to hatching: 6 to 12 days.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Females lay eggs that they supply with nourishing yolk, but once they lay their eggs their investment is done. Males provide no parental care or investment, just fertilization.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

  • Lance, S., K. Wells. 1993. Are Spring Peeper satellite males physiologically inferior to calling males?. Copeia, 1993/4: 1162-1166.
  • Blaustein, A., L. Belden, D. Olson, D. Green, T. Root, J. Kiesecker. 2001. Amphibian breeding and climate change. Conservation Biology, 15/6: 1804-1809.
  • Woodward, B., S. Mitchell. 1990. Predation on frogs in breeding choruses. The Southwestern Naturalist, 35: 449-450.
  • Skelly, D. 1996. Pond Drying, Predators, and the Distribution of Pseudacris Tadpoles. Copeia, 1996(3): 599-605. Accessed August 24, 2007 at http://www.jstor.org/view/00458511/ap050444/05a00100/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The breeding season is in early spring in the northern part of the range but may occur in fall, winter, or early spring in the south. Adult females lay up to several hundred eggs (deposited singly on submerged vegetation or other objects). Eggs hatch in a few to several days. Larvae metamorphose in 2-4 months. Breeders in Maryland were 2-4 years old (Lyken and Forester 1987). Single site may include many dozens of breeding individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Glucose prevents formation of ice crystals: spring peepers
 

Glucose produced by spring peepers in cold weather reduces ice crystal formation by concentrating the frogs' body fluids.

     
  "In 1997, biologists from Pennsylvania's Slippery Rock University revealed that the spring peeper (Pseudacris crucifer), a tiny species of North American frog, produces glucose during frosty weather to concentrate its body fluids and so reduce ice crystal formation, enabling it to survive for up to three days with almost half of its total body fluid frozen. It returns to a fully active state in only a day after thawing out." (Shuker 2001:110)

"To prevent lethal freeze injury, these [North American] frogs initiate intensive hepatic glycogenolysis immediately after the onset of tissue freezing and concomitantly distribute the glucose throughout their bodies, raising levels of tissue glucose by as much as 10- 100 X above normal (Storey and Storey, 1984). The treefrog Hyla versicolor is exceptional because it converts most of the glucose into glycerol, which is then distributed to body tissues (Storey and Storey, 1985). Because so much of their body water is sequestered into ice (to 70%), frozen frogs cannot sustain systemic functions, including breathing, heartbeat, and blood flow (Layne et al., 1989). Upon thawing, freeze-tolerant frogs resume cardiovascular functions first, whereas, other functions resume during the ensuing hours (Layne and First, 1991)...Pseudacris crucifer mobilizes glucose to levels that are comparable to most other freeze-tolerant frogs." (Layne and Kefauver 1997:260)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Layne JR, Jr; Kefauver J. 1997. Freeze tolerance and postfreeze recovery in the frog Pseudacris crucifer. Copeia. 1(2): 260-264.
  • Layne JR, Jr; Lee RE. 1995. Adaptations of frogs to survive freezing. 5: 53-59.
  • Storey JM; Storey KB. 1985. Adaptations of metabolism for freeze tolerance in the gray tree frog, Hyla versicolor. 63: 49-54.
  • Storey JM; Storey KB. 1986. Freeze tolerance and in- tolerance as strategies of winter survival in terres- trially hibernating amphibians. 83A: 613-617.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudacris crucifer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTATCTAGTATTTGGGGCCTGAGCCGGCATAGTCGGCACAGCCCTAAGCCTCCTTATTCGAGCCGAATTAAGCCAACCCGGTTCCCTTCTCGGCGATGATCAAATCTACAACGTTATTGTTACGGCACATGCCTTCGTTATAATTTTCTTTATGGTAATACCCATTCTTATTGGAGGCTTCGGAAACTGACTTGTCCCCTTAATGATTGGAGCCCCTGATATAGCTTTTCCTCGAATGAATAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTTCTTCTCCTCGCATCAGCAGGTGTAGAGGCAGGTGCTGGCACCGGGTGAACTGTTTACCCCCCTCTAGCTGGGAACTTAGCACATGCAGGACCCTCAGTTGACCTAACCATTTTTTCCCTCCATCTAGCAGGAGTCTCTTCCATCCTAGGAGCTATTAATTTTATTACTACAATTCTTAACATAAAACCCCCCTCTATTACTCAGTATCAAACACCTTTATTTGTTTGATCTGTTCTGATTACTGCAGTTCTTCTGTTACTTTCACTACCCGTATTAGCTGCAGGTATCACTATATTACTTACAGACCGAAATCTAAATACAACATTTTTTGACCCTGCAGGCGGGGGAGATCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudacris crucifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Northern Spring Peepers have no special status in most areas. They are common and widespread but, due to loss of wetlands, their habitats are quickly dissapearing. In some areas their populations have decreased significantly. This is especially true in areas where wetlands have been virtually eliminated. For instance, in Iowa, where they are on the threatened species list.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This is a relatively common anuran within its range, but some states on the on the edge of its range give it special protection. It is listed as "Protected" in New Jersey and "Threatened" in Kansas.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Levell, J. 1997. A Field Guide to Reptiles and the Law. 2nd ed.. Lanesboro, Minnesota: Serpent's Tale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Abundant over most of large range.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The breeding season is the best time to see and hear P. crucifer in the wild. Occasionally, individuals may be seen during the day in damp or rainy weather. The call of this species resembles that of sleigh bells when heard from a distance. A terminal upward slur characterizes the high, single, clear whistle that is repeated at intervals of approximately 1 second. In the background of small choruses, a trilling peep may be uttered by some individuals.

  • Conant, R. and Collins, J. T. (1991). A Field Guide to Reptiles and Amphibians: Eastern/Central North America. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are thousands of populations and millions of individuals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Population trend is unknown but probably stable to slightly declining.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Wetland drainage reduces the available habitat. It does not thrive in areas of urbanization and intense agriculture, but the species is moderately adaptable. However, the species does not face major threats on a global scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Wetland drainage reduces available habitat. Does not thrive in areas of urbanization and intense agriculture. However, the species does not face major threats on a global scale.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation methods needed. It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Protect wetlands from drainage for urbanization/ agriculture.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of Northern Spring Peepers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Northern Spring Peepers may help to control mosquitoes and other small insects in the areas where they live.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Pseudacris crucifer on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spring peepers may help to control certain insect populations.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spring peeper

The spring peeper (Pseudacris crucifer)[1] is a small chorus frog widespread throughout the eastern USA and Canada.

Contents

Etymology and taxonomy [edit]

Subspecies [edit]

There are two subspecies of the spring peeper, the northern (P. c. crucifer) and the southern spring peeper (P. c. bartramiana). The northern is similar to the southern except for a strong dark marking on the southern frog's belly. P. c. bartramiana is found along the southern Gulf Coast from south eastern Texas to northern Florida and southern Georgia, while the northern can be found all over the eastern USA and eastern Canada.

Nicknames [edit]

On Martha's Vineyard, peepers are commonly called "pinkletinks"; in New Brunswick, Canada, they are sometimes called "tinkletoes", although not commonly known by that name, and usually referred to as simply "peepers". On Nova Scotia's South Shore, they are sometimes referred to as "pink-winks."

Anatomy and physiology [edit]

Spring peeper

Spring peepers are tan or brown with a dark cross that roughly forms an X on their dorsa (thus the Latin name crucifer, meaning cross-bearer[2]), though sometimes the marking may be indistinct.[3][4] They have a body length between less than 1 in (25 mm) to 1.5 in (38 mm)[4] and a weight between 0.11 and 0.18 oz (3.1 and 5.1 g).[3]

The species has large toe pads for climbing, although it is more at home amid the loose debris of the forest floor.[3]

The color variations of the P. crucifer are mostly tan, brown, olive green, and gray. Females are lighter-colored, while males are slightly smaller and usually have dark throats. This frog has a vocal sac located by its throat, which expands and deflates like a balloon to create a short and distinct peeping sound. Only males have the ability to make this loud high-pitched noise, and they use it to attract mates.

Ecology [edit]

Spring peeper

Spring peepers primarily live in forests and regenerating woodlands near ephemeral or semipermanent wetlands.[5] This amphibious species requires marshes, ponds, or swamp regions to support the aquatic environment the eggs and tadpoles need.

In the northern reaches of their range, spring peepers must frequently endure occasional periods of subfreezing temperatures during the breeding season. The species can tolerate freezing of some of its body fluids, and undergoes hibernation under logs or behind loose bark on trees.[3] It is capable of surviving temperatures as low as -8°C.[6] This species frequently occurs in breeding aggregations of several hundred individuals, and commonly breeds in many small wetlands, including swamps and temporary pools and disturbed habitats, such as farm ponds and borrow pits.[5]

Geographic range and habitat [edit]

The southern spring peeper's habitat includes the Gulf Coast from southeastern Texas to southeastern Georgia and northern Florida, United States. Its northern conspecific occurs in the entire United States east of the Mississippi and spreads to eastern and central Canada.[3][5]

Behavior [edit]

Diet [edit]

Spring peepers are nocturnal carnivores, emerging at night to primarily feed on small invertebrates, such as beetles, ants, flies, and spiders.[3] They do not climb high into trees, but hunt in low vegetation. Spring peepers living in deep, damp forests are active hunters both day and night, whereas those found in woodland edges restrict most hunting and other activity to night.[4]

Tadpoles feed on algae and other organisms in the water. Their predators include great diving beetle larvae (when in tadpole form), snakes, skunks, and larger frogs.

Vocalization [edit]

As their common name implies, the spring peeper has a high-pitched call similar to that of a young chicken, only much louder and rising slightly in tone. They are among the first frogs in the regions to call in the spring.[7] As a chorus, they resemble the sounds of sleigh bells.[8] They are heard early in spring not long after the ice melts on the wetlands.[4] The males usually call from the edges of the bodies of water in which they breed, hidden near the bases of shrubs or grasses. Even when calling, they may be difficult to locate, and are most easily seen when in amplexus in the shallows. As in other frogs, an aggressive call is made when densities are high. This call is a rising trill closely resembling the breeding call of the southern chorus frog (Pseudacris nigrita nigrita).[5]

Breeding and reproduction [edit]

P. c. crucifer tadpoles, about 4–5 wk old and 24 hours away from complete metamorphosis

Spring peepers breed in southern areas from October to March, depending on the local temperature. In northern areas, they breed between March and June, when the warm rains start. P. crucifer typically lays around 900 eggs per clutch, but up to 1000 are possible. Egg clusters are hidden under vegetation or debris at the water base. After hatching, they transform into frogs and are ready to leave the water in about eight weeks. In very cold weather, they hibernate under logs and loose bark. Spring peepers often call day and night as long as the temperature is above freezing, but they are mostly heard and usually not seen because they hide in dense plants. They are especially easy to hear due to their extremely loud mating call which gives them the name "peeper", but it is often hard to pinpoint the source of the sound, especially when many are peeping at once. The peepers generally breed close to dusk and throughout the evening and early morning hours. Their calls can be heard from as far as one to two and a half miles, depending on their numbers. The spring peeper can live an estimated three years in the wild.[3]

Conservation status [edit]

The spring peeper has no special status in most areas. They are common and widespread frogs in the eastern regions. However, their habitats are quickly changing due to loss of wetlands. In some areas, their populations have decreased significantly.[8]

The species is listed as threatened in both Iowa[8] and Kansas.[9]

References [edit]

  1. ^ ITIS Pseudacris crucifer (Integrated Taxonomic Information System). www.itis.gov.
  2. ^ http://www.etymonline.com/index.php?search=crucifer&searchmode=none
  3. ^ a b c d e f g "Spring Peeper Profile". National Geographic Society. Retrieved 2009-11-15. 
  4. ^ a b c d LeClere, Jeff. "Spring Peeper - Pseudacris crucifer". HerpNet. Retrieved 2009-11-15. 
  5. ^ a b c d "Spring Peeper". U.S. Geological Survey. Retrieved 2009-11-15. 
  6. ^ Adaptations of Frogs to Survive Freezing
  7. ^ "Pseudacris crucifer". Maryland Department of Natural Resources9. 
  8. ^ a b c "Spring Peeper". The Regents of the University of Michigan. BioKIDS. Retrieved 19 November 2009. 
  9. ^ "Pseudacris crucifer". The Regents of the University of Michigan and its licensors. Retrieved 19 November 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Hyla; transferred to the genus Pseudacris by Hedges (1986), based on allozyme data (see also Highton 1991). Proposed as sole member of distinct genus, Parapseudacris, by Hardy and Burroughs (1986); this proposal has not gained any significant support. Cocroft (1994) analyzed morphological and biochemical data sets and concluded that the spring peeper does not arise within Pseudacris but is the sister taxon to the clade containing the P. nigrita group, P. ocularis, and the P. ornata group; he concluded also that placement of crucifer in the genus Pseudacris is appropriate but noted that inclusion in a monotypic genus also could be justified. da Silva (1997) recommended that for now Hedges' (1986) definition of Pseudacris should be maintained.

A molecular phylogeny of Pseudacris based on mtDNA data (Moriarty and Cannatella 2004) revealed four strongly supported clades within Pseudacris: (1) A West Coast Clade containing regilla and cadaverina, (2) a Fat Frog Clade including ornata, streckeri, and illinoensis, (3) a Crucifer Clade consisting of crucifer and ocularis, and (4) a Trilling Frog Clade containing all other Pseudacris. Within the Trilling Frog Clade, brimleyi and brachyphona form the sister group to the Nigrita Clade: nigrita, feriarum, triseriata, kalmi, clarkii, and maculata. The Nigrita Clade shows geographic division into three clades: (1) populations of maculata and triseriata west of the Mississippi River and Canadian populations, (2) southeastern United States populations of feriarum and nigrita, and (3) northeastern United States populations of feriarum, kalmi, and triseriata. Current taxonomy does not reflect the phylogenetic relationships among populations of the Nigrita Clade (Moriarty and Canatella 2004). For example, the molecular data appear to indicate that triseriata, maculata, and clarkii in the western United States are conspecific, but the authors indicated that further sampling and analysis of the Trilling Frog Clade are needed before their relationships can be determined and an appropriate taxonomy established. Moriarty and Cannatella (2004) found that subspecific epithets for crucifer (crucifer and bartramiana) and nigrita (nigrita and verrucosa) are uninformative, and they therefore discouraged recognition of these subspecies. They concluded that further study is needed to determine if illinoensis warrants status as a distinct species. Molecular data were consistent with retention of regilla, cadaverina, ocularis, and crucifer in the genus Pseudacris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!