Overview

Comprehensive Description

Description

M 20-25 mm, F 30-34 mm. Tibiotarsal articulation usually reaches the tip of snout or beyond. Hand with some webbing, foot webbing 1(0), 2i(0), 2e(0), 3i(0), 3e(0), 4i/e(1), 5(0). Dorsal skin smooth. Dorsally green, with a more or less complete dorsolateral yellow stripe that fades at midbody. Small red dots and red patches above the eyes. Usually no brown pigments. Outer iris area bluish, iris periphery blue.

Similar species: Mainly B. bottae. The two species can occur in close syntopy, calling in the same shrubs along streams, and can be distinguished by the presence of usually at least some brown dorsal pigment in B. bottae.

Taken with permission from Glaw and Vences (2007).

  • Vences, M. and Glaw, F. (2008). Boophis rappiodes. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 14 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the eastern and southern rainforest belt of Madagascar, from Andasibe south to Nahampoana. Its recorded altitudinal range is 300-900m asl. Some old records of this species might be referable to Boophis bottae, or to undescribed species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Andasibe, Nahampoana, Ranomafana village, Vohiparara. It occurs between 300-900m asl in rainforest, generally along streams (Vences and Glaw 2008).

  • Vences, M. and Glaw, F. (2008). Boophis rappiodes. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 14 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives along streams in, and at the edge of, rainforest, but never fully outside forest. It presumably breeds in streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boophis rappiodes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCGCCCTCAGCCTCTTGATTCGAGCCGAACTAGGCCAGCCCGGAACTTTACTTGGTGAC---GATCAGATTTATAATGTTGTAGTTACTGCCCATGCTTTTGTAATAATTTTTTTCATAGTAATGCCCATTTTAATTGGAGGCTTTGGTAACTGACTAGTGCCGCTAATAATTGGAGCACCAGACATAGCCTTTCCCCGCATGAACAACATAAGCTTCTGGCTCTTGCCCCCTTCATTTTTTCTACTCCTAGCCTCCTCCATAGTTGAAGCTGGGGCCGGCACCGGATGAACTGTGTACCCGCCCTTGGCAGGCAATTTAGCCCACGCCGGACCCTCAGTTGATTTAACGATCTTTTCCCTCCATTTAGCGGGTGTCTCTTCAATTCTGGGAGCAATTAATTTTATCACAACTATTTTAAATATGAAACCACCTTCAATGACCCAGTACCAAACCCCTCTTTTTGTGTGATCAGTGTTAATCACAGCTGTCTTACTACTCCTATCCCTCCCAGTCTTAGCCGCTGGCATTACAATACTTCTTACAGACCGAAACTTAAACACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Boophis rappiodes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Miguel Vences, Frank Glaw

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a locally abundant species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

A pair was found in axillary amplexus along a stream in woodland, during a rainy night in November. In January, calling males were found after sunset along a brook, about one metre above the ground, near forest. Gravid females with large yellowish eggs were still found in March.

Call: At Tolagnaro short double-click-notes (duration 60-85 ms) were heard, repeated after intervals of 2800-5400 ms. Frequency ranges from 2.5 to 3.5 kHz and note repetition rate is about 0.3/s.

At Andasibe similar irregularly repeated double-click-notes were also often heard. Beside this call type motivated males displayed a different acoustic repertoire after heavy rainfall in December and January: 1) long series (duration: 5000-7000 ms) of many single click notes (note repetition rate about 10/s). Two double-clicks occur at the end of such a series. Frequency is 3.8-4.5 kHz. 2) series of about 5 regularly repeated double-click-notes (about 2 such notes per second), possibly with territorial function.

Eggs and tadpoles: One female deposited 260 glutinous light green eggs measuring 2 mm in diameter (ref. 89). A female (SVL 34 mm) found in December deposited about 300 yellowish eggs (egg diameter 2 mm, with jelly 3.5 mm. Tadpoles live in slow-running stretches of streams where the water is shaded by abundant vegetation. They are blackish, covered with small bright green spots. Total length in stage 25: 15-27 mm; in stages 31-41: 28-36 mm. The eyes are directed laterally. The mouth is small and directed ventrally. At midlength of the tail, the caudal musculature represents about 2/5 of the total tail height. Tooth formula is 1/3+3//1+1/2 or 1/2+2//1+1/2. Metamorphosis occurred in November; juveniles measure 11.5-14.0 mm SVL

Breeding takes place in streams (Vences and Glaw 2008).

  • Vences, M. and Glaw, F. (2008). Boophis rappiodes. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 14 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Its forest habitat is receding due to subsistence agriculture, timber extraction, charcoal manufacture, and invasive spread of eucalyptus, livestock grazing and expanding human settlements.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Least Concern: wide distribution and large population. It occurs in the Parc National de Ranomafana, and in the Analamazoatra Special Reserve (Vences and Glaw 2008).

  • Vences, M. and Glaw, F. (2008). Boophis rappiodes. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 14 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in the Parc National de Ranomafana, and in the Analamazoatra Special Reserve.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Boophis rappiodes

Boophis rappiodes is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests and rivers. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!