Overview

Comprehensive Description

Description

General body shape rather stout. SVL 20-27 mm (M 21-22 mm, F 24-25 mm). Upper head surface, dorsum and flanks usually blackish without recognizable dorsolateral colour border. Yellowish rostral stripe present. Femur and humerus yellow to green, this colour extending as large flank blotches onto the flanks and sometimes onto the dorsum. Distinct orange flashmarks present. Tibia, tarsus and foot orange, with or without blackish crossbands and marblings. Iris mostly containing light pigment in its upper part. Rostral stripe often in contact with flank blotch. Specimens of unknown origin in the pet trade were more variable yellow colour in varying extension can sometimes be present on the dorsum. All intermediate states from a few yellow spots, to a reticulated yellow marbling or a dense yellow speckling are known. A greenish frenal stripe, often interrupted, can be present as well. Other specimens are nearly uniformly yellow dorsally and ventrally, with only a few blackish spots and marblings. In these specimens, the more distinct yellow surface in the flank blotch area is reminiscent of the typical colouration, but it is not clear whether they really are conspecific with M. madagascariensis. Venter, throat and forelimbs black with light markings (mostly whitish-blue, sometimes yellow to green). These being generally rather large, rounded, and situated posteriorly on the venter. Distinct horseshoe marking present, more extended in males. Femur, tibia (except flashmark area), tarsus and foot often uniformly orange, in other specimens with areas of black and yellow (the latter corresponding to yellow colour on the dorsal surface). Areas of femoral "glands" often darkly pigmented. In some specimens, femur nearly totally black with blue spots. In "variable" specimens, entirely ventral pattern sometimes replaced by a dense yellow marbling.

Variation: Genetically, specimens from the Ranomafana area (in the general region where the types have been collected) are not placed in one clade with specimens from the Moramanga area. These south-eastern specimens which are to be considered as typical M. madagascariensis have a smaller body size but otherwise are not distinguishable from the central-eastern specimens by morphology or colouration.

Similar species: M. baroni is more slender and has no reddish flashmarks, M. pulchra is less colourful dorsally and has no distinct yellowish rostral stripe.

Taken with permission from Glaw and Vences (2007).

  • Andreone, F. and Glaw, F. (2008). Mantella madagascariensis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 22 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in east-central Madagascar from near Niagarakely, south to Ranomafana. It has been recorded from 700-1,050m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

One known from Ranomafana (Ranomafanakely, Vohiparara). Two known from Beparasy, Besariaka near Moramanga, Marolambo, Niagarakely. It occurs from 700 to 1,050m asl in forest and forest edge, particular along streams (Andreone and Glaw 2008).

  • Andreone, F. and Glaw, F. (2008). Mantella madagascariensis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 22 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a terrestrial species, living in forest and forest edge, in particular along streams. The eggs are laid on land, and the larvae develop in streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantella madagascariensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTTGTTCGTTGATTATTTTCTACAAATCATAAAGATATCGGCACACTTTACCTAATTTTCGGGGCATGAGCCGGAATGGTAGGCACTGCCCTCAGCCTCCTGATTCGAGCGGAACTGGCTCAACCCGGCACACTCCTCGGGGACGATCAGATTTATAATGTAATTGTAACTGCCCACGCCTTCGTCATAATCTTCTTTATAGTTATACCTATGCTAATCGGTGGATTTGGAAACTGACTAGTTCCATTAATAATTGGGGCCCCAGATATGGCCTTTCCTCGAATGAATAATATAAGTTTTTGACTACTCCCCCCTTCTTTCTTCTTGCTCTTAGCCTCTTCTATAGTAGAAGCAGGAGCTGGAACTGGATGAACAGTTTATCCTCCCTTAGCTGGAAACCTAGCCCATGCAGGACCATCTGTTGACCTAACCATTTTTTCTCTTCATCTAGCCGGGGTATCATCAATTCTTGGTGCTATTAATTTTATTTCTACAATTCTTAATATAAAGCCCCCATCGATCACCCAATACCAAACCCCCTTATTTGTCTGATCAGTTCTGATTACTGCAGTATTGTTACTTCTATCTCTCCCTGTTCTAGCTGCCGGTATTACTATACTCTTAACTGACCGTAATTTAAACACAACTTTCTTTGACCCAGCAGGCGGAGGAGACCCAATTCTTTATCAACACCTATTTTGATTCTTCGGCCACCCCGAAGTCTACATTCTCATCTTACCAGGATTCGGAATTATTTCTCATGTTGTAGCCTATTATTCTAATAAAAAAGAACCTTTCGGATATATAGGGATAGTTTGAGCTATGCTATCTATCGGTCTTCTAGGATTTATTGTCTGAGCTCATCATATGTTTACCACAGATCTTAATGTTGACACACGAGCCTACTTTACTTCCGCTACTATAATTATTGCTATTCCTACTGGAGTAAAAGTATTTAGCTGACTGGCAACAGTACACGGTGGAGTTATCAAATGAGAAACCCCCATACTTTGAGCCCTCGGCTTTATTTTTTTATTTACTGTGGGCGGGCTAACAGGAATCGTATTAGCTAACTCCTCCATTGACATCATACTACATGATACTTATTATGTAGTAGCCCACTTTCACTATGTTTTATCTATAGGAGCAGTATTTGCTATTATAGCTGGGTTTGTACATTGATTCCCCCTATTTACTGGATTCAATCTTCATCAACCCTGAACAAAAATCCATTTTGGGGTAATGTTCCTAGGTGTTAATTTAACATTTTTTCCCCAACACTTTTTAGGTCTAGCTGGGATACCTCGTCGATATTCTGATTATCCCGACGCTTACACCTTTTGAAACACAGTATCATCTATTGGCTCCTTAATTTCCCTTATTGCCGTAATTATTATAGTATATATTATCTGGGAAGCATTTGCCTCTCAACGACTTTTCGGAGAAGCTAAATTGACATCAACGAACATTGAATGATCTATAGGGTTTCCACCCAATTATCATACTTTTGAAGAATCAATTTTTTCAATAAAACCTGTGCGAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mantella madagascariensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2008

Assessor/s
Andreone, F. & Glaw, F.

Reviewer/s
Stuart, S.N., Chanson, J.S. & Cox, N.A.

Contributor/s

Justification
Listed as Vulnerable because its Extent of Occurrence is less than 20,000 km2, its distribution is severely fragmented, and there is continuing decline in the extent and quality of its forest habitat in eastern Madagascar.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is uncommonly encountered, but large numbers have been recorded in trade.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: Poorly known, along streams in primary rainforest. Active during the day on the ground.

Calls: Short chirps, arranged in less regular series.

Breeding occurs in streams, where larvae develop (Andreone and Glaw 2008).

  • Andreone, F. and Glaw, F. (2008). Mantella madagascariensis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 22 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Its forest habitat is receding due to subsistence agriculture (including livestock grazing), timber extraction, charcoal manufacture, the spread of invasive eucalyptus, and expanding human settlements. It is also possible that over-collecting for commercial and private purposes poses a threat, but this requires further investigation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Vulnerable: extent of occurrence is less than 20,000 km2. Its distribution is severely fragmented, and there is continuing decline in the extent and quality of its forest habitat in eastern Madagascar.Its presence is not confirmed in any protected areas, but it occurs close to Parc National de Ranomafana. There is a need for careful regulation of the trade in this species (Andreone and Glaw 2008).

  • Andreone, F. and Glaw, F. (2008). Mantella madagascariensis. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 22 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its presence is not confirmed in any protected areas, but it occurs close to Parc National de Ranomafana. There is a need for careful regulation of the trade in this species. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Madagascan mantella

The Malagasy Painted Mantella (Mantella madagascariensis) is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, and rivers. It is threatened by habitat loss.

Source[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!