Overview

Brief Summary

Biology

The nest is usually built by the female in a depression on the ground (2) amongst a tuft of long grass or heather (3). Eggs are laid between mid-March and early August; each clutch contains 3-5 eggs and hatching occurs about 14 days later (2). Most pairs have two or even three broods in the breeding season, as the time from laying to fledging is so short. During the breeding season the diet consists of invertebrates such as beetles, spiders, and caterpillars (3) taken from the lowest parts of plants or from moss. In winter the main food source is seeds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The woodlark is brown in colour, with a whitish eye stripe and an overall streaky appearance. The underparts are dull white and the tail is dark. There is a crest on the crown, but this may not always be visible. It can be distinguished from the similar skylark by its much shorter tail and smaller size. In flight the woodlark closes its wings and glides at regular intervals (2), a pattern of flight known as 'undulating flight'.  The melodious song is produced during a song flight, from a perch or from the ground (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The breeding range extends from southern Britain and southern Fenno-Scandia to southern Europe and east to the Urals. It tends to winter in the west and south of the range. In Britain some birds remain near the breeding range in winter, but part of the population moves to the continent (4). The woodlark was once a familiar breeding bird in most counties south from Yorkshire.Today it is mainly restricted to Devon, Dorset, Hampshire, Breckland, the Suffolk coast and the border between Surrey and Hampshire (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses a wide range of nesting habitats that vary depending on the region, the most important being recently felled and restocked forestry plantations (3), heathland (4) and unimproved pasture (2). They require patches of bare ground or very short vegetation interspersed with areas of long grass or heather in dry, well drained locations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lullula arborea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGCACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGCGCCCTGCTAGGGGATGACCAAATCTACAACGTAATCGTCACAGCCCACGCCTTCGTAATAATTTTCTTTATAGTCATACCAATTATAATCGGAGGCTTCGGAAACTGATTAGTACCACTGATAATTGGAGCGCCAGACATGGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTACCCCCATCCTTCCTCCTCCTACTAGCTTCCTCCACAGTAGAAACAGGCGCAGGAACAGGATGAACCGTATATCCCCCACTAGCAGGTAACCTAGCCCACGCTGGAGCCTCAGTCGATCTAGCCATCTTCTCCTTACACCTAGCAGGCATTTCATCAATCCTAGGAGCTATCAACTTTATCACCACGGCTATCAACATAAAACCACCTGCCCTCTCCCAATACCAAACCCCCCTGTTCGTATGATCAGTCCTAATCACCGCCGTACTCCTCCTCCTCTCCCTCCCCGTCCTAGCCGCCGGAATCACCATACTACTCACAGACCGCAACCTCAACACCACTTTCTTTGATCCCGCAGGCGGGGGAGACCCAGTGCTATACCAGCACCTATTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lullula arborea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Listed on the Birds of Conservation Concern Red List, Annex 1 of the EC Birds Directive and Appendix II of the Bern Convention. Protected in the UK under Schedule 1 of the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 1300000-3300000 breeding pairs, equating to 3900000-9900000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 4150000-13200000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Between 1968-72 and 1988-91 the breeding range of this species in the UK decreased by a huge 62%. The woodlark disappeared from Cornwall in the 1980s and ceased to breed in Wales in 1981. In 1986 the population was estimated to be just 250 pairs. The reasons for the decline include the huge decrease in the extent of England's lowland heathland (4). Since the 1950s, 40% of this habitat has been lost (4) due to conversion to agriculture and forestry (3). Pressure from roads and housing developments continues. Even where suitable habitat remains, if it is not managed appropriately it will not be inhabited by woodlarks. Grazing is essential in providing the mosaic of bare ground or short vegetation needed for feeding, and tussocky vegetation with bare patches needed for nesting by the woodlark. The rabbit population underwent a massive decline following the introduction of myxomatosis in the 1950s (4), this resulted in a reduction in woodlark numbers due to the grass growing too long (2). The UK population had increased to 620 pairs by 1993, and a further increase up to 1500 pairs had occurred by 1997 (BTO). The woodlark has returned to areas from which it had been absent for more than 25 years (2), although it is still absent from parts of its former range in Wales and south-west England.This bird is at the northern extreme of its range in Britain, and exceptionally cold winters can take a toll on populations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Woodlarks currently occur on a number of heathland nature reserves, including RSPB reserves, where its needs can be met through management. Heathland management encouraged by agri-environment schemes such as Countryside Stewardship and the Breckland Environmentally Sensitive Area (ESA) have benefited the species (4) The woodlark is a priority species under the UK Biodiversity Action Plan (UK BAP); the species Action Plan aims to increase the range and numbers of the woodlark, including the recolonisation of Wales and south-west England by 2008 (4). Main areas of work include protecting existing lowland heathland and suitable grassland habitats, creating new areas of habitat, and promoting sympathetic forestry management practices and extensive agricultural systems in the wider countryside (2). It is likely that any actions aimed at helping the woodlark will also benefit the nightjar, Caprimulgus europaeus (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Woodlark

The Woodlark (Lullula arborea) is the only lark in the genus Lullula. It breeds across most of Europe, the Middle East Asia and the mountains of north Africa. It is mainly resident in the west of its range, but eastern populations of this passerine bird are more migratory, moving further south in winter. Even in the milder west of its range, many birds move south in winter.

This is a 13.5–15 cm long bird of open heath with some trees, and other open woodlands, especially those with pines and light soil. Its generic name derives from its sweet plaintive song, delivered in flight from heights of 100 m or more.

Like most other larks, this is an undistinguished-looking species on the ground, mainly brown above and pale below, but with distinctive white superciliar meeting on the nape. In flight it shows a short tail and short broad wings. The tail is tipped with white, but unlike the Skylark, the tail sides and the rear edge of the wings are not edged with white.

The nest is on the ground, with up to 6 eggs being laid. Food is seeds supplemented with insects in the breeding season.

Contents

Culture

The Woodlark is commemorated by two famous British poets for its beautiful song. In The Woodlark2 Gerard Manley Hopkins departs from the standard tradition of British nature poetry by trying to transliterate the bird's song into made-up words, saying:

Teevo cheevo cheevio chee:
O where, what can tháat be?
Weedio-weedio: there again!
So tiny a trickle of sóng-strain;

The Scottish poet Robert Burns writes of the bird's "melting art" in his Address to the Woodlark3. However, since the Woodlark is not currently found in Scotland, it is possible that he confused the Woodlark with another bird. Another possibility is that the bird, whose range has contracted but is now expanding4, was found in Scotland during Burns's era.

References

2 http://www.poemhunter.com/poem/the-woodlark/
3 http://www.robertburns.org/works/526.shtml
4 http://www.rspb.org.uk/wildlife/birdguide/name/w/woodlark/index.aspx
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!