Overview

Brief Summary

Biology

The nest is usually built by the female in a depression on the ground (2) amongst a tuft of long grass or heather (3). Eggs are laid between mid-March and early August; each clutch contains 3-5 eggs and hatching occurs about 14 days later (2). Most pairs have two or even three broods in the breeding season, as the time from laying to fledging is so short. During the breeding season the diet consists of invertebrates such as beetles, spiders, and caterpillars (3) taken from the lowest parts of plants or from moss. In winter the main food source is seeds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The woodlark is brown in colour, with a whitish eye stripe and an overall streaky appearance. The underparts are dull white and the tail is dark. There is a crest on the crown, but this may not always be visible. It can be distinguished from the similar skylark by its much shorter tail and smaller size. In flight the woodlark closes its wings and glides at regular intervals (2), a pattern of flight known as 'undulating flight'.  The melodious song is produced during a song flight, from a perch or from the ground (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The breeding range extends from southern Britain and southern Fenno-Scandia to southern Europe and east to the Urals. It tends to winter in the west and south of the range. In Britain some birds remain near the breeding range in winter, but part of the population moves to the continent (4). The woodlark was once a familiar breeding bird in most counties south from Yorkshire.Today it is mainly restricted to Devon, Dorset, Hampshire, Breckland, the Suffolk coast and the border between Surrey and Hampshire (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses a wide range of nesting habitats that vary depending on the region, the most important being recently felled and restocked forestry plantations (3), heathland (4) and unimproved pasture (2). They require patches of bare ground or very short vegetation interspersed with areas of long grass or heather in dry, well drained locations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lullula arborea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGCACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGCGCCCTGCTAGGGGATGACCAAATCTACAACGTAATCGTCACAGCCCACGCCTTCGTAATAATTTTCTTTATAGTCATACCAATTATAATCGGAGGCTTCGGAAACTGATTAGTACCACTGATAATTGGAGCGCCAGACATGGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTACCCCCATCCTTCCTCCTCCTACTAGCTTCCTCCACAGTAGAAACAGGCGCAGGAACAGGATGAACCGTATATCCCCCACTAGCAGGTAACCTAGCCCACGCTGGAGCCTCAGTCGATCTAGCCATCTTCTCCTTACACCTAGCAGGCATTTCATCAATCCTAGGAGCTATCAACTTTATCACCACGGCTATCAACATAAAACCACCTGCCCTCTCCCAATACCAAACCCCCCTGTTCGTATGATCAGTCCTAATCACCGCCGTACTCCTCCTCCTCTCCCTCCCCGTCCTAGCCGCCGGAATCACCATACTACTCACAGACCGCAACCTCAACACCACTTTCTTTGATCCCGCAGGCGGGGGAGACCCAGTGCTATACCAGCACCTATTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lullula arborea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5