Overview

Brief Summary

Biology

The nest is usually built by the female in a depression on the ground (2) amongst a tuft of long grass or heather (3). Eggs are laid between mid-March and early August; each clutch contains 3-5 eggs and hatching occurs about 14 days later (2). Most pairs have two or even three broods in the breeding season, as the time from laying to fledging is so short. During the breeding season the diet consists of invertebrates such as beetles, spiders, and caterpillars (3) taken from the lowest parts of plants or from moss. In winter the main food source is seeds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The woodlark is brown in colour, with a whitish eye stripe and an overall streaky appearance. The underparts are dull white and the tail is dark. There is a crest on the crown, but this may not always be visible. It can be distinguished from the similar skylark by its much shorter tail and smaller size. In flight the woodlark closes its wings and glides at regular intervals (2), a pattern of flight known as 'undulating flight'.  The melodious song is produced during a song flight, from a perch or from the ground (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The breeding range extends from southern Britain and southern Fenno-Scandia to southern Europe and east to the Urals. It tends to winter in the west and south of the range. In Britain some birds remain near the breeding range in winter, but part of the population moves to the continent (4). The woodlark was once a familiar breeding bird in most counties south from Yorkshire.Today it is mainly restricted to Devon, Dorset, Hampshire, Breckland, the Suffolk coast and the border between Surrey and Hampshire (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses a wide range of nesting habitats that vary depending on the region, the most important being recently felled and restocked forestry plantations (3), heathland (4) and unimproved pasture (2). They require patches of bare ground or very short vegetation interspersed with areas of long grass or heather in dry, well drained locations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Lullula arborea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Lullula arborea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGCACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGCGCCCTGCTAGGGGATGACCAAATCTACAACGTAATCGTCACAGCCCACGCCTTCGTAATAATTTTCTTTATAGTCATACCAATTATAATCGGAGGCTTCGGAAACTGATTAGTACCACTGATAATTGGAGCGCCAGACATGGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTACCCCCATCCTTCCTCCTCCTACTAGCTTCCTCCACAGTAGAAACAGGCGCAGGAACAGGATGAACCGTATATCCCCCACTAGCAGGTAACCTAGCCCACGCTGGAGCCTCAGTCGATCTAGCCATCTTCTCCTTACACCTAGCAGGCATTTCATCAATCCTAGGAGCTATCAACTTTATCACCACGGCTATCAACATAAAACCACCTGCCCTCTCCCAATACCAAACCCCCCTGTTCGTATGATCAGTCCTAATCACCGCCGTACTCCTCCTCCTCTCCCTCCCCGTCCTAGCCGCCGGAATCACCATACTACTCACAGACCGCAACCTCAACACCACTTTCTTTGATCCCGCAGGCGGGGGAGACCCAGTGCTATACCAGCACCTATTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed on the Birds of Conservation Concern Red List, Annex 1 of the EC Birds Directive and Appendix II of the Bern Convention. Protected in the UK under Schedule 1 of the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 1300000-3300000 breeding pairs, equating to 3900000-9900000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 4150000-13200000 individuals, although further validation of this estimate is needed.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Between 1968-72 and 1988-91 the breeding range of this species in the UK decreased by a huge 62%. The woodlark disappeared from Cornwall in the 1980s and ceased to breed in Wales in 1981. In 1986 the population was estimated to be just 250 pairs. The reasons for the decline include the huge decrease in the extent of England's lowland heathland (4). Since the 1950s, 40% of this habitat has been lost (4) due to conversion to agriculture and forestry (3). Pressure from roads and housing developments continues. Even where suitable habitat remains, if it is not managed appropriately it will not be inhabited by woodlarks. Grazing is essential in providing the mosaic of bare ground or short vegetation needed for feeding, and tussocky vegetation with bare patches needed for nesting by the woodlark. The rabbit population underwent a massive decline following the introduction of myxomatosis in the 1950s (4), this resulted in a reduction in woodlark numbers due to the grass growing too long (2). The UK population had increased to 620 pairs by 1993, and a further increase up to 1500 pairs had occurred by 1997 (BTO). The woodlark has returned to areas from which it had been absent for more than 25 years (2), although it is still absent from parts of its former range in Wales and south-west England.This bird is at the northern extreme of its range in Britain, and exceptionally cold winters can take a toll on populations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Woodlarks currently occur on a number of heathland nature reserves, including RSPB reserves, where its needs can be met through management. Heathland management encouraged by agri-environment schemes such as Countryside Stewardship and the Breckland Environmentally Sensitive Area (ESA) have benefited the species (4) The woodlark is a priority species under the UK Biodiversity Action Plan (UK BAP); the species Action Plan aims to increase the range and numbers of the woodlark, including the recolonisation of Wales and south-west England by 2008 (4). Main areas of work include protecting existing lowland heathland and suitable grassland habitats, creating new areas of habitat, and promoting sympathetic forestry management practices and extensive agricultural systems in the wider countryside (2). It is likely that any actions aimed at helping the woodlark will also benefit the nightjar, Caprimulgus europaeus (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Woodlark

For other uses, see Woodlark (disambiguation).

The Woodlark or Wood Lark (Lullula arborea) is the only species in the lark genus Lullula. It breeds across most of Europe, the Middle East Asia and the mountains of north Africa. It is mainly resident in the west of its range, but eastern populations of this passerine bird are more migratory, moving further south in winter.

There are two subspecies of Woodlark, L. a. arborea and L. a. pallida. The former is native to northern regions of Europe, while the latter can be found in the south of the Woodlark's range. Their diet is mostly composed of seeds but also includes insects during the breeding period. A comparatively small bird, the Woodlark is between 13.5 and 15 centimetres long and roughly 20% shorter than the Skylark. It is a brown bird with a pale underside and has a white-tipped tail.

Taxonomy and systematics[edit]

There are two subspecies of Woodlark:[2]

Description[edit]

"Drawing of Woodlark"
Coloured lithograph by Magnus von Wright

This is a 13.5–15 cm long bird, slightly smaller than the Skylark[3] being roughly 20% shorter.[4] The Woodlark is mainly brown above and pale below, but with distinctive white superciliar meeting on the nape.[5] It has a crest which is quite small and at most times inconspicuous.[6] In flight it shows a short tail and short broad wings. The tail is tipped with white, but unlike the Skylark, the tail sides and the rear edge of the wings are not edged with white.

Distribution and habitat[edit]

Found mainly in Europe, the mountains of northern Africa and eastern Asia, the Woodlark is present across much of its range. In Europe, the bird seems most at home in the sandy heaths of Belgium, where its density was 7.5 pairs per square kilometre (km2) in 1988.[7] In the same year, densities in East Germany ranged from 0.29 to 5.0 pairs per km2 and between 0.1 and 0.25 pairs per km2 in Southern England, with more optimal habitats being more densely populated. However, populations fluctuated across Europe in the 1990s and 2000s and more up to date density figures are unavailable. The extent of the Woodlark's range is England in the west, parts of northern Egypt to the south, Iran and Turkmenistan to the east and the Scandinavian Peninsula in the north.[3][4][8] Declining populations have resulted in the Woodlark's range contracting, for example in Britain it once bred in Wales and central England but is now found only in southern England. Within its range it is mainly resident in the west, with eastern populations migrating south in the winter.

The Woodlark's natural habitat is heathland and open spaces sparsely populated with trees.[9] They prefer clearings in pine forests and heathland and like newly planted areas with pine saplings.[6] The bird can also be found more rarely in urban areas. For example, in 1950 a pair were recorded on a main road near Putney Heath, London.[6]

Behaviour[edit]

"Woodlark in flight"
Bird in flight at Südheide Nature Park

A songbird, the Woodlark has a melodious, warbling song often described onomatopoeically as a lu-lu-lu-[8] or, more precisely, as a "serial lū-lū-lū-lū-lū-", toolooeet toolooeet toolooeet.[3] The French name, Alouette lulu, and the scientific name, Lullula arborea, are derived from the sound of its song.[6] The male Woodlark has a song flight similar to that of the Eurasian Skylark but flutters more as he rises and spirals upwards, circling the ground as he sings at a fairly constant height. Both male and female birds will also sing from the ground or a perch.[8] Birds start singing early in the season, usually around February in Britain.

Breeding[edit]

Four eggs, part of the collections at the Muséum de Toulouse

The nest is generally made from grass, bracken, roots and moss and constructed in a depression on the ground.[8] Usually between 3 and 5 eggs are laid. The female will incubate the eggs, which are whitish with brown speckles, for 13 to 15 days.[3] Both parents will then feed the young in the nest and the chicks leave the nest after a further 11 to 13 days.[9] Two broods will normally be raised each year.

Food and feeding[edit]

As with many of the birds in the lark family, the Woodlark is primarily vegetarian as an adult but during the breeding season will also eat medium-sized insects.[4] The diet is mainly composed of seeds and such insects as beetles, flies and moths.[3][8] During the breeding season, the female incubates the eggs in spells of approximately 45 minutes and intervals of eight minutes feeding.[9]

Threats[edit]

Populations of Woodlark across Europe have been in decline and ranges have been contracting in recent years.[8] Habitat loss is thought to be a major contributor to this, with dry grassland, fallow land, lowland heathland and pasture being lost to agriculture, abandonment and development across Northern Europe.[10] Recent wildfires in England are also thought to have damaged the population, with some protected Woodlark habitats having been destroyed.[11]

In culture[edit]

Teevo cheevo cheevio chee:
O where, what can tháat be?
Weedio-weedio: there again!
So tiny a trickle of sóng-strain;
And all round not to be found
For brier, bough, furrow, or gréen ground
Before or behind or far or at hand
Either left either right
Anywhere in the súnlight.
Well, after all! Ah but hark—
‘I am the little wóodlark.

"The Woodlark" by Gerard Manley Hopkins

The Woodlark is commemorated in the works of two major poets. "The Woodlark", written by Gerard Manley Hopkins, departs from the standard tradition of British nature poetry by trying to transliterate the bird's song into made-up words.[12]

The Scottish poet Robert Burns wrote of the bird's "melting art" in his poem "To the Woodlark".[13] As there are currently no Woodlarks in Scotland, and Burns never travelled south of Carlisle, many have speculated that Burns never came in contact with the bird and was in fact writing about the Tree Pipit, which was commonly referred to as the Woodlark in Scotland.[14] The Woodlark's song is also thought to be melodious[8] while Burns' poem has an "underlying sense of grief" which may be attributed to the languishing notes at the end of the Tree Pipit's song.[14][15] However, the Woodlark has been spotted in Scotland on occasion[16] and it is possible that Burns was writing about this bird. This is backed up by the entry of a minister from Clinic, Perthshire in the Old Statistical Account, which reads "The notes of the wood-lark are heard, delightful along the banks of the Lunan in spring and autumn; its nocturnal song has a dying cadence peculiarly melodious and has often been mistaken for the song of the Philomel [nightingale]."[14][17]

Status[edit]

In Europe in 2004, the breeding population of Woodlark was estimated to number 1.3m-3.3m breeding pairs. Europe accounts for 75-94% of the global population, meaning between 4.15m and 13.2m individuals in its world range.[18] Populations of Woodlark have fluctuated across Europe, with specific figures available for Britain showing these fluctuations. An estimated 400 breeding pairs were present in England in 1981.[6] A series of systematic national surveys found 241 pairs in 1986, which increased to 1633 pairs in 1997 followed by an 88% increase to 3064 pairs in 2007.[19] The Woodlark has been categorised by the IUCN Red List of Threatened Species as being of Least Concern, meaning that it is not currently threatened with extinction.[1]

Fossil record[edit]

Lullula balcanica (late Pliocene of Varshets, Bulgaria)[20]

Lullula slivnicensis (late Pliocene of Slivnitsa, Bulgaria)[20]

Lullula minor (late Miocene of Polgardi, Hungary) [21]

Lullula parva (Pliocene of Csarnota, Hungary) [21]

Lullula minuscula (Pliocene of Beremend, Hungary) [21]

References[edit]

  1. ^ a b BirdLife International (2012). "Lullula arborea". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Clements, J.F.; Schulenberg, S.; Iliff, M.J.; Sullivan, B.L.; Wood, C.L.; Roberson, D. (2012). "The Clements Checklist". Cornell Lab of Ornithology. Retrieved 28 July 2013. 
  3. ^ a b c d e Černý, Walter (1975). A Field Guide in Colour to Birds. Translated by Margot Schierlová; Illustrated by Karel Drchal. London: Octopus Books Limited. pp. 156–157. ISBN 070640405X. 
  4. ^ a b c Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition 2. Oxford: Oxford University Press. pp. 1041–1043. ISBN 0198501889. 
  5. ^ "Woodlark". Birds by name. Royal Society for the Protection of Birds. Retrieved 29 July 2013. 
  6. ^ a b c d e Campbell, Donald (1999). The Encyclopedia of British Birds. Bath: Paragon. p. 165. ISBN 9780752541594. 
  7. ^ Simms, Eric (1992). British Larks, Pipits and Wagtails (1st ed.). HarperCollins. pp. 66–67. ISBN 0002198703. 
  8. ^ a b c d e f g Harbard, Chris (1988). Songbirds: How to attract them and identify their songs. London: Quarto Publishing plc. p. 53. ISBN 9780862724597. 
  9. ^ a b c Hayman, Peter; Burton, Philip (1979). The Birdlife of Britain. London: Mitchell Beazley Publishers Limited. p. 78. ISBN 0855330872. 
  10. ^ "Woodlark Lullula arborea". Joint Nature Conservation Committee. Retrieved 29 July 2013. 
  11. ^ "Fears about forest fire 'scale'". BBC News. 5 May 2011. Retrieved 29 July 2013. 
  12. ^ Phillips, Catherine (2001) [First published 1996]. "The Woodlark". Gerard Manley Hopkins: The Major Works. Oxford: Oxford University Press. p. 122. ISBN 9780199538850. 
  13. ^ Burke, Tim (2008). "To the Woodlark". The Collected Poems of Robert Burns. Hertfordshire: Wordsworth Editions Limited. p. 392. ISBN 9781853264153. 
  14. ^ a b c Jobling, James A. (2010). The Helm Dictionary of Scientific Bird Names. London: Christopher Helm. pp. 308–309. ISBN 9781408125014. 
  15. ^ Hudson, William Henry (1919). Birds in Town & Village (1st ed.). J M Dent & Sons. p. 46. 
  16. ^ Yarrell, William (1871–1874). "Woodlark". A History of British Birds I (2nd ed.). London: John Van Voorst, Paternoster Row. pp. 625–631. 
  17. ^ Hull, Robin (2001). Scottish Birds: Culture and Tradition (1st ed.). Mercat Press. ISBN 9781841830254. 
  18. ^ BirdLife International. 2004. Birds in Europe: population estimates, trends and conservation status. BirdLife International, Cambridge, U.K.
  19. ^ Conway G et al (2009) The status of breeding woodarks Lullula arborea in Britain 2006. Bird Study 56.3 pp310-325
  20. ^ a b Boev, Z. 2012. Neogene Larks (Aves: Alaudidae (Vigors, 1825)) from Bulgaria - Acta zoologica bulgarica, 64 (3), 2012: 295-318.
  21. ^ a b c Kessler, E. 2013. Neogene songbirds (Aves, Passeriformes) from Hungary. – Hantkeniana, Budapest, 2013, 8: 37-149.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!