Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Comprehensive Description

Description

Sachatamia albomaculata adult males range from 20.5 to 29 mm in size, while the females reach 22 to 32 mm (Savage 2002). Ground coloration is bluish green, with many light yellow to silver spots on low bumps on the dorsal surfaces (Savage 2002). There is a white stripe on the upper lip and along the margins of the lower limbs. (Savage 2002). The sides of the neck are spotted, while the underside of the limbs is whitish (Savage 2002). Ventrally, these frogs are translucent, and their digestive system is visible (Guyer and Donnelly 2005). A white parietal peritoneal sheath is present, but it does not extend very far posteriorly (Savage 2002). The pericardium is covered by a guanine sheath (Guyer and Donnelly 2005). The bones are green, and are visible when viewed from the dorsal side (Guyer and Donnelly 2005).

The head is as wide as it is long, and rounded when viewed dorsally (Savage 2002). The snout is rounded in profile (Savage 2002). Eyes are large, with gray-gold irises and black reticula, and the pupils are horizontal (Savage 2002). The dorsal skin is granular, with widely scattered bumps (Savage 2002). There is a fleshy fold on the forearm, along the posterior lower edge (Savage 2002). Finger and toe disks are present and truncate (Savage 2002). The outer fingers are webbed, and the toes are moderately webbed (Savage 2002). Males have white nuptial pads on the thumbs (Savage 2002).

Their appearance mostly resembles Fleishmann's Glassfrog and the Powdered Glassfrog. Fleishmann's Glassfrog is lighter in color than the Yellow-flecked Glassfrog and has white bones, while the Powdered Glassfrog has larger spots (Guyer and Donnelly, 2005).

The karyotype is 2N=20 (Duellman 1967).

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Duellman, W. E. (1967). ''Additional studies of chromosomes of anuran amphibians.'' Systematic Zoology, 16(1), 38-43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known from humid lowlands and premontane slopes from north-central Honduras to western Colombia (Chocó, Risaralda and Antioquia departments) and northwestern Ecuador (Esmeraldas and Imbabura provinces), from sea level to 1,500m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

These frogs can be found on the Caribbean slopes from Honduras to Costa Rica and on the Pacific slopes from Costa Rica to Colombia (Guyer and Donnelly 2005). They inhabit humid lowlands and premontane slopes from 20-1500 m (Savage 2002). They have also been found living on old cacao plantations, far from flowing water (Guyer and Donnelly 2005).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Duellman, W. E. (1967). ''Additional studies of chromosomes of anuran amphibians.'' Systematic Zoology, 16(1), 38-43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Costa Rica, Ecuador, Honduras, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  Small, delicate frog with large eyes and a rounded snout. Males to 29 mm, females to 32 mm.

Dorsal

Dorsal surface bluish-green and granular with small white or yellowish spots.

Distinguishing characteristics

Sachatamia albomaculata has a white line along the upper lip and along the outer arm.

Eye

Iris golden-gray with black reticulations. Pupil horizontal.

Extremities

The feet are moderately webbed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits humid lowland and montane forest, and is generally observed in bushes and trees along forest streams. Populations can persist alond streams in pastures with minimal riparian growth (Brian Kubicki pers. comm. 2007). The larvae develop in streams. It is restricted to forest covered streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland and premontane forest to 1500 m elevation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Populations of Sachatamia albomaculata are beginning to decline east of the Panama Canal due to the invasion of chytrid fungus (Woodhams et al 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A single dik (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Breeding season

This species breeds throughout the rainy season (Ibanez et al 1999, Puschendorf et al 2004). In Costa Rica, males aggregate and concentrate calling activity near waterfalls (Puschendorf et al 2004). Presumably, the spray from waterfalls allows them to prolong breeding into the early part of the dry season (Puschendorf et al 2004).

Egg

Newly laid eggs are black and white (Savage 2002).

Tadpole

The tadpole of Sachatamia albomaculata is undescribed but Lips and Savage (1996) suggest some characteristics that it is likely to have based on the features of other Centrolenid tadpoles. In particular, they are likely to have 3 lower teethrows and 1 full and 1 partial (limited to a short segment on either side) upper toothrow (Lips and Savage 1996). Centrolenid tadpoles are fossorial, living in the low-oxygen environment under mud and leaf litter in stream bottoms (McDiarmid and Altig 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Karyotype

Karyotype

2N = 20 (Duellman 1967)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sachatamia albomaculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cochranella albomaculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sachatamia albomaculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGGTTTTTGGTGCATGAGCTGGCATAGTAGGAACAGCCCTCAGCCTACTTATTCGAGCCGAACTAAGTCAACCTGGCTCTCTTTTAGGTGATGATCAAATCTATAACGTCATCGTTACAGCCCATGCTTTTGTTATAATTTTTTTCATAGTTATACCCATTCTAATCGGAGGATTTGGAAACTGATTAGTTCCATTAATAATTGGGGCACCAGACATGGCCTTCCCACGAATAAACAACATAAGCTTCTGACTGCTTCCTCCATCATTTTTACTTCTACTAGCATCTGCTGGTGTAGAAGCTGGAGCTGGGACCGGATGAACAGTATATCCGCCCTTAGCAGGAAATCTTGCTCACGCTGGCCCTTCTGTTGACCTAACAATTTTTTCCCTTCATTTAGCAGGTGTTTCCTCTATTCTCGGGGCCATTAACTTTATTACAACTATTCTAAATATAAAACCCCCATCAATAACACAATACCAAACCCCCTTATTTGTGTGATCAGTTTTAATTACAGCCGTTCTCCTACTTCTGTCACTTCCAGTGCTAGCCGCCGGAATTACAATACTTTTAACCGATCGAAATCTTAACACTACCTTCTTTGACCCAGCAGGAGGTGGAGATCCAGTTTTATATCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Frank Solís, Roberto Ibáñez, Gerardo Chaves, Jay Savage, César Jaramillo, Querube Fuenmayor, Fernando Castro, Taran Grant, Erik Wild, Brian Kubiki, Javier Sunyer

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common and regularly encountered.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

These frogs are nocturnal. During the mating season, males emit calls consisting of a single short "dik", which may be repeated after intervals (Savage 2002). Calls are made at night, from low vegetation near rapidly-moving streams (Savage 2002). As with other glass frogs, this species is likely to make nests on leaves above water (Guyer and Donnelly 2005). The eggs are black-and white (Savage 2002). The adult diet most likely consists of small arthropods (Guyer and Donnelly 2005).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Duellman, W. E. (1967). ''Additional studies of chromosomes of anuran amphibians.'' Systematic Zoology, 16(1), 38-43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General habitat loss due to the destruction of natural forests is a localized threat to the species habitat, but at present there are no major threats to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

These frogs are moderately common (Savage, 2002).

  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • Duellman, W. E. (1967). ''Additional studies of chromosomes of anuran amphibians.'' Systematic Zoology, 16(1), 38-43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been recorded from many protected areas in Costa Rica and Panama. It was recently recorded from the Parque Nacional Saslaya in Nicaragua (Köhler et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cochranella albomaculata

Cochranella albomaculata is a species of frog in the Centrolenidae family. It is found in Colombia, Costa Rica, Honduras, and Panama. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, and rivers.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!