Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

Great Basin of w US to sw Brazil and central Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

White-faced ibises are widespread, with two distinct ranges; one population is found in North and Middle America and a separate population is found in South America. Those found in North and Middle America cover most of the western and mid-western United States and most of Mexico. Breeding areas are as far north as southern Canada and as far east as Nebraska. Additionally they are found along the Gulf coast of Texas and Louisiana and in central Mexico. However, all except those found in California, Texas, Louisiana and central Mexico will migrate to southern parts of their range during the non-breeding season. Most of these winter in Mexico but other populations migrate to Guatemala, El Salvador and Honduras. South American population of white-faced ibises do not migrate for the winter. They are found from southern Brazil and southeastern Bolivia to northern Argentina. The eastern and western boundaries of their range are the Pacific and Atlantic Oceans.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: locally from central California, eastern Oregon, southern Idaho (Taylor et al. 1989), Montana, southern North Dakota, and (formerly) southwestern Minnesota south into Mexico (to Colima, Zacatecas, state of Mexico, Veracruz), Texas, and southwestern Louisiana, southern Alabama, Florida (occasionally or formerly); also locally in South America in Bolivia, Paraguay, Uruguay, southern Brazil, northern and central Chile, and northern and central Argentina (AOU 1983). The world's largest nesting aggregation occurs probably in the marshes around the Great Salt Lake, Utah (D. Paul, in Paton et al. 1992). NON-BREEDING: north to southern California, Baja California, southern Texas, and Louisiana, south through lowlands to Guatemala and El Salvador, and in generally in breeding range in South America (AOU 1983). In the U.S., the highest winter densities occur near San Diego in California and on the coast of Texas and western Louisiana (Root 1988). Wanders outside usual range; rare straggler to Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White-faced ibises weigh between 450 and 525 grams and are 46 to 56 cm in length. Those found in South America tend to be smaller than those found in North America. When white-faced ibises first hatch they are bare on the underside and sparsely covered with brown or black down. After about two weeks they start to gain their juvenile plumage, which consists of the loss of down and gaining green and purple colored feathers. Juveniles are also noticeably smaller than adults. Adults are dark in color, either maroon or brown with dark green reflections on the underside. During mating season the head, neck, upper back, wing-coverts and underside becomes more chestnut in color. In both breeding and nonbreeding seasons there is a metallic green look to the flight feathers. These ibises get their name from the white coloring, which can be seen on their face and throat. Males have the same coloring as females but males are generally bigger than females. Parts of the face, as well as the legs and feet are red or purple because bare skin is exposed. The length of the bill varys between 15 and 18 cm, males have longer bills than females. There are no described sub-species.

Range mass: 450 to 525 g.

Range length: 46 to 56 cm.

Range wingspan: 94 to 99 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 58 cm

Weight: 697 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Breeding adult differs from glossy ibis in having a reddish bill, red eyes, all-red legs, and a white feathered border around the facial skin; border extends behind eye and under chin. Winter adult differs from glossy ibis in lacking the pale line from the eye to the bill. (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Plegadis chihi
Catalog Number: USNM 53671
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Immature
Preparation: Skin: Whole
Collector(s): R. Ridgway
Year Collected: 1867
Locality: Oreana, Camp 17, Humboldt River Valley, Pershing, Nevada, United States, North America
  • Cotype: Ridgway. February 1874. American Naturalist. 8: 110.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Plegadis chihi
Catalog Number: USNM 84604
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Immature
Preparation: Skin: Whole
Collector(s): R. Ridgway
Year Collected: 1867
Locality: Oreana, Camp 17, Humboldt River Valley, Pershing, Nevada, United States, North America
  • Cotype: Ridgway. February 1874. American Naturalist. 8: 110.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-faced ibises are found in both temperate and tropical regions. They tend to live in fresh and saltwater marshes containing many rushes and sedges which are used to nest on, for nesting materials, and for finding food. These birds are also found around ponds, rivers and in flooded pastures and agricultural fields. Rainy conditions are required for both foraging and nesting rainy conditions are required, limiting the areas in which they are found and influencing movement patterns. White-faced ibises are found from near sea level to 4300 m elevation in South America.

Range elevation: 0 to 4300 m.

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Marshes, swamps, ponds and rivers, mostly in freshwater habitats (Tropical to Temperate zones) (AOU 1983). Nests in marshes; in low tree, on the ground in bulrushes or reeds, or on a floating mat. In the Central Valley of California, ibises preferentially selected foraging sites close to emergent vegetation (Safran et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Resident in southern part of breeding range, migrates in northern areas. Northern populations winter from the southern U.S. south to northern Central America (Sibley and Monroe 1990).. In northern Utah, generally arrives in early April, most depart by late August, occasionally lingers into December (Paton et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White-faced ibises feed by probing the substrate with their long bill, in search of small animals. They feed in large groups of up to 1000 individuals. They feed mainly in moist areas around bodies of water and also in shallow (less than 20 cm) water. They are primarily carnivorous and feed on insects, crustaceans, spiders, snails, leeches, and amphibians. Snails and slugs are the large prey group by volume, accounting for 55 to 90% of all food eaten. Prey taken varies with the season, with more insects in the spring and summer than in other seasons. Males tend to eat more snails and slugs and females tend to eat more insects.

Animal Foods: amphibians; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Typically feeds in freshwater marshes on: crayfishes, frogs, fishes, insects, newts, earthworms, crustaceans, etc. (Terres 1980). In the Central Valley of California, preferentially selected foraging sites with significantly higher midge (Chironomidae) and significantly lower oligochaete biomass (Safran et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White-faced ibises aerate the soil with their foraging method of pushing their bill into the ground. They are important predators of many aquatic invertebrate groups, impacting their populations. Additionally, they are the hosts of several species of parasites: Ardeicola rhaphidius, Ciconiphilus blagoweschenskii, Colpocephalum leptopygos, Ibidoecus bisignatus, and Plegadiphilus plegadis.

Ecosystem Impact: soil aeration

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The eggs, nestlings, and fledglings of white-faced ibises are taken by many different predators, including gull species (Larus), black-billed magpies (Pica pica), black-crowned night herons (Nycticorax nycticorax), common ravens (Corvus corax), raccoons (Procyon lotor), striped skunks (Mephitis mephitis), spotted skunks (Spilogale putorius), coyotes (Canis latrans), mink (Neovison vison), and long-tailed weasels (Mustela frenata). Mammals are more likely to become predators when water levels around nests fall, making access to the nest easier. Peregrine falcons (Falco peregrinus) and red-tailed hawks (Buteo jamaicensis) are able to prey on the adult white-faced ibises, but Ryder and Manny (2005) report that predation on adults is rare. Humans (Homo sapiens) are major predators of white-faced ibises, for food, feathers, and sport. Adults are vigilant in protecting their eggs and young from predators, helping to avoid predation. Their flocking habits also help in alerting flock members to potential danger.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: In the 1980s, the Great Basin/Rocky Mountains population was estimated at 25,000 (appears healthy); 24,000 on Gulf Coast. See Spendelow and Patton (1988) for information on abundance of Plegadis on Gulf Coast. Little available information for other populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious; flocks of up to at least 290 have been observed, but generally they are much smaller.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

White-faced ibises communicate through sounds and visual displays. There are multiple different sounds that these birds make which have different meanings. There are separate sounds for calling to their young, when a mate is returning to the nest, and a sound used as a feeding call.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest known lifespan of this species in the wild is 14 years and 6 months. In captivity they have lived to 14 years. In a study done in Utah in 1967, 111 birds that had been tagged at birth were recovered, all of which died by the age of 9.

Range lifespan

Status: wild:
14.5 (high) years.

Range lifespan

Status: captivity:
14 (high) years.

Typical lifespan

Status: wild:
9 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.4 years (captivity) Observations: In the wild, the oldest individual found in one study was 9 years old (John Terres 1980). One animal was still alive after 20.4 years in captivity (Brouwer et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

If conditions are favorable, the mating process begins shortly after white-faced ibises return from their wintering locations. If conditions are not favorable, mating can be delayed temporarily or not undertaken at all in that year. Nesting occurs in dense, large colonies. It is unknown when the male and female bond. Some appear to return from wintering locations already as mated pairs, some seem to form pairs in the one or two weeks proceeding mating. It is also unknown how long this pairing lasts. Males display at multiple possible nesting sites, including previously used nests. Males use “ritualized bill probing” and also give a call that interested females answer with another call. Females choose the actual nesting site.

Mating System: monogamous

White-faced ibises breed once per year. The breeding season in North America is from April to May. In the event of unfavorable breeding conditions, this season can sometimes last until mid-June or the season can be skipped altogether. In South America the breeding season occurs in November and December. Eggs are laid at a one to two day interval with the average number of eggs laid each season being three to four and a range of two to seven. The eggs hatch after 20 days (range: 17 to 26). Before the young can fly on their own they are fed by their parents. During the first week after hatching there is a 60% mortality rate for third and fourth eggs produced, compared with a 5% mortality rate for first and second eggs. Young fledge after five weeks and are independent after eight weeks.

Breeding interval: White-faced ibises breed once yearly.

Breeding season: Nesting generally occurs April to June in North America and November to December in South America.

Range eggs per season: 2 to 7.

Average eggs per season: 3.5.

Range time to hatching: 17 to 26 days.

Average time to hatching: 20 days.

Average fledging age: 5 weeks.

Average time to independence: 8 weeks.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

White-faced ibis parents take turns in making the nest and guarding it. The male starts guarding the nest while the female gathers materials and then the role reverses while the female builds the nest the male gathers materials. Once the eggs have been laid, the parents take turns in caring for the eggs, normally the males during the day and the females at night. Both sexes will fiercely guard the nest and the area around the nest within a meter against intruders. They shade or incubate the eggs to keep them at the correct temperature. This treatment continues for the first week following hatching and occurs to a lesser extent (left alone for up to three hours) during the second week and is absent in the third week. Both male and female adults will feed the young. This is done by regurgitating partially digested food. The parents will also take the young on both a short walk and a short flight around the colony. There is no evidence to believe there is an association between the parents and young after they have reached independence.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually is 3-4. Incubation lasts 21-22 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plegadis chihi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATCTTTGGTGCATGAGCTGGTATAATCGGAACAGCACTCAGCTTATTAATTCGTGCAGAACTGGGACAACCAGGCACCCTCCTGGGAGACGACCAAATCTACAACGTAATTGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATGCCAATCATGATCGGCGGATTTGGCAACTGACTTGTACCCCTCATAATCGGGGCACCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTTCTCCTTCTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGGTGAACTGTATACCCACCACTTGCCGGCAACCTTGCCCATGCTGGTGCCTCAGTAGACCTTGCCATCTTCTCCCTCCACCTAGCAGGGGTGTCATCTATCTTAGGGGCAATTAACTTCATCACAACTGCTATCAACATAAAACCACCCGCCCTTTCACAATACCAAACACCCCTATTCGTCTGATCTGTCTTAATCACTGCCGTCTTACTGTTACTATCACTCCCAGTCCTCGCTGCTGGTATTACCATACTACTAACAGATCGAAACCTAAACACCACATTCTTCGACCCGGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTATATCTTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Plegadis chihi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-faced ibises have a large geographic range and populations remain large. Population trends haven't been quantified, but populations are believed to be stable currently.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1B - Critically Imperiled

United States

Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Secure due mainly to large range; locally fairly common; relatively small number of breeding areas; vulnerable to habitat alteration, disturbance during nesting, and pesticide contamination.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Limited number of breeding locations; vulnerable to fluctuating water levels. Susceptible to breeding failure in areas of pesticide contamination. Breeders in Nevada are still being contaminated with DDE-DDT in Mexican wintering areas (Henny and Herron 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

White-faced ibises sometimes have an economic impact on farmers because they can trample crops in wet fields during foraging. Crayfish farmers experiences losses when white-faced ibises visit their operations.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Ibises are hunted for food in some areas. They are also important for birding ecotourism and are essential components of the healthy, wetland habitats in which they live.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-faced Ibis

The White-faced Ibis (Plegadis chihi) is a wading bird in the ibis family Threskiornithidae.

Winter Quintana, Texas

This species breeds colonially in marshes, usually nesting in bushes or low trees. Its breeding range extends from the western USA south through Mexico, as well as from southeastern Brazil and southeastern Bolivia south to central Argentina, and along the coast of central Chile. Its winter range extends from southern California and Louisiana south to include the rest of its breeding range.

Non-breeding plumage

It is very similar to the Glossy Ibis in its non-breeding plumages, but the plumage color is somewhat warmer and breeding adults have a pink face bordered with white, a grey bill, and redder legs. Adults have red eyes year-round, whereas Glossy Ibises have dark eyes. Juveniles of the two species are nearly identical.

References

  • The Sibley Guide to Birds, David Sibley, 2000, ISBN 0-679-45122-6
  • Askwiki.com, For more information!
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: P. FALCINELLUS and P. CHIHI are sometimes considered conspecific (AOU 1998). Oberholser (1974) used the name P. MEXICANA, but P. CHIHI is the name accepted by others (Banks and Browning 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!