Articles on this page are available in 1 other language: Spanish (24) (learn more)

Overview

Brief Summary

Mycteria americana

A large (34-47 inches) wader, the Wood Stork is most easily identified by its white body, black wing edges, and large bald head. In flight, this species is easily separated from cranes by its short neck, from egrets by its ability to hold its neck extended in flight (as opposed to folding it back on its body), and from ibises by its extremely long legs. In fact, with its bald head and soaring flight, this species is more easily mistaken for a vulture than for any wader. Male and female Wood Storks are similar to one another in all seasons. The Wood Stork primarily breeds in the American tropics from southern Mexico and the Caribbean south to tropical portions of South America. In North America, this species is a local breeder and uncommon winter resident from south Florida north to coastal South Carolina. Non-breeding and post-breeding birds may wander widely during late summer, when they may turn up as far north as the Mid-Atlantic region and New England. Wood Storks breed in freshwater and brackish wetlands surrounded by trees, which this species uses to nest and roost colonially. In the non-breeding season, this species may be found in a number of wetland habitats ranging in size from large expanses of marshland to small ponds and canals. Wood Storks primarily eat small fish, but may also eat small quantities of insects and other small animals when available. Wood Storks may be best observed wading in shallow water, where they may be seen plunging their bills into the water to catch fish. It is also possible to see Wood Storks at their nest trees, especially when they return to roost at sunset, or while soaring singly or in small groups high above marshland. Wood Storks are primarily active during the day.

Threat Status: Least Concern

  • Coulter, M. C., J. A. Rodgers, J. C. Ogden and F. C. Depkin. 1999. Wood Stork (Mycteria americana), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/409
  • Mycteria americana. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Wood Stork (Mycteria americana). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Wood Stork. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mycteria americana range from North America to Argentina. In the United States, wood storks nest in South Carolina, Georgia, and Florida. After breeding they may disperse north to North Carolina or west to Mississippi and Alabama.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Brooks, B. 2001. Wood Stork (Mycteria americana). Endangered Species Update, 18: S38.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from southern Sonora, Mexican Plateau (rarely), U.S. Gulf Coast (Florida, formerly west to Texas), and Atlantic coast (South Carolina to southern Florida), south in lowlands to South America (to western Ecuador, eastern Peru, Bolivia, northern Argentina), and Antilles (Cuba, Hispaniola). The southeastern U.S. population is probably disjunct from those in Mexico-Central America. Some individuals, especially juveniles, wander north after the breeding season; may occur up the Mississippi Valley to Arkansas and west Tennessee and up the Atlantic coast to North Carolina; Mexican breeders may range to Texas and Louisiana. Recent breeding in the U.S. has occurred in Florida, southeastern Georgia (Ruckdeschel and Shoop 1989, Bratton and Hendricks 1990), and South Carolina. Center of breeding range in the U.S. has shifted northward since the mid-1970s (Ogden et al. 1987); the Everglades has become of lesser importance as a breeding area but remains critical as a foraging area, especially during dry years (Ehrlich et al. 1992), when possibly as much as 55% of the total U.S. population may use the Water Conservation Areas north of Everglades National Park (at least 8-10% in wet years) (Bancroft et al. 1992). Southeastern U.S. breeders winter within the breeding range, rarely north to northwestern Florida and coastal Georgia. In the U.S., the highest winter densities occur in peninsular Florida (Gulf and Atlantic coasts) (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S US to n Argentina, Brazil, Cuba and Hispaniola.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A., (CA, AZ, TX, to Carolinas), Mexico, C. and S. America

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adults usually measure one meter tall and can have a wingspan of over one and a half meters. They have a blackish bill, accompanied with a scaly-looking, featherless head and neck which sticks out straight when flying. The majority of the birds' body is white except for the primary, secondary, and tail feathers which are black. Immature wood storks have a pale yellow bill and dull gray-colored head and neck.

Average length: 1 m.

Average wingspan: 1.5 m.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 2500 g.

  • Farrand, J. 1983. Audubon Society Master Guide to Birding. Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 102 cm

Weight: 2702 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the jabiru by smaller size, smaller bill that turns downward rather than slightly upward, and by black (rather than white) flight feathers and tail. Differs from white ibis in larger size, thicker bill, and black tail. Differs from egrets and herons in having a curved bill rather than a straight one. (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12734 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.905 - 26.831
  Nitrate (umol/L): 0.049 - 1.794
  Salinity (PPS): 32.493 - 36.958
  Oxygen (ml/l): 4.577 - 5.624
  Phosphate (umol/l): 0.033 - 0.385
  Silicate (umol/l): 0.787 - 3.819

Graphical representation

Temperature range (°C): 16.905 - 26.831

Nitrate (umol/L): 0.049 - 1.794

Salinity (PPS): 32.493 - 36.958

Oxygen (ml/l): 4.577 - 5.624

Phosphate (umol/l): 0.033 - 0.385

Silicate (umol/l): 0.787 - 3.819
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wood storks inhabit mainly tidal waters, marshes, swamps, streams and mangroves. They hunt for prey in shallow, muddy-bottomed banks or wetlands. Their nests are ideally constructed in trees surrounded by water to limit depredation of the eggs.

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: brackish water

Wetlands: marsh ; swamp

Other Habitat Features: estuarine

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Chiefly freshwater situations: marshes, swamps, lagoons, ponds, flooded fields; depressions in marshes are important during drought; also occurs in brackish wetlands. Nests mostly in upper parts of cypress trees, mangroves, or dead hardwoods over water or on islands along streams or adjacent to shallow lakes. Feeds in freshwater marshes, swamps, lagoons, ponds, flooded pastures and flooded ditches, depressions in marshes (especially during drought).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12734 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.905 - 26.831
  Nitrate (umol/L): 0.049 - 1.794
  Salinity (PPS): 32.493 - 36.958
  Oxygen (ml/l): 4.577 - 5.624
  Phosphate (umol/l): 0.033 - 0.385
  Silicate (umol/l): 0.787 - 3.819

Graphical representation

Temperature range (°C): 16.905 - 26.831

Nitrate (umol/L): 0.049 - 1.794

Salinity (PPS): 32.493 - 36.958

Oxygen (ml/l): 4.577 - 5.624

Phosphate (umol/l): 0.033 - 0.385

Silicate (umol/l): 0.787 - 3.819
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Individuals from Mexican west coast are regular post-breeding migrants in California and Arizona; breeders from eastern Mexico appear in Texas and Louisiana (Matthews and Moseley 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adult wood storks eat small fish, frogs, mollusks, snails, insects, and aquatic invertebrates. It has been calculated that a 2.5 kilogram bird would eat more than half a kilogram of fish daily. Wood storks wade through shallow water feeling for movement and snap their bill shut when they touch a fish. Vision is not as important as touch, and the bill-snapping reflex of the stork is one of the fastest reflexes known in vertebrates, taking only about 25 thousandths of a second (Wolkomir and Wolkomir, 2001). It was also recently discovered that wood storks often leave the roost at night to catch prey or fish during nocturnal low tides. This allows them to feed without the competition of other large shorebirds such as great egrets.

Animal Foods: amphibians; fish; insects; mollusks

Primary Diet: carnivore (Piscivore )

  • Bryan, A., J. Snodgrass, J. Robinette, J. Daly, L. Brisbin. 2001b. Nocturnal activities of post-breeding Wood Storks. The Auk, 118 (2): 508-313.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly fishes (usually over 3.5 cm long), also miscellaneous other small animals, detected mainly by contact with touch-sensitive bill. Forages mainly in shallow water (about 15-50 cm deep) and flooded fields; attracted to areas with falling water level and hence concentrated food sources (Palmer 1962, Ogden et al. 1978). May feed cooperatively, wading together in shallow water (Hilty and Brown 1986). Conservative estimate is that one pair requires about 200 kg of fish in one breeding season to supply needs of adults and young (see Van Meter 1989). May travel long distances (sometimes over 100 km, usually not more than 56 km) between nesting and feeding areas when feeding young (Ogden et al. 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Wood storks and other wading birds are an integral part of the marshland food chain along with other reptilian and mammalian predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The greatest threat to wood storks are raccoons (Procyon lotor) that climb to the nests to eat the chicks. Alligators (Alligator mississippiensis) may also pose a problem to unwary birds.

Known Predators:

  • raccoons (Procyon lotor)
  • American alligators (Alligator mississippiensis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Mycteria americana is prey of:
Procyon lotor
Alligator mississippiensis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Mycteria americana preys on:
Actinopterygii
Mollusca
Insecta
Amphibia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Occurs locally throughout range in North, Central, and South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: There are no known rangewide estimates for population numbers. The largest colonies are in the Usumacinta-Grijalva delta in southeastern Mexico; these colonies had 5000-10,000 pairs in the 1980s (Ogden et al. 1989). U.S. breeding pupulation was more or less stable at 7000-10,000 pairs in the early 1990s (Bancroft et al. 1992). Manry (1993) stated that only 4086 pairs were found in U.S. range in 1991. The U.S. Fish and Wildlife Service (1996; see Federal Register, 25 March 1996, also) stated that the U.S. population was 5500-6500 pairs over the last 12 years. The Florida population was estimated at: 9400 adults in 1983; 9500 adults in 1984; 5215 pairs in 1985; and 5130 pairs in 1986. "Statewide surveys in 1993, 1994, and 1995 produced estimates of 4402 (29 colonies), 3588 (26 colonies), and 5523 (33 colonies), respectively, in Florida... The numbers of storks nesting [were]...1661 pairs at 11 colonies in Georgia (M. Harris, pers. comm), and 806 pairs at 3 colonies in South Carolina (T. Murphy, pers. comm.) during 1993." (Ogden 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Notably gregarious. Roosts communally.

In Georgia, lower water level led to lower nesting success because of increased predation of young, presumably by alligators (Ruckdeschel and Shoop 1989). Rise in water level during nesting period may result in breeding colony abandonment (Ramo and Busto 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like other migrating birds, wood storks may locate their nesting grounds by recognizing geographical landmarks and sensing magnetic fields.

Perception Channels: visual ; tactile ; acoustic ; chemical ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The eggs are incubated for one month and the newborn chicks hatch weighing only 57 grams. They are completely helpless except for the feathered umbrella that the parents provide with their wings to shield them from heat and rain (Klinkenberg 1998). There is sibling competition for food and under stressful conditions only the first-born and largest will survive. During times of heavy rains, nestlings often die or are deserted by their parents (Ramo and Busto 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: One captive animal lived for 27 years (Brouwer et al. 1992).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Wood storks are monogamous.

Mating System: monogamous

Pairs often mate for life and return to the same nest each breeding season to raise their offspring. Breeding occurs from December to April. Nests are constructed out of sticks high atop cypress, mangrove, or other trees in marshy woodlands. Wood storks nest colonially with from 5 to 25 nests in a single tree.

Females lay 2 to 4 (usually 3) eggs per clutch. Incubation lasts 28 to 32 days and the young fledge after 55 to 60 days. Woodstorks do not begin to breed until they are 4 years old.

Breeding season: December to April

Range eggs per season: 2 to 4.

Range time to hatching: 28 to 32 days.

Range fledging age: 55 to 60 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 3.

Both the male and female take part in nest building, incubation and the feeding of their semi-altricial young. Chicks are fed regurgitated fish and are dependent on their parents for 55 to 60 days after they hatch.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
  • The Georgia Museum of Natural History, , Georgia Department of Natural Resources. 2000. "Storks" (On-line). Accessed January 21, 2004 at http://museum.nhm.uga.edu/gawildlife/birds/Ciconiiformes/mamericana.html.
  • Wolkomir, R., J. Wolkomir. 2001. In search of sanctuary: As its Florida habitat disappears, the American Wood Stork, our largest wading bird, is migrating northward to new nesting grounds. Smithsonian, February: 72.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting is tied to receding water levels and concentration of food sources, regardless of date. Clutch size is 2-5 (often 3). Incubation, by both sexes, lasts 28-32 days. Both parents tend young, which leave nest at 50-55 days (also reported as 9 weeks), return to nest for feeding and roosting until 75 days old. Nests in colonies of a few to thousands of pairs.

In Georgia, nesting was most successful if nesters did not experience (a) periods of cold weather and (b) raccoon predation that was associated with drying of the water under the colony (Coulter and Bryan 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mycteria americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGAGCATGGGCCGGCATAGTCGGAACCGCTCTCAGCCTCCTCATCCGTGCAGAACTCGGCCAGCCAGGAACCCTCTTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGATTCGGAAACTGACTTGTCCCACTTATAATCGGCGCCCCAGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCACCATCCTTCTTGCTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCTCCTCTAGCTGGCAACTTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCTCTCCACCTGGCAGGTGTCTCCTCAATCCTAGGAGCAATCAACTTTATCACAACTGCCATCAACATAAAACCTCCTGCCCTATCACAGTACCAAACTCCCCTATTCGTATGATCCGTCCTAATCACTGCCGTCCTTCTACTACTCTCCTTACCAGTCCTCGCTGCAGGTATTACCATGCTACTAACAGATCGAAACCTAAATACCACATTCTTTGATCCAGCTGGAGGAGGAGACCCTGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mycteria americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5