Articles on this page are available in 1 other language: Spanish (24) (learn more)

Overview

Brief Summary

Mycteria americana

A large (34-47 inches) wader, the Wood Stork is most easily identified by its white body, black wing edges, and large bald head. In flight, this species is easily separated from cranes by its short neck, from egrets by its ability to hold its neck extended in flight (as opposed to folding it back on its body), and from ibises by its extremely long legs. In fact, with its bald head and soaring flight, this species is more easily mistaken for a vulture than for any wader. Male and female Wood Storks are similar to one another in all seasons. The Wood Stork primarily breeds in the American tropics from southern Mexico and the Caribbean south to tropical portions of South America. In North America, this species is a local breeder and uncommon winter resident from south Florida north to coastal South Carolina. Non-breeding and post-breeding birds may wander widely during late summer, when they may turn up as far north as the Mid-Atlantic region and New England. Wood Storks breed in freshwater and brackish wetlands surrounded by trees, which this species uses to nest and roost colonially. In the non-breeding season, this species may be found in a number of wetland habitats ranging in size from large expanses of marshland to small ponds and canals. Wood Storks primarily eat small fish, but may also eat small quantities of insects and other small animals when available. Wood Storks may be best observed wading in shallow water, where they may be seen plunging their bills into the water to catch fish. It is also possible to see Wood Storks at their nest trees, especially when they return to roost at sunset, or while soaring singly or in small groups high above marshland. Wood Storks are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Resident from southern Sonora, Mexican Plateau (rarely), U.S. Gulf Coast (Florida, formerly west to Texas), and Atlantic coast (South Carolina to southern Florida), south in lowlands to South America (to western Ecuador, eastern Peru, Bolivia, northern Argentina), and Antilles (Cuba, Hispaniola). The southeastern U.S. population is probably disjunct from those in Mexico-Central America. Some individuals, especially juveniles, wander north after the breeding season; may occur up the Mississippi Valley to Arkansas and west Tennessee and up the Atlantic coast to North Carolina; Mexican breeders may range to Texas and Louisiana. Recent breeding in the U.S. has occurred in Florida, southeastern Georgia (Ruckdeschel and Shoop 1989, Bratton and Hendricks 1990), and South Carolina. Center of breeding range in the U.S. has shifted northward since the mid-1970s (Ogden et al. 1987); the Everglades has become of lesser importance as a breeding area but remains critical as a foraging area, especially during dry years (Ehrlich et al. 1992), when possibly as much as 55% of the total U.S. population may use the Water Conservation Areas north of Everglades National Park (at least 8-10% in wet years) (Bancroft et al. 1992). Southeastern U.S. breeders winter within the breeding range, rarely north to northwestern Florida and coastal Georgia. In the U.S., the highest winter densities occur in peninsular Florida (Gulf and Atlantic coasts) (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

S US to n Argentina, Brazil, Cuba and Hispaniola.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mycteria americana range from North America to Argentina. In the United States, wood storks nest in South Carolina, Georgia, and Florida. After breeding they may disperse north to North Carolina or west to Mississippi and Alabama.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Brooks, B. 2001. Wood Stork (Mycteria americana). Endangered Species Update, 18: S38.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A., (CA, AZ, TX, to Carolinas), Mexico, C. and S. America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults usually measure one meter tall and can have a wingspan of over one and a half meters. They have a blackish bill, accompanied with a scaly-looking, featherless head and neck which sticks out straight when flying. The majority of the birds' body is white except for the primary, secondary, and tail feathers which are black. Immature wood storks have a pale yellow bill and dull gray-colored head and neck.

Average length: 1 m.

Average wingspan: 1.5 m.

Average mass: 2500 g.

  • Farrand, J. 1983. Audubon Society Master Guide to Birding. Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 102 cm

Weight: 2702 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the jabiru by smaller size, smaller bill that turns downward rather than slightly upward, and by black (rather than white) flight feathers and tail. Differs from white ibis in larger size, thicker bill, and black tail. Differs from egrets and herons in having a curved bill rather than a straight one. (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Marismas Nacionales-San Blas Mangroves Habitat

This taxon is found in the Marismas Nacionales-San Blas mangroves ecoregion contains the most extensive block of mangrove ecosystem along the Pacific coastal zone of Mexico, comprising around 2000 square kilometres. Mangroves in Nayarit are among the most productive systems of northwest Mexico. These mangroves and their associated wetlands also serve as one of the most important winter habitat for birds in the Pacific coastal zone, by serving about eighty percent of the Pacific migratory shore bird populations.

Although the mangroves grow on flat terrain, the seven rivers that feed the mangroves descend from mountains, which belong to the physiographic province of the Sierra Madre Occidental. The climate varies from temperate-dry to sub-humid in the summer, when the region receives most of its rainfall (more than 1000 millimetres /year).

Red Mangrove (Rhizophora mangle), Black Mangrove (Avicennia germinans), Buttonwood (Conocarpus erectus) and White Mangrove trees (Laguncularia racemosa) occur in this ecoregion. In the northern part of the ecoregion near Teacapán the Black Mangrove tree is dominant; however, in the southern part nearer Agua Brava, White Mangrove dominates. Herbaceous vegetation is rare, but other species that can be found in association with mangrove trees are: Ciruelillo (Phyllanthus elsiae), Guiana-chestnut (Pachira aquatica), and Pond Apple (Annona glabra).

There are are a number of reptiles present, which including a important population of Morelet's Crocodile (Crocodylus moreletii) and American Crocodile (Crocodylus acutus) in the freshwater marshes associated with tropical Cohune Palm (Attalea cohune) forest. Also present in this ecoregion are reptiles such as the Green Iguana (Iguana iguana), Mexican Beaded Lizard (Heloderma horridum) and Yellow Bellied Slider (Trachemys scripta). Four species of endangered sea turtle use the coast of Nayarit for nesting sites including Leatherback Turtle (Dermochelys coriacea), Olive Ridley Turtle (Lepidochelys olivacea), Hawksbill Turtle (Eretmochelys imbricata) and Green Turtle (Chelonia mydas).

A number of mammals are found in the ecoregion, including the Puma (Puma concolor), Ocelot (Leopardus pardalis), Jaguar (Panthera onca), Southern Pygmy Mouse (Baiomys musculus), Saussure's Shrew (Sorex saussurei). In addition many bat taxa are found in the ecoregion, including fruit eating species such as the Pygmy Fruit-eating Bat (Artibeus phaeotis); Aztec Fruit-eating Bat (Artibeus aztecus) and Toltec Fruit-eating Bat (Artibeus toltecus); there are also bat representatives from the genus myotis, such as the Long-legged Myotis (Myotis volans) and the Cinnamon Myotis (M. fortidens).

There are more than 252 species of birds, 40 percent of which are migratory, including 12 migratory ducks and approximately 36 endemic birds, including the Bumblebee Hummingbird, (Atthis heloisa) and the Mexican Woodnymph (Thalurania ridgwayi). Bojórquez considers the mangroves of Nayarit and Sinaloa among the areas of highest concentration of migratory birds. This ecoregion also serves as wintering habitat and as refuge from surrounding habitats during harsh climatic conditions for many species, especially birds; this sheltering effect further elevates the conservation value of this habitat.

Some of the many representative avifauna are Black-bellied Whistling Duck (Dendrocygna autumnalis), Great Blue Heron (Ardea herodias), Roseate Spoonbill (Ajaia ajaja), Snowy Egret (Egretta thula), sanderling (Calidris alba), American Kestrel (Falco sparverius), Blue-winged Teal (Anas discors), Mexican Jacana (Jacana spinosa), Elegant Trogan (Trogan elegans), Summer Tanager (Piranga rubra), White-tailed Hawk (Buteo albicaudatus), Merlin (Falco columbarius), Plain-capped Starthroat (Heliomaster constantii), Painted Bunting (Passerina ciris) and Wood Stork (Mycteria americana).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Chiefly freshwater situations: marshes, swamps, lagoons, ponds, flooded fields; depressions in marshes are important during drought; also occurs in brackish wetlands. Nests mostly in upper parts of cypress trees, mangroves, or dead hardwoods over water or on islands along streams or adjacent to shallow lakes. Feeds in freshwater marshes, swamps, lagoons, ponds, flooded pastures and flooded ditches, depressions in marshes (especially during drought).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood storks inhabit mainly tidal waters, marshes, swamps, streams and mangroves. They hunt for prey in shallow, muddy-bottomed banks or wetlands. Their nests are ideally constructed in trees surrounded by water to limit depredation of the eggs.

Habitat Regions: temperate ; tropical ; terrestrial

Aquatic Biomes: brackish water

Wetlands: marsh ; swamp

Other Habitat Features: estuarine

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12734 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 16.905 - 26.831
  Nitrate (umol/L): 0.049 - 1.794
  Salinity (PPS): 32.493 - 36.958
  Oxygen (ml/l): 4.577 - 5.624
  Phosphate (umol/l): 0.033 - 0.385
  Silicate (umol/l): 0.787 - 3.819

Graphical representation

Temperature range (°C): 16.905 - 26.831

Nitrate (umol/L): 0.049 - 1.794

Salinity (PPS): 32.493 - 36.958

Oxygen (ml/l): 4.577 - 5.624

Phosphate (umol/l): 0.033 - 0.385

Silicate (umol/l): 0.787 - 3.819
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Individuals from Mexican west coast are regular post-breeding migrants in California and Arizona; breeders from eastern Mexico appear in Texas and Louisiana (Matthews and Moseley 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly fishes (usually over 3.5 cm long), also miscellaneous other small animals, detected mainly by contact with touch-sensitive bill. Forages mainly in shallow water (about 15-50 cm deep) and flooded fields; attracted to areas with falling water level and hence concentrated food sources (Palmer 1962, Ogden et al. 1978). May feed cooperatively, wading together in shallow water (Hilty and Brown 1986). Conservative estimate is that one pair requires about 200 kg of fish in one breeding season to supply needs of adults and young (see Van Meter 1989). May travel long distances (sometimes over 100 km, usually not more than 56 km) between nesting and feeding areas when feeding young (Ogden et al. 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Adult wood storks eat small fish, frogs, mollusks, snails, insects, and aquatic invertebrates. It has been calculated that a 2.5 kilogram bird would eat more than half a kilogram of fish daily. Wood storks wade through shallow water feeling for movement and snap their bill shut when they touch a fish. Vision is not as important as touch, and the bill-snapping reflex of the stork is one of the fastest reflexes known in vertebrates, taking only about 25 thousandths of a second (Wolkomir and Wolkomir, 2001). It was also recently discovered that wood storks often leave the roost at night to catch prey or fish during nocturnal low tides. This allows them to feed without the competition of other large shorebirds such as great egrets.

Animal Foods: amphibians; fish; insects; mollusks

Primary Diet: carnivore (Piscivore )

  • Bryan, A., J. Snodgrass, J. Robinette, J. Daly, L. Brisbin. 2001b. Nocturnal activities of post-breeding Wood Storks. The Auk, 118 (2): 508-313.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Wood storks and other wading birds are an integral part of the marshland food chain along with other reptilian and mammalian predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The greatest threat to wood storks are raccoons (Procyon lotor) that climb to the nests to eat the chicks. Alligators (Alligator mississippiensis) may also pose a problem to unwary birds.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mycteria americana is prey of:
Procyon lotor
Alligator mississippiensis

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mycteria americana preys on:
Actinopterygii
Mollusca
Insecta
Amphibia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Occurs locally throughout range in North, Central, and South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: There are no known rangewide estimates for population numbers. The largest colonies are in the Usumacinta-Grijalva delta in southeastern Mexico; these colonies had 5000-10,000 pairs in the 1980s (Ogden et al. 1989). U.S. breeding pupulation was more or less stable at 7000-10,000 pairs in the early 1990s (Bancroft et al. 1992). Manry (1993) stated that only 4086 pairs were found in U.S. range in 1991. The U.S. Fish and Wildlife Service (1996; see Federal Register, 25 March 1996, also) stated that the U.S. population was 5500-6500 pairs over the last 12 years. The Florida population was estimated at: 9400 adults in 1983; 9500 adults in 1984; 5215 pairs in 1985; and 5130 pairs in 1986. "Statewide surveys in 1993, 1994, and 1995 produced estimates of 4402 (29 colonies), 3588 (26 colonies), and 5523 (33 colonies), respectively, in Florida... The numbers of storks nesting [were]...1661 pairs at 11 colonies in Georgia (M. Harris, pers. comm), and 806 pairs at 3 colonies in South Carolina (T. Murphy, pers. comm.) during 1993." (Ogden 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Notably gregarious. Roosts communally.

In Georgia, lower water level led to lower nesting success because of increased predation of young, presumably by alligators (Ruckdeschel and Shoop 1989). Rise in water level during nesting period may result in breeding colony abandonment (Ramo and Busto 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other migrating birds, wood storks may locate their nesting grounds by recognizing geographical landmarks and sensing magnetic fields.

Perception Channels: magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The eggs are incubated for one month and the newborn chicks hatch weighing only 57 grams. They are completely helpless except for the feathered umbrella that the parents provide with their wings to shield them from heat and rain (Klinkenberg 1998). There is sibling competition for food and under stressful conditions only the first-born and largest will survive. During times of heavy rains, nestlings often die or are deserted by their parents (Ramo and Busto 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: One captive animal lived for 27 years (Brouwer et al. 1992).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Nesting is tied to receding water levels and concentration of food sources, regardless of date. Clutch size is 2-5 (often 3). Incubation, by both sexes, lasts 28-32 days. Both parents tend young, which leave nest at 50-55 days (also reported as 9 weeks), return to nest for feeding and roosting until 75 days old. Nests in colonies of a few to thousands of pairs.

In Georgia, nesting was most successful if nesters did not experience (a) periods of cold weather and (b) raccoon predation that was associated with drying of the water under the colony (Coulter and Bryan 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood storks are monogamous.

Mating System: monogamous

Pairs often mate for life and return to the same nest each breeding season to raise their offspring. Breeding occurs from December to April. Nests are constructed out of sticks high atop cypress, mangrove, or other trees in marshy woodlands. Wood storks nest colonially with from 5 to 25 nests in a single tree.

Females lay 2 to 4 (usually 3) eggs per clutch. Incubation lasts 28 to 32 days and the young fledge after 55 to 60 days. Woodstorks do not begin to breed until they are 4 years old.

Breeding season: December to April

Range eggs per season: 2 to 4.

Range time to hatching: 28 to 32 days.

Range fledging age: 55 to 60 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average eggs per season: 3.

Both the male and female take part in nest building, incubation and the feeding of their semi-altricial young. Chicks are fed regurgitated fish and are dependent on their parents for 55 to 60 days after they hatch.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A field guide to the natural history of North American birds. New York: Simon & Schuster Inc.
  • Wolkomir, R., J. Wolkomir. 2001. In search of sanctuary: As its Florida habitat disappears, the American Wood Stork, our largest wading bird, is migrating northward to new nesting grounds. Smithsonian, February: 72.
  • The Georgia Museum of Natural History, , Georgia Department of Natural Resources. 2000. "Storks" (On-line). Accessed January 21, 2004 at http://museum.nhm.uga.edu/gawildlife/birds/Ciconiiformes/mamericana.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mycteria americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGAGCATGGGCCGGCATAGTCGGAACCGCTCTCAGCCTCCTCATCCGTGCAGAACTCGGCCAGCCAGGAACCCTCTTAGGAGACGACCAAATCTACAACGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGATTCGGAAACTGACTTGTCCCACTTATAATCGGCGCCCCAGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCACCATCCTTCTTGCTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACCGTATATCCTCCTCTAGCTGGCAACTTAGCCCATGCCGGAGCTTCAGTAGACCTAGCCATCTTCTCTCTCCACCTGGCAGGTGTCTCCTCAATCCTAGGAGCAATCAACTTTATCACAACTGCCATCAACATAAAACCTCCTGCCCTATCACAGTACCAAACTCCCCTATTCGTATGATCCGTCCTAATCACTGCCGTCCTTCTACTACTCTCCTTACCAGTCCTCGCTGCAGGTATTACCATGCTACTAACAGATCGAAACCTAAATACCACATTCTTTGATCCAGCTGGAGGAGGAGACCCTGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mycteria americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large range from the southeastern U.S. and Mexico to South America; populations are relatively stable and apparently secure on a global basis; U.S. population has been stable in recent years, but nesting and feeding areas have been negatively impacted by human alteration of the natural hydrological conditions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 02/28/1984
Lead Region:   Southeast Region (Region 4) 
Where Listed: U.S.A. (AL, FL, GA, SC)


Population detail:

Population location: U.S.A. (AL, FL, GA, SC)
Listing status: E

For most current information and documents related to the conservation status and management of Mycteria americana , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the 1930's an estimated 20,000 wood stork pairs were nesting in the United States. In 1978 only 2,500 pairs were recorded and wood storks were placed on the Endangered Species List in 1984. A recent survey of nesting pairs counted 5,500 pairs (Klinkenberg, 1998). If the species grows to 6,000 nesting pairs it may be reclassified to "threatened" instead of "endangered". The best way to help the species is to preserve wetlands, limit water management, and reduce heavy metal pollution such as mercury which can be lethal to the storks (Bryan et al., 2001a).

Historically the largest American population of wood storks has been in Florida's Big Cypress National Preserve and the Everglades, but because of a decline in wetland habitat and water management, colonies seem to be migrating northward (Brooks, 2001).

Wood storks are listed as endangered on the US Federal List and are protected under the US MBTA.

US Migratory Bird Act: protected

US Federal List: endangered

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Bryan, A., C. Jagoe, H. Brant, J. Gariboldi, G. Masson. 2001a. Mercury concentrations in post-fledging Wood Storks. Waterbirds, 24(2): 277-281.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: The U.S. Fish and Wildlife Service (1990) categorized the status of the southeastern U.S. population as "stable." Breeding populations from Mexico to South America appear to be stable (Matthews and Moseley 1990).

Global Long Term Trend: Unknown

Comments: Rangewide trends unknown. Breeding population in the southeastern U.S. declined from 16,000-20,000 pairs in the 1930s to 10,000 pairs in 1960 to 2500-5000 pairs in the late 1970s (Ogden and Patty 1981, Spendelow and Patton 1988); increased to 5000-6000 pairs in the mid-1980s. Since the 1960s, the southern Florida population has substantially declined whereas populations in northern Florida, Georgia, and South Carolina have substantially increased (USFWS 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: AB

Comments: A major problem is low productivity, associated with inadequate food, caused in part by disruption and drainage of wetlands (see Van Meter 1989). The U.S. population (especially Florida) is threatened by human manipulation of water regimes, affecting both nesting sites and feeding areas. The long reproductive lifespan of the wood stork allows it to tolerate reproductive failure in some years, but artificially modified hydrological regimes, exacerbated by naturally occurring events (e.g., prolonged drought or unseasonal heavy rainfall), have caused nesting failures to become chronic in some of the important south Florida rookeries. Additional loss of habitat stems from logging and development. Nest predation by raccoons has been a problem in some areas. Human disturbance causes adults to leave their nests, exposing the eggs/young to predators (Van Meter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: The earliest possible data for complete recovery of the U.S. population is 2005, but a more realistic date might be 2015-2020 (USFWS 1996).

Management Requirements: See recovery plan (USFWS 1996). Control of water level is critical to the management of this species. See Coulter (1990) and Matthews and Moseley (1990) for information on the successful creation of artificial foraging habitat at Kathwood Lake, Silverbluff Plantation Sanctuary, South Carolina.

Biological Research Needs: Continue research on the role of water management regimes in relation to productivity of rookeries. Study rookeries in north and central FL and the degree of interchange with south FL colonies. Monitor recruitment and factors that affect it. Evaluate dredge and fill activities for affects on wood stork nesting and feeding areas. Evaluate prey response to water management regimes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Many occurences are in national wildlife refuges, national parks, National Audubon sanctuaries, and state-owned lands within the U.S. Unknown oustide U.S.; however, occurrences within protected areas can mean very little. Dramatic declines in the "protected" south Florida occurrences are thought to be the result of reduced nesting success, associated with an inadequate food supply caused in part by disruption and drainage of wetlands (see Threat Comments). See state ranking forms for specific protected sites.

Needs: Do whatever necessary to restore more natural hydrological conditions within the range of the wood stork. Provide adequate feeding habitat for existing rookeries. Restore and enhance habitat. Restrict the use of pesticides in stork habitat. Protect any nesting areas that are not yet protected. Increase public awareness. See recovery plan (USFWS 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of wood storks on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

We do not have information on economic importance for this species at this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wood stork

The wood stork (Mycteria americana) is a large American wading bird in the stork family Ciconiidae. It was formerly called the "wood ibis", though it is not really an ibis. As of June 26, 2014 it is classified as a threatened species by the U.S. Fish & Wildlife Service.[2][3]

Appearance[edit]

The wood stork's head much resembles that of an ibis
Wood stork in flight

The adult is a large bird which stands 83–115 cm (33–45 in) tall and spans 140–180 cm (58–71 in) across the wings. Males typically weigh 2.5–3.3 kg (5.5-7.3 lbs); females weigh 2.0–2.8 kg (4.4-6.2 lbs),[4] although large males can weigh up to 4.5 kg (10 lbs).[5] It appears all white on the ground, with blackish-gray legs and pink feet. In flight, the trailing edge of the wings is black. The head is dark brown with a bald, black face, and the thick downcurved bill is dusky yellow. Juvenile birds are a duller version of the adult, generally browner on the neck, and with a paler bill. The bare head and the long bill, which can measure up to 25.5 cm (10.0 in) in length, render the wood stork distinctive from other large waders in its range.[6] The standard scientific measurements of the wood stork are as follows: the wing is 42–49 cm (17–19 in), the culmen is 19–25 cm (7.5–9.8 in) and the tarsus is 17.5–21.5 cm (6.9–8.5 in).[7]

Habitat and breeding[edit]

This is a subtropical and tropical species which breeds in much of South America, Central America and the Caribbean. The wood stork is the only stork that presently breeds in North America. In the United States there is a small breeding population in Florida, Georgia, and South Carolina, along with a recently discovered rookery in southeastern North Carolina. After a successful three-decade conservation effort resulting in an increased population in the southeastern United States, the wood stork was removed from the endangered species list and upgraded to threatened on June 26, 2014.[3] Similarly, in the state of Santa Catarina, Brazil, its decline seems to have been reversed: after an absence between the late 1960s and the mid-1990s, the species is now again regularly encountered there, in particular in the Tubarão River region.[8] It is likely that the Paraná River region's wetlands served as a stronghold of the species, from where it is now re-colonizing some of its former haunts.[9] Globally, it is considered a species of Least Concern by the IUCN due to its large range.[10]

The wood stork is a broad-winged soaring bird that flies with its neck outstretched and legs extended. It forages usually where lowering water levels concentrate fish in open wetlands; it also frequents paddy fields. Walking slowly and steadily in shallow water up to its belly, it seeks prey, which, like that of most of its relatives, consists of fish, frogs and large insects. It catches fish by holding its bill open in the water until a fish is detected.[11]

In the United States, the wood stork favors cypress trees in marshes, swamps, or (less often) among mangroves and nearby habitat.[12]

A nesting colony in Georgia, US

A resident breeder in lowland wetlands with trees, the wood stork builds a large stick nest in a forest tree. They nest colonially with up to twenty-five nests in one tree.[12] Breeding once a year, a female typically lays three to five eggs in the clutch. The eggs are incubated 27–32 days by both sexes. Wood storks' reproductive cycle is triggered when waterholes dry up sufficiently to concentrate fish in sufficient numbers for efficient feeding of the chicks. Each chick weighs approximately 2 ounces (60 grams), is unable to fly and is helpless. Competition for food is fierce, and if food is scarce, only the older chicks will survive. Week-old chicks are fed about 15 times per day, and grow rapidly. By 14 days, each will weigh 10 times its hatching weight. At 28 days, each is 25 times heavier. During the breeding season, wood storks need over 400 pounds (180 kg) of fish to feed themselves and their offspring. When the weather is very warm, parents also collect water and bring it to the nest to drool on and into the mouths of the chicks. By the time the young are four weeks old, both parents leave the nest to search for food, and this continues until the chicks fledge or leave the nest. Young may continue to return to the colony for another 10 to 15 days to roost or to try to get food from their parents. A colony is considered successful if its parents average at least 1.5 fledged young per nest.[13]

Each adult will defend its nest against various predators. corvids, vultures, grackles and striped skunks will attempt to pick off eggs.[13] Raccoons are the leading predator of nests, and can cause almost complete colony nesting failure when water dries under nests in drought years since they can easily access the nest using dry ground under the tree.[14] Adults have few natural predators, but unwary ones have been picked off by American alligators.[15]

Evolution[edit]

Wood stork alighting, Hontoon Dead River, in Florida

This species seems to have evolved in tropical regions; its North American presence probably postdates the last ice age. A fossil fragment from the Touro Passo Formation found at Arroio Touro Passo (Rio Grande do Sul, Brazil) might be of the living species; it is at most from the Late Pleistocene age, a few 10,000s of years ago.[16] North American fossils from that time are of an extinct larger relative, M. wetmorei. This was probably a sister species; both occurred sympatrically on Cuba at the end of the Pleistocene.[17]

References[edit]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Mycteria americana". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ https://ecos.fws.gov/speciesProfile/profile/speciesProfile.action?spcode=B06O
  3. ^ a b "Wood stork off endangered list after recovery in U.S. Southeast". Reuters. Retrieved 1 July 2014. 
  4. ^ "Environmental Pollution - Potential risk to wood storks (Mycteria americana) from mercury in Carolina Bay fish". ScienceDirect.com. 2002-02-05. Retrieved 2013-01-30. 
  5. ^ "Wood Stork (Mycteria americana)". Pelotes.jea.com. 1997-01-02. Retrieved 2013-01-30. 
  6. ^ "Everglades National Park (Page 2)". Shannontech.com. Retrieved 2013-01-30. 
  7. ^ Hancock, Kushlan & Kahl (1992). Storks, Ibises, and Spoonbills of the World. Academic Press. ISBN 978-0-12-322730-0. 
  8. ^ Amorim & Piacentini (2006)
  9. ^ Bencke (2007)
  10. ^ http://www.iucnredlist.org/details/106003824/0
  11. ^ Sibley (2003): p.58
  12. ^ a b Ehrlich, Dobkin & Wheye (1992)
  13. ^ a b [1][dead link]
  14. ^ "Wood Stork — Behavior — Birds of North America Online". Bna.birds.cornell.edu. Retrieved 2013-01-30. 
  15. ^ Carroll, Sean (2004-01-21). "ADW: Mycteria americana: INFORMATION". Animaldiversity.ummz.umich.edu. Retrieved 2013-01-30. 
  16. ^ Schmaltz Hsou (2007)
  17. ^ Suárez & Olson (2003)

Literature[edit]

  • Amorim, James Faraco & Piacentini, Vítor de Queiroz (2006): Novos registros de aves raras em Santa Catarina, Sul do Brasil, incluindo os primeiros registros documentados de algumas espécies para o Estado [New records of rare birds, and fi rst reports of some species, in the state of Santa Catarina, southern Brazil]. Revista Brasileira de Ornitologia 14(2): 145-149 [Portuguese with English abstract]. PDF fulltext Electronic supplement
  • Bencke, Glayson Ariel (2007): Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais ["The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects"]. Talk held on 2007-JUN-22 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract in Portuguese
  • Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl (1992). Birds in Jeopardy. Stanford, CA: Stanford University Press. p. 18. ISBN 0-8047-1967-5. 
  • Schmaltz Hsou, Annie (2007): O estado atual do registro fóssil de répteis e aves no Pleistoceno do Estado do Rio Grande do Sul, Brasil ["The current state of the fossil record of Pleistocene reptiles and birds of Rio Grande do Sul"]. Talk held on 2007-JUN-20 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract in Portuguese
  • Sibley, David Allen (2003): The Sibley Field Guide to Birds of Eastern North America. Alfred A. Knopf, New York. ISBN 0-679-45120-X
  • Suarez, William & Olson, Storrs L. (2003): New Records of Storks (Ciconiidae) from Quaternary Asphalt Deposits in Cuba. Condor 105(1): 150-154. DOI:10.1650/0010-5422(2003)105[150:NROSCF]2.0.CO;2 PDF fulltext

Further reading[edit]

  • Alsop, Fred J. III (2002): Birds of Texas. DK Publishing, Inc., New York City. ISBN 0-7894-8388-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Genetic analyses yielded no evidence of discrete subpopulations in Florida (Stangel et al. 1990). Indeed, Van Den Bussche et al. (1999) found low levels of genetic variablity among Georgia and Florida Wood Storks and recommended that "all colonies of Wood Storks in the southeastern United States be managed...as a single interbreeding population." Similar surveys of South and Central American populations are not available.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!