Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Range

Lowlands of s Asia; winters to Greater Sundas.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ardeola bacchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATATCTAATCTTTGGAGCATGAGCTGGTATAGTTGGAACTGCCCTAAGCCTACTTATTCGAGCTGAACTTGGCCAACCCGGAACACTGCTAGGAGACGACCAAATCTACAATGTAGTCGTCACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATCGGAGGATTCGGAAACTGACTAGTCCCTCTCATAATTGGCGCCCCAGATATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTTCTACCACCATCATTCATACTCCTACTAGCCTCATCCACAGTTGAAGCAGGGGCAGGTACAGGCTGAACCGTATATCCACCACTAGCTGGCAATCTAGCCCACGCCGGAGCCTCAGTCGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCTATCCTAGGAGCAATCAACTTCATCACAACATCCATCAACATAAAACCCCCAGCCCTATCACAATACCAAACTCCCCTGTTCGTATGATCCGTCCTAATCACCGCTGTCCTACTCCTACTCTCACTCCCAGTCCTCGCCGCAGGCATTACAATACTACTAACCGATCGAAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCAATCCTTTACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTAATCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ardeola bacchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number c.25,000-1,000,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China and < c.100 breeding pairs and c.50-1,000 individuals on migration in Korea (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinese Pond Heron

Adult take-off in winter plumage

The Chinese Pond Heron (Ardeola bacchus) is an East Asian freshwater bird of the heron family (Ardeidae).

It is one of six species of birds known as "pond herons" (genus Ardeola). It is parapatric (or nearly so) with the Indian Pond Heron (A. grayii) to the west and the Javan Pond Heron (A. speciosa) to the south, and these three are presumed to form a superspecies. As a group they are variously affiliated with the Squacco Heron (A. ralloides) or the Madagascar Pond Heron (A. idae). As of mid-2011 there are no published molecular analyses of pond heron interrelationships[2] and osteological data is likewise not analyzed for all relevant comparison taxa.[3]

Description and ecology[edit]

The Chinese Pond Heron is typically 47 cm (19 in) long with white wings, a yellow bill with a black tip, yellow eyes and legs. Its overall colour is red, blue and white during breeding season, and greyish-brown and flecked with white at other times.[4]

It is found in shallow fresh and salt-water wetlands and ponds in China and adjacent temperate and subtropical East Asia. Essentially a lowland bird, its range is delimited by the subarctic regions in the north, and by the mountain ranges in the west and south.[4]

The species is prone to some vagrancy. One individual in breeding plumage was seen by the river at Bonzon near Gangaw – just inside the Chin State of Burma –, west of the species' usual range, on April 8, 1995. A stray bird stopping over on Saint Paul Island, Alaska on August 4–9, 1997 was the first recorded occurrence of this species in the USA.[5][6]

Its food consists of insects, fish, and crustaceans. The Chinese Pond Heron often nests in mixed-species heronries. It lays a clutch of 3–6 blue-green eggs.[4]

It is fairly common and not considered a threatened species by the IUCN.[7]

References[edit]

  1. ^ BirdLife International (2012). "Ardeola bacchus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Though a number of studies have used DNA of A. bacchus, there is almost no comparison data from other Ardeola: GenBank: Ardeola bacchus, Ardeola. Retrieved 2011-JUL-14.
  3. ^ McCracken, Kevin G. & Sheldon, Frederick H. (1998). "Molecular and osteological heron phylogenies: sources of incongruence". Auk 115: 127–141. doi:10.2307/4089118. 
  4. ^ a b c Robson, Craig R. (2002): A guide to the birds of Southeast Asia: Thailand, Peninsular Malaysia, Singapore, Myanmar, Laos, Vietnam, Cambodia. New Holland, London. ISBN 1-85368-313-2
  5. ^ Robson, Craig R.; Buck, H.; Farrow, D.S.; Fisher, T. & King, B.F. (1998). "A birdwatching visit to the Chin Hills, West Burma (Myanmar), with notes from nearby areas". Forktail 13: 109–120. 
  6. ^ American Ornithologists' Union (2000). "Forty-second supplement to the American Ornithologists' Union Check-list of North American Birds". The Auk 117 (3): 847. doi:10.1642/0004-8038(2000)117[0847:FSSTTA]2.0.CO;2. 
  7. ^ BirdLife International (2012). Ardeola bacchus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!