Articles on this page are available in 2 other languages: Chinese (Simplified) (11), Dutch (1) (learn more)

Overview

Brief Summary

Description

The familiar mallard is the most numerous duck in Britain (3), and is the ancestor of the domestic duck (2). Both male and female mallards are easily identified by the presence of a dark blue band on the wing known as a 'speculum', which is bordered above and below with white (2). Males and females are distinct; males have a metallic bottle-green head, a crisp white neck-collar and a rich purplish-brown breast. The upperparts are grey, the flanks are somewhat paler, and the central feathers of the black tail are curled smartly upwards (2). In contrast, females are brown, with streaks of darker brown and buff (4). Juveniles are very similar to females, but lack the speculum (2). It is the female mallard who produces the well-known loud 'quack-quack' call; males produce a softer 'rhaeb', particularly when alert, and a 'piu' whistle during courtship (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

The mallard feeds mainly on vegetable matter, which is usually obtained by upending (tipping head first into the water, so that the tail remains visible above the surface) (3). During autumn and winter they may feed in fields, some distance from water (3). Breeding may take place throughout the year, but usually occurs after March (4). In overcrowded water bodies, such as parks, breeding males may attack females in order to mate; this may lead to the death of the female in some cases. This behaviour is rare in truly wild mallards, however (6). The hollow nest, lined with grasses, feathers and leaves (5), is typically made close to water and is often concealed by vegetation (4). Between 10-12 pale green, blue or creamy white eggs are produced (although as many as 16 per clutch have been known), and are incubated for 28-29 days by the female (4). The downy chicks are led to the water by the female shortly after hatching and are cared for by the female for up to 8 weeks (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Anas platyrhynchos

The Mallard is the most recognizable species of waterfowl, often being the only species of duck present in ponds and small streams near cities and towns. This large duck is about 20 to 24 inches long with an oval-shaped body and short tail. Males are splotchy brown and tan with a green head and yellow bill, while females are speckled brown and tan with a dull brown bill. Both sexes have orange legs and a blue diamond on the wings. The Mallard is common across North America and Eurasia. This species may be found from the Arctic Circle south to the tropics. While some Mallard populations migrate between separate breeding and wintering grounds, many populations living in human-altered environments are non-migratory. Mallards are usually found in and around rivers, streams, lakes, or ponds. They eat a variety of foods, including insects, snails, and grains. Mallards are often present in large numbers where ducks are fed by humans. Mallards are often found floating on the water’s surface, occasionally dabbling (submerging their head and chest while their legs and tail stick out of the water) to find food. These ducks are also capable of taking off directly from the water. They may also be found on land, where they may be observed walking, or in the air, where they may be observed making swift and direct flights between bodies of water. They are most active during the day.

Threat Status: Least Concern

  • Anas platyrhynchos. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Drilling, Nancy, Rodger Titman and Frank Mckinney. 2002. Mallard (Anas platyrhynchos), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/658
  • Mallard (Anas platyrhynchos). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Mallard. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

You find the mallard ducks almost anywhere where there is calm shallow water. So it's not surprising to find them in the middle of cities. They feed mostly on plants and seeds but also animal matter in the water. In the cities, they eat mostly bread. The Netherlands has lots of mallard ducks. Some years, 400,000 mallards were estimated.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 50-65 cm, envergure 81-98 cm, poids 750-1 450 g.

La quasi-totalité des milieux aquatiques terrestres sont colonisés par l’espèce, avec une préférence pour les eaux peu profondes.

Le Canard colvert est omnivore et opportuniste ; il broute feuilles et pousses à la façon des oies, filtre des graines et des invertébrés à la surface de l’eau, capture des insectes, etc.

L’espèce est très grégaire durant la majeure partie de l’année. Des groupes pouvant atteindre quelques milliers d’oiseaux sont signalés en hiver sur les grands étangs les plus favorables. À partir de février, les couples s’isolent pour prospecter des sites de nid parfois éloignés des ressources alimentaires. Des parades collectives ont lieu dès l’automne précédent, avec des pics d’activité en octobre-novembre puis février-mars. Il s’agit pour l’essentiel de démonstrations natatoires accompagnées de mouvements de la tête et/ou de la queue. Les mâles manœuvrent sans cesse pour atteindre la meilleure position auprès de la femelle. Les oiseaux en parade décollent fréquemment pour se reposer peu après. Les couples sont formés uniquement jusqu’à l’incubation. Les rares cas où le mâle reste jusqu’à l’éclosion sont signalés lorsque la ponte a lieu très tôt en saison.

La couvaison se fait habituellement au sol, dès février ou mars. Des trous d’arbres ou des constructions humaines sont parfois utilisés. Bien que l’espèce ne soit pas coloniale, les nids peuvent être rapprochés. Ils sont une simple dépression couverte d’herbe et de feuilles, tapissée par du duvet. Les œufs sont au nombre de 9 à 13 (max. 18) et sont couvés 27 à 28 jours. Les jeunes sont volants à l’âge de 2 mois.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description of Anas platyrhynchos

Het mannetje heeft een glanzend groene kop en het vrouwtje is donkerbruin.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mallards can be found almost anywhere in the world. They dominate the Northern Hemisphere, and can be found easly in Oceana, Asia, Africa, South America and many islands

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Alaska, Mackenzie Delta, southern Keewatin, and Maine south to southern California, Mexico, Oklahoma, and Virginia. Has expanded range in eastern North America (especially in the north) in recent decades (see Heusmann 1991 for a detailed account of status in the Atlantic Flyway). WINTERS: southern Alaska and southern Canada to southern U.S., Mexico, Cuba, occasionally Hawaii (AOU 1983). Half or more of the Mississippi Flyway's 3.2 million mallards winter in the lower Mississippi Valley, from Cape Girardeau, Missouri, to the Gulf of Mexico. Also occurs in the Palearctic. Many semiferal populations exist. Availablity of grain allows wintering north of pre-settlement range; now rare in Central America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

North America; range extends from Labrador to the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; range extends from Labrador to the Gulf of Mexico
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mallards can be found in many regions throughout the Northern Hemisphere, native to the Nearctic, Palearctic and Oriental regions. They are the most common duck species of the Northern Hemisphere and are found in Asia, North America, and many islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The mallard has a circumpolar distribution.  It occurs throughout North
America from northern Canada and Alaska south into Mexico and from coast
to coast [12].  It is usually a year-round resident in the central
United States and along the West Coast from Baja to southern Alaska.
The mallard's breeding range is usually in the more northerly parts of
its distribution; it winters in the southern United States and Mexico
[15].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread and common throughout Britain, the mallard is absent only from mountainous or very dry areas (3). The native population is supplemented in winter by immigrants from Iceland and Scandinavia, escaping harsh winter weather (3). Outside of Britain, the mallard is found in subtropical and temperate areas throughout the northern hemisphere (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The mallard is undoubtably the most recognized waterfowl in the world. The familiar duck morphology is complemented with a iridesent blue speculum on the wings in both sexes. On the male, the notable characteristics are the green iridesent plumage on the head and neck, and curled black feathers on the tail. The female's plumage is drab brown.

Average mass: 1082 g.

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 1048.1 g.

Average basal metabolic rate: 4.068 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mallards are undoubtedly the most recognized waterfowl in the world. They have a typical duck body with an iridescent blue patch on the wings in both sexes. On males the notable characteristics are the green iridescent feathers on the head and neck and curled black feathers on the tail. Females are uniformly a speckled brown color. The male duck's bill is yellow, while the female's bill is orange with black markings. Both males and females have orange legs, webbed feet, and dark colored eyes.

Average length: 48.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 1048.1 g.

Average basal metabolic rate: 4.068 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 58 cm

Weight: 1082 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour In temperate regions breeding populations of this species are sedentary or dispersive, often making local movements during severe weather (Scott and Rose 1996). Other populations are fully migratory (Kear 2005b) with females and juveniles leaving the breeding grounds in the western Palearctic from Septemberand returning as early as February (Kear 2005b). The species breeds between March and June (Madge and Burn 1988) in single pairs or loose groups (del Hoyo et al. 1992) although the exact timing varies with latitude (Madge and Burn 1988). While the females are incubating (Johnsgard 1978) (from mid-May) (Flint et al. 1984, Scott and Rose 1996) the males gather (Madge and Burn 1988) in small flocks and migrate to moulting areas (Flint et al. 1984) where they undergo a flightless moulting period lasting for c.4 weeks (Scott and Rose 1996) (females moult near the breeding grounds) (Flint et al. 1984). Outside of the breeding season the species can be found in small to very large flocks (Madge and Burn 1988) numbering up to several hundreds or even thousands of individuals (Snow and Perrins 1998) especially when moulting (Scott and Rose 1996), on migration (Snow and Perrins 1998) and during the winter (Kear 2005b). The species may also roost both nocturnally and diurnally in communal groups when not breeding (Brown et al. 1982). Habitat The species occurs in almost every wetland type (del Hoyo et al. 1992) although it generally avoids fast-flowing, oligotrophic (del Hoyo et al. 1992, Scott and Rose 1996, Snow and Perrins 1998), deep, exposed, rough, rockbound waters and hard unvegetated areas such as rocky ground, sand dunes and artificial surfacing (Snow and Perrins 1998). It requires water less than 1 m deep for foraging (Snow and Perrins 1998) and shows a preference for freshwater habitats (Madge and Burn 1988) although it may frequent shallow brackish waters as long as they provide the cover (del Hoyo et al. 1992, Scott and Rose 1996) of submerged, floating, emergent or riparian vegetation, dense reedbeds or overhanging branches (Snow and Perrins 1998). Habitats commonly frequented include flooded swampy woodlands, seasonal floodlands (Snow and Perrins 1998), wet grassy swamps and meadows, oxbow lakes (Flint et al. 1984), open waters with mudflats, banks or spits, irrigation networks, reservoirs, ornamental waters (del Hoyo et al. 1992, Scott and Rose 1996, Snow and Perrins 1998), canals and sewage farms (Snow and Perrins 1998). During the winter the species may also be found in saline habitats along the coast (Madge and Burn 1988) where water is shallow, fairly sheltered and within site of land (Snow and Perrins 1998) (e.g. brackish lagoons [Snow and Perrins 1998], brackish estuaries [del Hoyo et al. 1992, Snow and Perrins 1998] and bays [del Hoyo et al. 1992]). Diet The species is omnivorous and opportunistic (del Hoyo et al. 1992, Snow and Perrins 1998), feeding by dabbling in water and by grazing on the land (Snow and Perrins 1998). Its diet consists of seeds and the vegetative parts of aquatic and terrestrial plants (e.g. crops) (del Hoyo et al. 1992), as well as terrestrial and aquatic invertebrates (especially in the spring and summer) such as insects, molluscs, crustaceans, worms and occasionally amphibians and fish (del Hoyo et al. 1992). Breeding site The nest is a shallow depression (Snow and Perrins 1998) or bowl of vegetation that can be situated in many different locations such as within vegetation on the ground, in natural tree cavities (del Hoyo et al. 1992) up to 10 m high (Africa) (Brown et al. 1982), under fallen dead wood, on tree stumps (Flint et al. 1984), under bushes (Brown et al. 1982) and even in abandoned nests of other species (e.g. herons or crows) (Flint et al. 1984). Nests are generally placed close to water (Kear 2005b) although occasionally they may be some distance away (Madge and Burn 1988). Management information "Extensive" grazing of wetland grasslands (c.0.5 cows per hectare) was found to attract a higher abundance of the species in Hungary (Baldi et al. 2005). Studies in Danish coastal wetlands found that the spatial restriction of shore-based shooting was more successful at maintaining waterfowl population sizes than was the temporal restriction of shooting, and therefore that wildfowl reserves should incorporate shooting-free refuges that include adjacent marshland in order to ensure high waterfowl species diversity (Bregnballe et al. 2004). The cyclical removal of adult fish from an artificial waterbody (gravel pit) in the UK resulted in an increase in invertebrate food availability and an increase in the growth of submerged aquatic macrophytes, which in turn led to an increased use of the habitat for brood rearing by the species (Giles 1994). The removed fish (dead or alive) were sold to generate funds (Giles 1994). The species will also nest in artificial nest boxes (Brown et al. 1982, del Hoyo et al. 1992).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 12.736
  Nitrate (umol/L): 1.249 - 8.636
  Salinity (PPS): 6.607 - 35.269
  Oxygen (ml/l): 6.149 - 8.081
  Phosphate (umol/l): 0.240 - 0.574
  Silicate (umol/l): 1.801 - 10.453

Graphical representation

Temperature range (°C): 8.272 - 12.736

Nitrate (umol/L): 1.249 - 8.636

Salinity (PPS): 6.607 - 35.269

Oxygen (ml/l): 6.149 - 8.081

Phosphate (umol/l): 0.240 - 0.574

Silicate (umol/l): 1.801 - 10.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most often, they prefer wetlands, where highly productive waters produce large amounts of floating, emergent and submerged vegetation Wetlands also produce a great deal of aquatic invertebrates on which mallards feed.

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Primarily shallow waters such as ponds, lakes, marshes, and flooded fields; in migration and in winter mostly in fresh water and cultivated fields, less commonly in brackish situations (AOU 1983). See Nichols et al. (1983). Adapted to dynamic wetland conditions that provide a variety of wetland types in relatively close proximity (Allen 1986, which see for details on winter habitat in Lower Mississippi Valley). In Maryland, breeding pairs and broods used stormwater-control basins, especially permanent ponds with gently sloping sides (Adams et al. 1985). In California and Oregon, molting areas were dominated by bulrush and cattail and were traditionally flooded in summer and often associated with lakes or rivers (Yarris et al. 1994). Usually nests on ground in concealing vegetation, sometimes in trees or in atypical situations. Nest usually within 0.8 km of water (Palmer 1976). Commonly uses man-made ponds. Successful nesters are more likely to return to the same nesting site in successive years than are unsuccessful nesters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mallards live in a variety of habitats. Most often they live along waterways with plentiful vegetation, such as marshes, ponds, small lakes, coastal bays, and estuaries. They graze in stubble fields and nest in grasslands away from the water's edge.

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: tree

Mallards prefer lowland habitat such as marshes, ponds, small lakes,
sheltered coastal bays and estuaries, shallow pools, tidal flats, and
protected coves [12,15].  They also graze in stubble fields and inhabit
low-elevation mountain lakes and streams.  Mallards primarily nest in
grasslands away from the water's edge but have been known to use old
bird nests, tree cavities, rights-of-way, and meadows with woody
vegetation [2].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Mallards mostly inhabit wetland plant communities composed of marsh
species such as cattail (Typha spp.), bulrush (Scirpus spp.), smartweed
(Polygonum spp.), sedge (Carex spp.), and (Phragmites spp.).  They also
inhabit brome (Bromus spp.)-wheatgrass (Agropyron spp.) communities
[12].  Mallards may use upland meadows for nesting; plants in these
meadows may include aster (Aster spp.), sowthistle (Sonchus arvensis),
and white-top grass (Scholochloa festucacea) [17].

REFERENCES :
NO-ENTRY

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

    16  Aspen
    17  Pin cherry
    18  Paper birch
    63  Cottonwood
    65  Pin oak - sweetgum
    88  Willow oak - water oak - diamondleaf oak
    89  Live oak
    91  Swamp chestnut oak - cherrybark oak
    92  Sweetgum - willow oak
    93  Sugarberry - American elm - green ash
    94  Sycamore - sweetgum - American elm
    95  Black willow
    96  Overcup oak - water hickory
   101  Baldcypress
   102  Baldcypress - tupelo
   103  Water tupelo - swamp tupelo
   104  Sweetbay - swamp tupelo - redbay
   217  Aspen
   235  Cottonwood - willow

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K047  Fescue - oatgrass
   K048  California steppe
   K050  Fescue - wheatgrass
   K051  Wheatgrass - bluegrass
   K053  Grama - galleta steppe
   K054  Grama - tobosa prairie
   K056  Wheatgrass - needlegrass shrubsteppe
   K063  Foothills prairie
   K064  Grama - needlegrass - wheatgrass
   K065  Grama - buffalograss
   K066  Wheatgrass - needlegrass
   K067  Wheatgrass - bluestem - needlegrass
   K068  Wheatgrass - grama - buffalograss
   K069  Bluestem - grama prairie
   K070  Sandsage - bluestem prairie
   K071  Shinnery
   K072  Sea oats prairie
   K073  Northern cordgrass prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K076  Blackland prairie
   K077  Bluestem - sacahuista prairie
   K078  Southern cordgrass prairie
   K079  Palmetto prairie
   K080  Marl - everglades
   K081  Oak savanna
   K082  Mosaic of K074 and K100
   K083  Cedar glades
   K084  Cross Timbers
   K085  Mesquite - buffalograss
   K086  Juniper - oak savanna
   K087  Mesquite - oak savanna
   K088  Fayette prairie
   K089  Black Belt
   K090  Live oak - sea oats
   K091  Cypress savanna
   K092  Everglades
   K094  Conifer bog
   K100  Oak - hickory forest
   K104  Appalachian oak forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES28 Western hardwoods
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

Mallards are very adaptable and appear to have only a few specific
requirements.  They need enough dry ground away from the water's edge
for nesting yet plenty of pond area for feeding [2,17].  Also, mallards
need the previous year's dead vegetation for nests [15].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 12.736
  Nitrate (umol/L): 1.249 - 8.636
  Salinity (PPS): 6.607 - 35.269
  Oxygen (ml/l): 6.149 - 8.081
  Phosphate (umol/l): 0.240 - 0.574
  Silicate (umol/l): 1.801 - 10.453

Graphical representation

Temperature range (°C): 8.272 - 12.736

Nitrate (umol/L): 1.249 - 8.636

Salinity (PPS): 6.607 - 35.269

Oxygen (ml/l): 6.149 - 8.081

Phosphate (umol/l): 0.240 - 0.574

Silicate (umol/l): 1.801 - 10.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in almost every type of lowland wetland, including village ponds, lakes, and flood water (4). They tolerate the presence of humans, and are therefore found in parks, and rivers and streams in towns (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Extent of southward migration may depend on winter temperature, water conditions, and population size. Arrives in northern breeding areas in late March and early April, in far north from mid-May into June. Departs from northern breeding areas late September into November (may depart from far north by mid-August) (Palmer 1976).

Makes postbreeding migration to molting area; females that nested in Suisun Marsh, California, began leaving in late May, 50% had departed by mid-June, and nearly all had departed by mid-July; migrated mainly northward to areas in California and south-central Oregon, 12-536 km from nesting sites; exhibited fidelity to molting area (Yarris et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Mallards consume a wide variety of foods, including vegetation, insects, worms, gastropods and arthropods, although they are not restricted to these. They also take advantage of human food sources, such as gleaning grain from crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats seeds, rootlets, and tubers of aquatic plants, seeds of swamp and river bottom trees, acorns, cultivated grains, insects, mollusks, amphibians, small fishes, fish eggs; adults eat mostly vegetable material, young initially eat mainly invertebrates. Foraging opportunities optimal where water depth less than 40 cm. See Allen (1986) for further details on diet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mallards consume a wide variety of foods, including aquatic vegetation, Insecta, and Oligochaeta, although they are not restricted to these. They also take advantage of human food sources, such as collecting grain from crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: hardwood

Mallards eat a variety of aquatic plants and invertebrates as well as
crops.  Foods include duckweeds (Lemna spp, Spirodela spp.), smartweeds
(Polygonum spp.), grasses (Poaceae), sedges (Carex spp.), pondweeds
(Potamogeton spp.), rice-cutgrass (Leersia oryzoides), arrowhead
(Sagittaria latifolia), wild millet (Echinochloa spp.), crustaceans,
worms, snails, spiders, corn, and soybeans [7,12,15].  Acorns in
bottomland hardwood types are also important food [14].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predation

Mallards are preyed upon by a wide variety of predators, including humans, Procyon lotor, Felis silvestris, Canis lupus familiaris, Mephitis mephitis, Mustela, Accipitridae, Corvus brachyrhynchos, Corvus corax, magpies, Testudines, Squamata, and Actinopterygii. They are watchful and escape to the water when startled, including the young ducklings.

Known Predators:

  • humans
  • Felis silvestris
  • Canis lupus familiaris
  • Procyon lotor
  • Didelphis virginiana
  • Mephitis mephitis
  • Mustela
  • martens
  • Accipitridae
  • Accipitridae
  • Corvus brachyrhynchos
  • Corvus corax
  • magpies
  • Testudines
  • Squamata
  • Actinopterygii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Predators of mallard include humans, cats, dogs, raccoon, opossum;
skunks, weasels, martens; eagles, hawks; crows, ravens, magpies; and
turtles, snakes, and fish [13,15].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Cotylurus cornutus endoparasitises small intestine of Anas platyrhynchos

Animal / parasite / endoparasite
fluke of Dendritobilharzia pulverulenta endoparasitises renal vein of Anas platyrhynchos

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density (2.3-9.5 birds per sq km) fluctuates with pond abundance in prairie pothole region (Krapu et al. 1983). In Manitoba, nesting home range size averaged 283 hectares (Dzubin 1955). Average breeding home ranges of radio-tagged birds in Minnesota were 210 hectares (12 females) and 240 hectares (12 males); range 66 hectares to 760 hectares (a pair, Gilmer et al. 1975).

In winter, may fly up to 48 to 64 kilometers to forage from roost sites. Does not defend rigid territories, but area immediately surrounding the female usually defended by the male. Broods susceptible to mink predation. Resident birds have higher reproduction whereas migrants have higher survival (Hestbeck et al. 1992).

May be negatively impacting black duck populations in eastern North America as a result of competitive interactions (Merendino and Ankney 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the term: cover

Burning in late May in Manitoba's pothole region showed a drastic
decline in mallard nests initiated immediately following burning.  Nest
initiations rose again in late June [5].  Mallards are early nesters and
are adversely affected by spring burns.  Also they prefer nesting in
dense cover, which is susceptible to heavy burning [5].  Fires before
May 10 in Manitoba negatively affect nesting success, and fires after
May 10 affect nesting success of later-nesting species [17].  Also,
large scale autumn burns may remove vegetation that is important for
capturing snow, which in turn recharges marshes during spring.

Spring burning to remove grass cover showed a slight decrease in mallard
nesting on a North Dakota wildlife refuge.  On average there were 13
percent fewer of all nesting ducks, including mallard, on plots that
were mowed and burned compared to undisturbed plots [13].  Fires on
another North Dakota refuge conducted over a 4-year period showed a
greater number of nest successes on plots burned in August and September
compared to June fires [8].  By the fourth growing season nest success
was still greater on the burned plots later, although there was no
significant difference between the number of nests on the plots burned
in August and September, and the plots burned in June.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Pair formation- mostly complete by autumn but can continue into winter;
                typically monogamous.
Breeding/Nesting- March through June.
Clutch- 5 to 14 eggs; young birds lay smaller clutches; may renest if
        original clutch is destroyed.
Incubation- 26 days.
Fledge- 8 weeks.
Maturity- 1 year.
[2,12,15]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

vegetation, insects, worms, gastropods, arthropods, grains
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS Editorial Board

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

vegetation, insects, worms, gastropods, arthropods, grains
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The familiar "quack" of ducks is from the female mallard--it is called the "decrescendo call", and can be heard for miles. A female will give the call when she wants to bring other ducks to her, such as her ducklings, and as a result it is also known as the "hail call". Mallards also use a variety of other calls to communicate amongst themselves. They have a good sense of vision.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
316 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest recorded wild Mallard lived to be 26 years and 4 months old. Most Mallards probably live much less than this, perhaps from 5 to 10 years.

Range lifespan

Status: wild:
27.0 (high) years.

Average lifespan

Status: wild:
316 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.1 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Most mallard hens breed as yearlings, but they may not have much success; studies show that older hens have much lower duckling mortality than yearlings. Pair bonding starts as early as October and continues through March. Mallard males leave the hen soon after mating occurs. The hen usually lays 9 -13 eggs in a nest on the ground near a body of water. When the ducklings hatch after 26-28 days, the hen leads them to water and does not return to the nest.

Range eggs per season: 9 to 13.

Range time to hatching: 26 to 28 days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is 5-14 (usually 8-10). Incubation, by female, lasts 26-30 days. Young first fly at 49-60 days. First breeds at 1 year. May attain high nesting density (up to at least about 400 nests/ha) on islands free of mammalian predators.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: monogamous

Most mallard females breed when they are 1 year old, but they may not have much success; studies show that older females have more success in breeding. Mating occurs from March through June. Females lay from 5 to 14 eggs in a nest on the ground near a body of water. Eggs hatch after 26 to 28 days of incubation.

Breeding interval: Mallards breed once yearly, though sometimes a second clutch is raised, especially if the first clutch failed.

Breeding season: March through June

Range eggs per season: 5.0 to 14.0.

Range time to hatching: 28.0 (high) days.

Average fledging age: 8.0 weeks.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Newly hatched Mallard Ducks are capable of swimming, walking, and communicating with their mother. Once hatched the female leads her ducklings to the water and abandons the nest. The young ducklings stay with their mother for about 8 weeks, then become independent.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anas platyrhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGACTATTTTCTACCAATCACAAAGACATCGGTACTCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTACTGATCCGGGCAGAACTAGGCCAGCCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATGGTAATGCCCATCATAATTGGAGGGTTCGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTTCTACTCGCCTCATCCACTGTAGAAGCTGGCGCTGGTACGGGTTGAACCGTATACCCACCTCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTGGACCTGGCTATCTTCTCACTTCACCTGGCTGGTGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTTGATCCTGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCAGGATTCGGAATTATCTCACACGTAGTCACATACTACTCGGGCAAAAAGGAACCCTTCGGCTACATAGGAATAGTCTGAGCCATGCTATCCATCGGCTTCCTAGGATTTATCGTCTGAGCCCACCACATATTCACCGTAGGAATAGACGTTGACACCCGGGCCTACTTCACATCCGCCACTATAATCATCGCCATCCCTACCGGAATCAAAGTCTTTAGCTGACTCGCCACCCTACACGGGGGAACAATCAAATGAGATCCCCCAATACTCTGAGCTCTAGGGTTTATCTTCCTATTTACCATCGGAGGACTAACAGGGATCGTCCTTGCGAACTCCTCCCTAGATATCGCCCTGCATGACACGTACTACGTAGTCGCCCACTTCCACTACGTACTATCTATGGGCGCTGTCTTTGCCATCCTAGCTGGATTCACTCACTGATTCCCCCTTCTTACAGGATTCACTCTACACCAAACATGAGCAAAAGCCCACTTCGGAGTGATATTTACAGGGGTAAACCTAACATTCTTCCCCCAACACTTCCTAGGCCTGGCAGGAATGCCCCGACGATACTCGGACTACCCTGATGCCTACACACTGTGAAACACCGTCTCCTCTATTGGGTCCCTGATCTCAATAGTGGCCGTAATCATACTAATGTTCATCATCTGAGAAGCCTTCTCAGCCAAACGGAAAGTCCTCCAACCAGAATTAACCGCCACAAACATTGAGTGAATCCACGGCTGCCCCCCTCCATACCACACCTTCGAGGAGCCAGCTTTCGTTCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anas platyrhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 41
Specimens with Barcodes: 76
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5