Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Biology

The mallard feeds mainly on vegetable matter, which is usually obtained by upending (tipping head first into the water, so that the tail remains visible above the surface) (3). During autumn and winter they may feed in fields, some distance from water (3). Breeding may take place throughout the year, but usually occurs after March (4). In overcrowded water bodies, such as parks, breeding males may attack females in order to mate; this may lead to the death of the female in some cases. This behaviour is rare in truly wild mallards, however (6). The hollow nest, lined with grasses, feathers and leaves (5), is typically made close to water and is often concealed by vegetation (4). Between 10-12 pale green, blue or creamy white eggs are produced (although as many as 16 per clutch have been known), and are incubated for 28-29 days by the female (4). The downy chicks are led to the water by the female shortly after hatching and are cared for by the female for up to 8 weeks (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

You find the mallard ducks almost anywhere where there is calm shallow water. So it's not surprising to find them in the middle of cities. They feed mostly on plants and seeds but also animal matter in the water. In the cities, they eat mostly bread. The Netherlands has lots of mallard ducks. Some years, 400,000 mallards were estimated.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anas platyrhynchos

The Mallard is the most recognizable species of waterfowl, often being the only species of duck present in ponds and small streams near cities and towns. This large duck is about 20 to 24 inches long with an oval-shaped body and short tail. Males are splotchy brown and tan with a green head and yellow bill, while females are speckled brown and tan with a dull brown bill. Both sexes have orange legs and a blue diamond on the wings. The Mallard is common across North America and Eurasia. This species may be found from the Arctic Circle south to the tropics. While some Mallard populations migrate between separate breeding and wintering grounds, many populations living in human-altered environments are non-migratory. Mallards are usually found in and around rivers, streams, lakes, or ponds. They eat a variety of foods, including insects, snails, and grains. Mallards are often present in large numbers where ducks are fed by humans. Mallards are often found floating on the water’s surface, occasionally dabbling (submerging their head and chest while their legs and tail stick out of the water) to find food. These ducks are also capable of taking off directly from the water. They may also be found on land, where they may be observed walking, or in the air, where they may be observed making swift and direct flights between bodies of water. They are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The familiar mallard is the most numerous duck in Britain (3), and is the ancestor of the domestic duck (2). Both male and female mallards are easily identified by the presence of a dark blue band on the wing known as a 'speculum', which is bordered above and below with white (2). Males and females are distinct; males have a metallic bottle-green head, a crisp white neck-collar and a rich purplish-brown breast. The upperparts are grey, the flanks are somewhat paler, and the central feathers of the black tail are curled smartly upwards (2). In contrast, females are brown, with streaks of darker brown and buff (4). Juveniles are very similar to females, but lack the speculum (2). It is the female mallard who produces the well-known loud 'quack-quack' call; males produce a softer 'rhaeb', particularly when alert, and a 'piu' whistle during courtship (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description of Anas platyrhynchos

Het mannetje heeft een glanzend groene kop en het vrouwtje is donkerbruin.
Creative Commons Attribution 3.0 (CC BY 3.0)

1geron

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Mallards can be found almost anywhere in the world. They dominate the Northern Hemisphere, and can be found easly in Oceana, Asia, Africa, South America and many islands

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: Alaska, Mackenzie Delta, southern Keewatin, and Maine south to southern California, Mexico, Oklahoma, and Virginia. Has expanded range in eastern North America (especially in the north) in recent decades (see Heusmann 1991 for a detailed account of status in the Atlantic Flyway). WINTERS: southern Alaska and southern Canada to southern U.S., Mexico, Cuba, occasionally Hawaii (AOU 1983). Half or more of the Mississippi Flyway's 3.2 million mallards winter in the lower Mississippi Valley, from Cape Girardeau, Missouri, to the Gulf of Mexico. Also occurs in the Palearctic. Many semiferal populations exist. Availablity of grain allows wintering north of pre-settlement range; now rare in Central America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

The mallard has a circumpolar distribution.  It occurs throughout North
America from northern Canada and Alaska south into Mexico and from coast
to coast [12].  It is usually a year-round resident in the central
United States and along the West Coast from Baja to southern Alaska.
The mallard's breeding range is usually in the more northerly parts of
its distribution; it winters in the southern United States and Mexico
[15].
  • 12.  Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to        the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin        Company. 298 p.  [20029]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

    1  Northern Pacific Border
    2  Cascade Mountains
    3  Southern Pacific Border
    4  Sierra Mountains
    5  Columbia Plateau
    6  Upper Basin and Range
    7  Lower Basin and Range
    8  Northern Rocky Mountains
    9  Middle Rocky Mountains
   10  Wyoming Basin
   11  Southern Rocky Mountains
   12  Colorado Plateau
   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, New Zealand Exclusive Economic Zone, North West Atlantic, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
HI ID IL IN IA KS KY LA ME MD
MA MI MN MS MO MT NE NV NH NJ
NM NY NC ND OH OK OR PA RI SC
SD TN TX UT VT VA WA WV WI WY


AB BC MB NB NF NT NS ON PE PQ
SK YT



MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Mallards can be found in many regions throughout the Northern Hemisphere, native to the Nearctic, Palearctic and Oriental regions. They are the most common duck species of the Northern Hemisphere and are found in Asia, North America, and many islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America; range extends from Labrador to the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread and common throughout Britain, the mallard is absent only from mountainous or very dry areas (3). The native population is supplemented in winter by immigrants from Iceland and Scandinavia, escaping harsh winter weather (3). Outside of Britain, the mallard is found in subtropical and temperate areas throughout the northern hemisphere (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mallards are undoubtedly the most recognized waterfowl in the world. They have a typical duck body with an iridescent blue patch on the wings in both sexes. On males the notable characteristics are the green iridescent feathers on the head and neck and curled black feathers on the tail. Females are uniformly a speckled brown color. The male duck's bill is yellow, while the female's bill is orange with black markings. Both males and females have orange legs, webbed feet, and dark colored eyes.

Average length: 48.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 1048.1 g.

Average basal metabolic rate: 4.068 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The mallard is undoubtably the most recognized waterfowl in the world. The familiar duck morphology is complemented with a iridesent blue speculum on the wings in both sexes. On the male, the notable characteristics are the green iridesent plumage on the head and neck, and curled black feathers on the tail. The female's plumage is drab brown.

Average mass: 1082 g.

Average mass: 1048.1 g.

Average basal metabolic rate: 4.068 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 58 cm

Weight: 1082 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Preferred Habitat

More info for the term: tree

Mallards prefer lowland habitat such as marshes, ponds, small lakes,
sheltered coastal bays and estuaries, shallow pools, tidal flats, and
protected coves [12,15].  They also graze in stubble fields and inhabit
low-elevation mountain lakes and streams.  Mallards primarily nest in
grasslands away from the water's edge but have been known to use old
bird nests, tree cavities, rights-of-way, and meadows with woody
vegetation [2].
  • 2.  Cowardin, Lewis M.; Gilmer, David S.; Shaiffer, Charles W. 1985. Mallard        recruitment in the agricultural environment of North Dakota. Wildlife        Monographs No. 92. Washington, DC: The Wildlife Society. 37 p.  [18150]
  • 12.  Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to        the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin        Company. 298 p.  [20029]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Mallards mostly inhabit wetland plant communities composed of marsh
species such as cattail (Typha spp.), bulrush (Scirpus spp.), smartweed
(Polygonum spp.), sedge (Carex spp.), and (Phragmites spp.).  They also
inhabit brome (Bromus spp.)-wheatgrass (Agropyron spp.) communities
[12].  Mallards may use upland meadows for nesting; plants in these
meadows may include aster (Aster spp.), sowthistle (Sonchus arvensis),
and white-top grass (Scholochloa festucacea) [17].

REFERENCES :
NO-ENTRY
  • 12.  Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to        the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin        Company. 298 p.  [20029]
  • 17.  Ward, P. 1968. Fire in relation to waterfowl habitat of the delta        marshes. In: Proceedings, annual Tall Timbers fire ecology conference;        1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers        Research Station: 255-267.  [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: swamp

    16  Aspen
    17  Pin cherry
    18  Paper birch
    63  Cottonwood
    65  Pin oak - sweetgum
    88  Willow oak - water oak - diamondleaf oak
    89  Live oak
    91  Swamp chestnut oak - cherrybark oak
    92  Sweetgum - willow oak
    93  Sugarberry - American elm - green ash
    94  Sycamore - sweetgum - American elm
    95  Black willow
    96  Overcup oak - water hickory
   101  Baldcypress
   102  Baldcypress - tupelo
   103  Water tupelo - swamp tupelo
   104  Sweetbay - swamp tupelo - redbay
   217  Aspen
   235  Cottonwood - willow

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K047  Fescue - oatgrass
   K048  California steppe
   K050  Fescue - wheatgrass
   K051  Wheatgrass - bluegrass
   K053  Grama - galleta steppe
   K054  Grama - tobosa prairie
   K056  Wheatgrass - needlegrass shrubsteppe
   K063  Foothills prairie
   K064  Grama - needlegrass - wheatgrass
   K065  Grama - buffalograss
   K066  Wheatgrass - needlegrass
   K067  Wheatgrass - bluestem - needlegrass
   K068  Wheatgrass - grama - buffalograss
   K069  Bluestem - grama prairie
   K070  Sandsage - bluestem prairie
   K071  Shinnery
   K072  Sea oats prairie
   K073  Northern cordgrass prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K076  Blackland prairie
   K077  Bluestem - sacahuista prairie
   K078  Southern cordgrass prairie
   K079  Palmetto prairie
   K080  Marl - everglades
   K081  Oak savanna
   K082  Mosaic of K074 and K100
   K083  Cedar glades
   K084  Cross Timbers
   K085  Mesquite - buffalograss
   K086  Juniper - oak savanna
   K087  Mesquite - oak savanna
   K088  Fayette prairie
   K089  Black Belt
   K090  Live oak - sea oats
   K091  Cypress savanna
   K092  Everglades
   K094  Conifer bog
   K100  Oak - hickory forest
   K104  Appalachian oak forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES28 Western hardwoods
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

Mallards are very adaptable and appear to have only a few specific
requirements.  They need enough dry ground away from the water's edge
for nesting yet plenty of pond area for feeding [2,17].  Also, mallards
need the previous year's dead vegetation for nests [15].
  • 2.  Cowardin, Lewis M.; Gilmer, David S.; Shaiffer, Charles W. 1985. Mallard        recruitment in the agricultural environment of North Dakota. Wildlife        Monographs No. 92. Washington, DC: The Wildlife Society. 37 p.  [18150]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]
  • 17.  Ward, P. 1968. Fire in relation to waterfowl habitat of the delta        marshes. In: Proceedings, annual Tall Timbers fire ecology conference;        1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers        Research Station: 255-267.  [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mallards live in a variety of habitats. Most often they live along waterways with plentiful vegetation, such as marshes, ponds, small lakes, coastal bays, and estuaries. They graze in stubble fields and nest in grasslands away from the water's edge.

Habitat Regions: temperate ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

coastal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour In temperate regions breeding populations of this species are sedentary or dispersive, often making local movements during severe weather5. Other populations are fully migratory2 with females and juveniles leaving the breeding grounds in the western Palearctic from Septemberand returning as early as February5. The species breeds between March and June3 in single pairs or loose groups1 although the exact timing varies with latitude3. While the females are incubating4 (from mid-May)5, 6 the males gather3 in small flocks and migrate to moulting areas6 where they undergo a flightless moulting period lasting for c.4 weeks5 (females moult near the breeding grounds)6. Outside of the breeding season the species can be found in small to very large flocks3 numbering up to several hundreds or even thousands of individuals7 especially when moulting5, on migration7 and during the winter2. The species may also roost both nocturnally and diurnally in communal groups when not breeding8. Habitat The species occurs in almost every wetland type1 although it generally avoids fast-flowing, oligotrophic1, 5, 7, deep, exposed, rough, rockbound waters and hard unvegetated areas such as rocky ground, sand dunes and artificial surfacing7. It requires water less than 1 m deep for foraging7 and shows a preference for freshwater habitats3 although it may frequent shallow brackish waters as long as they provide the cover1, 5 of submerged, floating, emergent or riparian vegetation, dense reedbeds or overhanging branches7. Habitats commonly frequented include flooded swampy woodlands, seasonal floodlands7, wet grassy swamps and meadows, oxbow lakes6, open waters with mudflats, banks or spits, irrigation networks, reservoirs, ornamental waters1, 5, 7, canals and sewage farms7. During the winter the species may also be found in saline habitats along the coast3 where water is shallow, fairly sheltered and within site of land7 (e.g. brackish lagoons7, brackish estuaries1, 7 and bays1). Diet The species is omnivorous and opportunistic1, 7, feeding by dabbling in water and by grazing on the land7. Its diet consists of seeds and the vegetative parts of aquatic and terrestrial plants (e.g. crops)1, as well as terrestrial and aquatic invertebrates (especially in the spring and summer) such as insects, molluscs, crustaceans, worms and occasionally amphibians and fish1. Breeding site The nest is a shallow depression7 or bowl of vegetation that can be situated in many different locations such as within vegetation on the ground, in natural tree cavities1 up to 10 m high (Africa)8, under fallen dead wood, on tree stumps6, under bushes8 and even in abandoned nests of other species (e.g. herons or crows)6. Nests are generally placed close to water2 although occasionally they may be some distance away3. Management information "Extensive" grazing of wetland grasslands (c.0.5 cows per hectare) was found to attract a higher abundance of the species in Hungary19. Studies in Danish coastal wetlands found that the spatial restriction of shore-based shooting was more successful at maintaining waterfowl population sizes than was the temporal restriction of shooting, and therefore that wildfowl reserves should incorporate shooting-free refuges that include adjacent marshland in order to ensure high waterfowl species diversity20. The cyclical removal of adult fish from an artificial waterbody (gravel pit) in the UK resulted in an increase in invertebrate food availability and an increase in the growth of submerged aquatic macrophytes, which in turn led to an increased use of the habitat for brood rearing by the species26. The removed fish (dead or alive) were sold to generate funds26. The species will also nest in artificial nest boxes1, 8.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most often, they prefer wetlands, where highly productive waters produce large amounts of floating, emergent and submerged vegetation Wetlands also produce a great deal of aquatic invertebrates on which mallards feed.

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 12.736
  Nitrate (umol/L): 1.249 - 8.636
  Salinity (PPS): 6.607 - 35.269
  Oxygen (ml/l): 6.149 - 8.081
  Phosphate (umol/l): 0.240 - 0.574
  Silicate (umol/l): 1.801 - 10.453

Graphical representation

Temperature range (°C): 8.272 - 12.736

Nitrate (umol/L): 1.249 - 8.636

Salinity (PPS): 6.607 - 35.269

Oxygen (ml/l): 6.149 - 8.081

Phosphate (umol/l): 0.240 - 0.574

Silicate (umol/l): 1.801 - 10.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily shallow waters such as ponds, lakes, marshes, and flooded fields; in migration and in winter mostly in fresh water and cultivated fields, less commonly in brackish situations (AOU 1983). See Nichols et al. (1983). Adapted to dynamic wetland conditions that provide a variety of wetland types in relatively close proximity (Allen 1986, which see for details on winter habitat in Lower Mississippi Valley). In Maryland, breeding pairs and broods used stormwater-control basins, especially permanent ponds with gently sloping sides (Adams et al. 1985). In California and Oregon, molting areas were dominated by bulrush and cattail and were traditionally flooded in summer and often associated with lakes or rivers (Yarris et al. 1994). Usually nests on ground in concealing vegetation, sometimes in trees or in atypical situations. Nest usually within 0.8 km of water (Palmer 1976). Commonly uses man-made ponds. Successful nesters are more likely to return to the same nesting site in successive years than are unsuccessful nesters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in almost every type of lowland wetland, including village ponds, lakes, and flood water (4). They tolerate the presence of humans, and are therefore found in parks, and rivers and streams in towns (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Extent of southward migration may depend on winter temperature, water conditions, and population size. Arrives in northern breeding areas in late March and early April, in far north from mid-May into June. Departs from northern breeding areas late September into November (may depart from far north by mid-August) (Palmer 1976).

Makes postbreeding migration to molting area; females that nested in Suisun Marsh, California, began leaving in late May, 50% had departed by mid-June, and nearly all had departed by mid-July; migrated mainly northward to areas in California and south-central Oregon, 12-536 km from nesting sites; exhibited fidelity to molting area (Yarris et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the term: hardwood

Mallards eat a variety of aquatic plants and invertebrates as well as
crops.  Foods include duckweeds (Lemna spp, Spirodela spp.), smartweeds
(Polygonum spp.), grasses (Poaceae), sedges (Carex spp.), pondweeds
(Potamogeton spp.), rice-cutgrass (Leersia oryzoides), arrowhead
(Sagittaria latifolia), wild millet (Echinochloa spp.), crustaceans,
worms, snails, spiders, corn, and soybeans [7,12,15].  Acorns in
bottomland hardwood types are also important food [14].
  • 7.  Gruenhagen, Ned M.; Fredrickson, Leigh H. 1990. Food use by migratory        female mallards in northwest Missouri. Journal of Wildlife Management.        54(4): 622-626.  [17427]
  • 12.  Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to        the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin        Company. 298 p.  [20029]
  • 14.  Moorhead, David J.; Hodges, John D.; Reinecke, Kenneth J. 1991.        Silvicultural options for waterfowl management in bottomland hardwood        stands and greentree reservoirs. In: Coleman, Sandra S.; Neary, Daniel        G., compilers. Proceedings, 6th biennial southern silvicultural research        conference: Volume 2; 1990 October 30 - November 1; Memphis, TN. Gen.        Tech. Rep. SE-70. Asheville, NC: U.S. Department of Agriculture, Forest        Service, Southeastern Forest Experiment Station: 710-721.  [17507]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Mallards consume a wide variety of foods, including aquatic vegetation, Insecta, and Oligochaeta, although they are not restricted to these. They also take advantage of human food sources, such as collecting grain from crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Mallards consume a wide variety of foods, including vegetation, insects, worms, gastropods and arthropods, although they are not restricted to these. They also take advantage of human food sources, such as gleaning grain from crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats seeds, rootlets, and tubers of aquatic plants, seeds of swamp and river bottom trees, acorns, cultivated grains, insects, mollusks, amphibians, small fishes, fish eggs; adults eat mostly vegetable material, young initially eat mainly invertebrates. Foraging opportunities optimal where water depth less than 40 cm. See Allen (1986) for further details on diet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

Predators of mallard include humans, cats, dogs, raccoon, opossum;
skunks, weasels, martens; eagles, hawks; crows, ravens, magpies; and
turtles, snakes, and fish [13,15].
  • 13.  Martz, Gerald F. 1967. Effects of nesting cover removal on breeding        puddle ducks. Journal of Wildlife Management. 31(2): 236-247.  [16284]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Cotylurus cornutus endoparasitises small intestine of Anas platyrhynchos

Animal / parasite / endoparasite
fluke of Dendritobilharzia pulverulenta endoparasitises renal vein of Anas platyrhynchos

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mallards are preyed upon by a wide variety of predators, including humans, Procyon lotor, Felis silvestris, Canis lupus familiaris, Mephitis mephitis, Mustela, Accipitridae, Corvus brachyrhynchos, Corvus corax, magpies, Testudines, Squamata, and Actinopterygii. They are watchful and escape to the water when startled, including the young ducklings.

Known Predators:

  • humans
  • Felis silvestris
  • Canis lupus familiaris
  • Procyon lotor
  • Didelphis virginiana
  • Mephitis mephitis
  • Mustela
  • martens
  • Accipitridae
  • Accipitridae
  • Corvus brachyrhynchos
  • Corvus corax
  • magpies
  • Testudines
  • Squamata
  • Actinopterygii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the term: cover

Burning in late May in Manitoba's pothole region showed a drastic
decline in mallard nests initiated immediately following burning.  Nest
initiations rose again in late June [5].  Mallards are early nesters and
are adversely affected by spring burns.  Also they prefer nesting in
dense cover, which is susceptible to heavy burning [5].  Fires before
May 10 in Manitoba negatively affect nesting success, and fires after
May 10 affect nesting success of later-nesting species [17].  Also,
large scale autumn burns may remove vegetation that is important for
capturing snow, which in turn recharges marshes during spring.

Spring burning to remove grass cover showed a slight decrease in mallard
nesting on a North Dakota wildlife refuge.  On average there were 13
percent fewer of all nesting ducks, including mallard, on plots that
were mowed and burned compared to undisturbed plots [13].  Fires on
another North Dakota refuge conducted over a 4-year period showed a
greater number of nest successes on plots burned in August and September
compared to June fires [8].  By the fourth growing season nest success
was still greater on the burned plots later, although there was no
significant difference between the number of nests on the plots burned
in August and September, and the plots burned in June.
  • 5.  Fritzell, Erik K. 1975. Effects of agricultural burning on nesting        waterfowl. Canadian Field-Naturalist. 89: 21-27.  [14635]
  • 8.  Higgins, Kenneth F. 1986. A comparison of burn season effects on nesting        birds in North Dakota mixed-grass prairie. Prairie Naturalist. 18(4):        219-228.  [1149]
  • 13.  Martz, Gerald F. 1967. Effects of nesting cover removal on breeding        puddle ducks. Journal of Wildlife Management. 31(2): 236-247.  [16284]
  • 17.  Ward, P. 1968. Fire in relation to waterfowl habitat of the delta        marshes. In: Proceedings, annual Tall Timbers fire ecology conference;        1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers        Research Station: 255-267.  [18932]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

Pair formation- mostly complete by autumn but can continue into winter;
                typically monogamous.
Breeding/Nesting- March through June.
Clutch- 5 to 14 eggs; young birds lay smaller clutches; may renest if
        original clutch is destroyed.
Incubation- 26 days.
Fledge- 8 weeks.
Maturity- 1 year.
[2,12,15]
  • 2.  Cowardin, Lewis M.; Gilmer, David S.; Shaiffer, Charles W. 1985. Mallard        recruitment in the agricultural environment of North Dakota. Wildlife        Monographs No. 92. Washington, DC: The Wildlife Society. 37 p.  [18150]
  • 12.  Madge, Steve; Burn, Hilary. 1988. Waterfowl: An indentification guide to        the ducks, geese and swans of the world. Boston, MA: Houghton Mifflin        Company. 298 p.  [20029]
  • 15.  Phillips, John C. 1986. A natural history of the ducks. Vols. 1-2. New        York: Dover Publications, Inc.  409 p.  [21634]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding density (2.3-9.5 birds per sq km) fluctuates with pond abundance in prairie pothole region (Krapu et al. 1983). In Manitoba, nesting home range size averaged 283 hectares (Dzubin 1955). Average breeding home ranges of radio-tagged birds in Minnesota were 210 hectares (12 females) and 240 hectares (12 males); range 66 hectares to 760 hectares (a pair, Gilmer et al. 1975).

In winter, may fly up to 48 to 64 kilometers to forage from roost sites. Does not defend rigid territories, but area immediately surrounding the female usually defended by the male. Broods susceptible to mink predation. Resident birds have higher reproduction whereas migrants have higher survival (Hestbeck et al. 1992).

May be negatively impacting black duck populations in eastern North America as a result of competitive interactions (Merendino and Ankney 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The familiar "quack" of ducks is from the female mallard--it is called the "decrescendo call", and can be heard for miles. A female will give the call when she wants to bring other ducks to her, such as her ducklings, and as a result it is also known as the "hail call". Mallards also use a variety of other calls to communicate amongst themselves. They have a good sense of vision.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest recorded wild Mallard lived to be 26 years and 4 months old. Most Mallards probably live much less than this, perhaps from 5 to 10 years.

Range lifespan

Status: wild:
27.0 (high) years.

Average lifespan

Status: wild:
316 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
316 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.1 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: monogamous

Most mallard females breed when they are 1 year old, but they may not have much success; studies show that older females have more success in breeding. Mating occurs from March through June. Females lay from 5 to 14 eggs in a nest on the ground near a body of water. Eggs hatch after 26 to 28 days of incubation.

Breeding interval: Mallards breed once yearly, though sometimes a second clutch is raised, especially if the first clutch failed.

Breeding season: March through June

Range eggs per season: 5.0 to 14.0.

Range time to hatching: 28.0 (high) days.

Average fledging age: 8.0 weeks.

Average age at sexual or reproductive maturity (female): 1.0 years.

Average age at sexual or reproductive maturity (male): 1.0 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Newly hatched Mallard Ducks are capable of swimming, walking, and communicating with their mother. Once hatched the female leads her ducklings to the water and abandons the nest. The young ducklings stay with their mother for about 8 weeks, then become independent.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most mallard hens breed as yearlings, but they may not have much success; studies show that older hens have much lower duckling mortality than yearlings. Pair bonding starts as early as October and continues through March. Mallard males leave the hen soon after mating occurs. The hen usually lays 9 -13 eggs in a nest on the ground near a body of water. When the ducklings hatch after 26-28 days, the hen leads them to water and does not return to the nest.

Range eggs per season: 9 to 13.

Range time to hatching: 26 to 28 days.

Average eggs per season: 9.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is 5-14 (usually 8-10). Incubation, by female, lasts 26-30 days. Young first fly at 49-60 days. First breeds at 1 year. May attain high nesting density (up to at least about 400 nests/ha) on islands free of mammalian predators.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anas platyrhynchos x A. crecca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Anas platyrhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 37 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATCAATCGATGACTATTTTCTACCAATCACAAAGACATCGGTACTCTATACCTTATCTTCGGGGCATGAGCCGGAATAATTGGCACAGCACTCAGCCTACTGATCCGGGCAGAACTAGGCCAGCCAGGGACCCTCCTGGGCGACGACCAAATTTATAACGTGATCGTCACCGCTCACGCCTTCGTAATAATCTTCTTCATGGTAATGCCCATCATAATTGGAGGGTTCGGCAACTGATTGGTCCCCCTGATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCATCATTCCTCCTTCTACTCGCCTCATCCACTGTAGAAGCTGGCGCTGGTACGGGTTGAACCGTATACCCACCTCTAGCAGGCAACCTAGCCCACGCCGGAGCCTCAGTGGACCTGGCTATCTTCTCACTTCACCTGGCTGGTGTCTCCTCCATCCTCGGAGCCATTAACTTCATTACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTTTTCGTCTGATCAGTCCTAATTACCGCCATCCTGCTCCTCCTATCACTCCCCGTCCTCGCCGCCGGCATCACAATGCTACTAACCGACCGAAACCTAAACACCACATTCTTTGATCCTGCCGGAGGGGGAGACCCAATCCTGTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTCTATATCTTAATCCTCCCAGGATTCGGAATTATCTCACACGTAGTCACATACTACTCGGGCAAAAAGGAACCCTTCGGCTACATAGGAATAGTCTGAGCCATGCTATCCATCGGCTTCCTAGGATTTATCGTCTGAGCCCACCACATATTCACCGTAGGAATAGACGTTGACACCCGGGCCTACTTCACATCCGCCACTATAATCATCGCCATCCCTACCGGAATCAAAGTCTTTAGCTGACTCGCCACCCTACACGGGGGAACAATCAAATGAGATCCCCCAATACTCTGAGCTCTAGGGTTTATCTTCCTATTTACCATCGGAGGACTAACAGGGATCGTCCTTGCGAACTCCTCCCTAGATATCGCCCTGCATGACACGTACTACGTAGTCGCCCACTTCCACTACGTACTATCTATGGGCGCTGTCTTTGCCATCCTAGCTGGATTCACTCACTGATTCCCCCTTCTTACAGGATTCACTCTACACCAAACATGAGCAAAAGCCCACTTCGGAGTGATATTTACAGGGGTAAACCTAACATTCTTCCCCCAACACTTCCTAGGCCTGGCAGGAATGCCCCGACGATACTCGGACTACCCTGATGCCTACACACTGTGAAACACCGTCTCCTCTATTGGGTCCCTGATCTCAATAGTGGCCGTAATCATACTAATGTTCATCATCTGAGAAGCCTTCTCAGCCAAACGGAAAGTCCTCCAACCAGAATTAACCGCCACAAACATTGAGTGAATCCACGGCTGCCCCCCTCCATACCACACCTTCGAGGAGCCAGCTTTCGTTCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anas platyrhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 39
Specimens with Barcodes: 76
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Mallards are the most abundant and widespread of all waterfowl; every year millions are harvested by hunters with little effect on their numbers. The greatest threat to Mallards is loss of habitat, but they easily adapt to human disturbances.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mallards are the most abundant and widespread of all waterfowl; every year millions are harvested by hunters with little effect on their numbers. The greatest threat to mallards is loss of habitat, but they readily adapt to human disturbances.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread (3). Included in the Birds of Conservation Concern Green List (low conservation concern) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is threatened by wetland habitat degradation and loss from pollution (e.g. petroleum9 and pesticide pollution22), wetland drainage, peat-extraction, changing wetland management practices (e.g. decreased grazing and mowing in meadows leading to scrub over-growth)and the burning and mowing of reedbeds9. The species also suffers mortality as a result of lead shot ingestion (e.g. in Spain21 and France24) and poisoning from white phosphorous ingestion (from firearms) in Alaska18. It is also susceptible to duck virus enteritis (DVE)10, avian influenza12 and avian botulism11 so may be threatened by future outbreaks of these diseases (although it may be able to withstand sporadic losses due to its high reproductive potential)11. The species is predated by American mink Neovison vison in Europe25. Utilisation The species is hunted throughout the world2 mainly for sport13, 14, 15, 17, but also for commercial use (food)16. The eggs of this species were (and possibly still are) harvested in Iceland23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: The recent decline is not simply a reflection of reduced number of wet ponds for breeding (Johnson and Shaffer 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This duck is not currently threatened; in fact the mallard population has been increasing since the 1960s (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: cool-season, cover, warm-season

Fires can reduce predator activity through elimination of
hiding cover [5].  Rotating spring fires have proved effective for
enhancing waterfowl habitat in Manitoba.  To ensure the maximum area is
available for nesting, burning should be done in small parcels [17].
Fire can be used to establish red goosefoot (Chenopodium rubrum), an
important duck food, by reducing impenetrable reed (Phragmites spp.)
thickets and breaking solid stands of meadow grass.  To avoid harmful
effects on ducks burning should be done at times other than during the
primary nesting season or shortly before [8].  Any burning can reduce
nesting cover, however.  Autumn fires could potentially destroy rank
grasses needed for cover the following nesting season, so some cover
should be left at all times.  In northern prairies burning should not be
conducted any more frequently than every two to three years [8].
Duebbert and others [18] recommend fire for rejuvenating prairie
pothole regions of cool- and warm-season grasses.  Cool-season native
grasses should be burned from late March through mid-May or mid-August
through mid-September.  Warm-season native grasses should be burned
between mid-May and mid-June [18].

Fire has been used to provide openings in cattail (Typha spp.) marshes
for mallard foraging.  In the St Clair Wildlife Refuge, Ontario, mallards
used openings that were created by winter burning followed by spring
flooding.  Mallard foraging effort was positively correlated with invertebrate
biomass and opening size (P less than 0.001).  Burning produced less cattail mortality
than winter mowing followed by spring flooding [20].  The Research Project
Summary
of Ball's [20] study provides details.

For more information on specific wetland species refer to the following
in this database:  Phragmites, Carex, Spartina, Scirpus, and Eleocharis.
  • 5.  Fritzell, Erik K. 1975. Effects of agricultural burning on nesting        waterfowl. Canadian Field-Naturalist. 89: 21-27.  [14635]
  • 8.  Higgins, Kenneth F. 1986. A comparison of burn season effects on nesting        birds in North Dakota mixed-grass prairie. Prairie Naturalist. 18(4):        219-228.  [1149]
  • 17.  Ward, P. 1968. Fire in relation to waterfowl habitat of the delta        marshes. In: Proceedings, annual Tall Timbers fire ecology conference;        1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers        Research Station: 255-267.  [18932]
  • 18.  Duebbert, Harold F.; Jacobson, Erling T.; Higgins, Kenneth F.; Podoll,        Erling B. 1981. Establishment of seeded grasslands for wildlife habitat        in the praire pothole region. Special Scientific Report-Wildlife No.        234. Washington, DC: U.S. Department of the Interior, Fish and Wildlife        Service. 21 p.  [5740]
  • 20. Ball, J. P. 1984. Habitat selection and optimal foraging by        mallards: a field experiment. Guelph, ON: University of Guelph. 44 p.        Thesis.  [18071]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: restoration, selection

Recruitment of mallards in the prairie pothole region of North America
is low even during years of high rainfall and runoff.  Wetland density
may be a limiting factor in nesting success, although evidence is
inconclusive [16].  The creation and restoration of wetlands can
increase wetland densities where low.

Setting numerical goals for local populations may be futile due to
regional and continental population shifts from habitat changes.
Instead, measurement of recruitment parameters at the local level can be
used with population models to predict population changes independent of
breeding size population [2].

Mallards are susceptible to diseases in urban settings.  Food poisoning
is especially common in stagnant park ponds where bacteria builds up
from heat and where bread is fed to ducks by people [4].

Bottomland oak forests serve as important feeding and wintering areas
for ducks.  Creating uneven-aged canopies by selection cuts and small
clearcuts (0.5 ha or larger) is adequate for maintaining and
regenerating oak stands [14].  Reservoirs in these areas should be
flooded beginning in mid-September and continued through October.
Drawdown should begin in mid-February.  Following years of good acorn
production, wetland flooding should be withheld for 2 to 3 years so the
understory can establish [14].

REFERENCES :
NO-ENTRY
  • 2.  Cowardin, Lewis M.; Gilmer, David S.; Shaiffer, Charles W. 1985. Mallard        recruitment in the agricultural environment of North Dakota. Wildlife        Monographs No. 92. Washington, DC: The Wildlife Society. 37 p.  [18150]
  • 4.  Figley, William K.; VanDruff, Larry W. 1982. The ecology of urban        mallards. Wildlife Monographs No. 81. Washington, DC: The Wildlife        Society. 40 p.  [2041]
  • 14.  Moorhead, David J.; Hodges, John D.; Reinecke, Kenneth J. 1991.        Silvicultural options for waterfowl management in bottomland hardwood        stands and greentree reservoirs. In: Coleman, Sandra S.; Neary, Daniel        G., compilers. Proceedings, 6th biennial southern silvicultural research        conference: Volume 2; 1990 October 30 - November 1; Memphis, TN. Gen.        Tech. Rep. SE-70. Asheville, NC: U.S. Department of Agriculture, Forest        Service, Southeastern Forest Experiment Station: 710-721.  [17507]
  • 16.  Rotella, Jay J.; Ratti, John T. 1992. Mallard brood survival and wetland        habitat conditions in southwestern Manitoba. Journal of Wildlife        Management. 56(3): 499-507.  [19286]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Anderson et al. (1974) for bibliography of management findings. See Allen (1986) for habitat suitability index model and information of wetland, timber, and cover type management in relation to winter habitat in Lower Mississippi Valley. See Barker et al. (1990) for information on the effects of different livestock grazing systems on nesting success in North Dakota. See Marcy (1986) for specifications for the construction and placement of wire nest baskets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

No specific conservation action has been targeted at this species, but it will have benefited from action carried out for other species of wildfowl, such as the creation and management of wetland nature reserves (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In areas where they are very abundant people may consider Mallards a nuisance as they are noisy and their droppings may accumulate on the ground.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mallards are an important game bird. The money generated by duck hunting license fees pays for the management of Mallard populations, and those of other ducks, and is used to protect important habitats. Also, money spent on hunting equipment is a significant addition to the economy.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

An important game species. The money generated by license fees pays for the management of mallard populations and is used to protect important habitats. Also, money spent on hunting equipment is a significant addition to the economy.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: See Munro and Kimball (1982) for information on harvest (1961-1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Hybridization with mallard has been implicated in the declines of several other duck species (e.g., see Rhymer et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mariana Mallard

The Mariana Mallard (Anas oustaleti) or Oustalet's Duck is an extinct type of duck of the genus Anas that was endemic to the Mariana Islands. Its taxonomic status is debated, and it has variously been treated as a full species, a subspecies of the Mallard or the Pacific Black Duck, or sometimes as a subspecies of the Indian Spot-billed Duck.

Contents

Taxonomy

Illustration by Allan Brooks (third bird)

The taxonomic status of the Mariana Mallard is disputed, since it resembles an intermediate of the Mallard and the Pacific Black Duck, two closely related allopatric species which frequently hybridise. Its males had two intergrading color morphs, called the "platyrhynchos" and the "superciliosa" types after the species they resembled more.[1] It was first scientifically described by Tommaso Salvadori as full species in the genus Anas, named after its collector, the French zoologist Emile Oustalet. Salvadori suggested it was related to the Pacific Black Duck.[2][3] It was previously known to the Chamorro people, who called it ngånga' (palao) in Chamorro, and to the Carolinian people, who called it ghereel'bwel in Carolinian.[citation needed]

After Salvadori, most taxonomists, such as Dean Amadon and Ernst Mayr, considered it a subspecies of the Mallard.[3] Yoshimaro Yamashina examined those specimens in Japanese museums in 1948, and decided that the Mariana Mallard was an example of hybrid speciation, and was descended from the Mallard and the Pacific Black Duck's Palau subspecies (Anas superciliosa pelewensis).[3][4] However, no molecular genetic evidence is available to support this hypothesis.[citation needed] Some scientists, such as Jean Delacour, have considered the Mariana Mallard a simple hybrid, so it was absent from Delacour's four-volume monograph on the ducks and from the IUCN Red List.[3] If Yamashina's hypothesis is correct, the Mariana Mallard would have presumably evolved into near species status in only about ten thousand years.[citation needed]

Neither Mariana Mallards nor their progenitor species are known from fossils on the Marianas, casting into doubt the assumption that a resident Black Duck population had been long established on the islands. However, most rock shelters and caves on the Marianas were obliterated in the 1944 Battle of Guam.[5] A species of flightless duck is known from a prehistoric bone found on Rota in 1994; was apparently not closely related to the Mariana Mallard.[6]

Description

Photo published in 1949

Mariana Mallards were 51–56 cm long and weighed approximately one kilogram, making them marginally smaller than mallards. Two intergrading color morphs were found in males, called the "platyrhynchos" and the "superciliosa" type after the species they resembled more.

Only the former had a distinct nuptial (breeding) plumage: the head was green as in mallard drakes, but less glossy, with some buff feathers on the sides, a dark brown eyestripe and a faint whitish ring at the base of the neck. The upper breast was dark ruddish chestnut brown with blackish-brown spots. The wing patch (speculum) and the tail was also like in mallard drakes' nuptial plumage, including curled-up central tail feathers, but the tips of the speculum feathers were buff. The underside was a mix between the vermiculated grey feathers of the mallard and the brown ones of the Pacific Black Duck. The remainder of the bird looked like a male Pacific Black Duck with lighter underwings. The bill was black at the base and olive at the tip, the feet reddish orange with darker webs and the iris brown. The eclipse plumage looked similar to a dark eclipse mallard drake.

Males of the "superciliosa" type resembled a Pacific Black Duck with a less distinctly marked head, the supercilium and cheeks being buffy and the cheek (malar) stripe hardly visible. The upper breast, flank and scapular feathers had broader buff edges, and the underwings were lighter. The speculum was usually as in the "platyrhynchos" type, i.e. mallard-like, but at least two specimens have the green speculum of the Pacific Black Duck. The bill was like that of A. superciliosa, and the iris and legs similar to the "platyrhynchos" type.

Females looked essentially like a dark mallard female with the orange of the feet and near the bill tip usually a bit more pure.

Distribution

It occurred, in recent times at least, on the islands of Guam, Saipan and Tinian. Two unidentified ducks were seen on Rota in 1945,[1] but as no movement of A. oustaleti between Saipan and Tinian, which are just 8 kilometres (5.0 mi) apart, was recorded,[7] these were probably vagrant migrating ducks, although Marshall (1949) suspected from circumstantial evidence that such movement did indeed take place.[8] However, the distance between Guam and Rota is nearly 80 kilometres (50 mi), making intentional migration between these islands not likely.

Ecology

The Mariana Mallard inhabited wetlands, mostly inland but occasionally also in coastal areas. On Guam, it was most abundant in the Talofofo River valley, on Tinian on Lake Hagoi and Lake Makpo (now Makpo Swamp) before it was drained, and on Saipan on the Garpan lagoon and on and around Lake Susupe. The birds were rather reclusive, preferring sheltered habitat with plenty of wetland/water plants – fern thickets (Acrostichum aureum) and reed beds (Scirpus, Cyperus and Phragmites (australis) karka),[9][10] where they also nested. Usually, pairs or small flocks were encountered, but in the key habitats larger groups of dozens and rarely up to 50–60 individuals could be found. Apart from possible inter-island movement, the birds were not migratory.

Feeding and reproduction are not well documented, but cannot expected to differ significantly from its immediate relatives. The Mariana Mallard fed on aquatic invertebrates, small vertebrates and plants, and although up-ending was not observed, they probably utilized it too.

Breeding was recorded from at least January to July, with a peak in June–July at the end of the dry season. One male specimen taken in October was also in breeding condition;[8] thus, the birds may have bred nealy year-round at least on occasion. Unfortunately, the courtship behavior, which in the strongly sexually dimorphic mallard is focused more on presentation of visual cues than in the monomorphic Pacific Black Duck (although it is generally similar in both species), was never recorded. Clutches consisted of 7–12 pale grey-green oval eggs, measuring 61.6 x 38.9 mm on average.[7] Incubation lasted around 28 days, males took no part in it and neither in caring for the ducklings. The precocial and nidifugous young fledged when about eight weeks old and became sexually mature the following year.

Extinction

The birds declined due to draining of wetlands for agriculture and construction. Hunting pressure was probably heavy, despite a ban on gun ownership under Japanese control (1914–1945), as the birds were unwary[verification needed] to be trapped, and at any rate the gun ban was lifted after World War II (see also below). By the 1940s, flocks of more than a dozen birds were seldom seen. On Guam, the last sightings were in 1949 and 1967 – the latter being a single, possibly vagrant, bird – and on Tinian in 1974. As Lake Susupe offered the most plentiful and least accessible habitat, although it too suffered from pollution by sugar mill wastes, the Saipan population lingered on for a few more years. The Mariana Mallard was listed as federally endangered on June 2, 1977.[11] In 1979, two males and a female were found on Saipan and caught; one male was later released, the last wild bird ever to be encountered. The pair was brought to Pohakuloa Training Area, Hawaii, and later to SeaWorld, San Diego, where it was attempted to have them reproduce in captivity. However, this was unsuccessful and the species became extinct with the death of the last individual in 1981. Surveys were conducted in the following years, but the species was certainly gone by then. It was removed from the USFWS Endangered Species List on February 23, 2004, due to extinction.[12][13]

Collection of specimens for museums and private collections must have had a temporary impact during the Japanese control over the islands.[citation needed] Although less than 100 specimens are on record, most were taken in the 1930s and 1940s for Japanese collectors; given the rather sedentary habits and small population size of the species, this may have jeopardized local populations to the point of extinction.[citation needed] Outside Japan, 7 specimens (including the type) are in the MNHN, Paris, one in the Walter Rothschild Zoological Museum, Tring, two in the USNM, Washington D.C. and six in the AMNH, New York City.[14] There are reports of additional specimens in Cambridge, Massachusetts and Lisbon.[15]

References

  1. ^ a b Madge, Steve; Burn, Hilary (1988). Waterfowl: an Identification Guide to the Ducks, Geese, and Swans of the World. Boston: Houghton Mifflin. p. 213. ISBN 0-395-46727-6. 
  2. ^ Salvadori, Tommaso (1894). Bulletin of the British Ornithologists' Club 20: 1. 
  3. ^ a b c d Weller, Milton W. (1980). The Island Waterfowl. Ames, Iowa: Iowa State University Press. pp. 17–19. ISBN 0813813107. 
  4. ^ Yamashina, Y. (1948). "Notes on the Marianas mallard". Pacific Science 2: 121–124. hdl:10125/9101. 
  5. ^ Steadman, David William (2006). Extinction and Biogeography of Tropical Pacific Birds. University of Chicago Press. ISBN 0-226-77142-3. 
  6. ^ Steadman, David William (1999). "The Prehistory of Vertebrates, Especially Birds, on Tinian, Aguiguan, and Rota, Northern Mariana Islands". Micronesica 31 (2): 319–345 (338, 340). 
  7. ^ a b Kuroda, N. (1941–1942). Tori (in Japanese) 11. pp. 99–119 (part 1), 443–448 (part 2). 
  8. ^ a b Marshall, Joe T., Jr. (1949). "The endemic avifauna of Saipan, Tinian, Guam and Palau". Condor 51 (5): 200–221. doi:10.2307/1364563. 
  9. ^ Tenorio, J. (1979). Ornithological surveys of wetlands in Guam, Saipan, Tinian, and Pagan. Honolulu: U.S. Army Corps of Engineers, Pacific Ocean Division. 
  10. ^ Stemmermann, L. (1981). A guide to Pacific wetland plants. Honolulu: U.S. Army Corps of Engineers, Honolulu District. 
  11. ^ Fish and Wildlife Service (1977). "Endangered and Threatened Wildlife and Plants: Determination that the Mariana Mallard is an Endangered Species". Federal Register 42: 28136–28137. 
  12. ^ Fish and Wildlife Service (2004). "Endangered and Threatened Wildlife and Plants; Removing the Mariana Mallard and the Guam Broadbill From the Federal List of Endangered and Threatened Wildlife". Federal Register 69: 8116–8119. 
  13. ^ Ravelo, John (25 February 2004). "CNMI's Mariana mallard now extinct". Saipan Tribune. Retrieved 14 August 2006. 
  14. ^ Fish and Wildlife Information Exchange (1996–1997). "Mariana Mallard, ESIS101048 (draft)". Virginia Tech. Archived from the original on 19 January 2000. http://web.archive.org/web/20000119174837/http://fwie.fw.vt.edu/WWW/esis/lists/e101048.htm.
  15. ^ Greenway, James C. (1967). "Marianas Island Duck". Extinct and Vanishing Birds of the World (2nd ed.). New York: Dover Publications. pp. 169–171. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Mallard

The Mallard (play /ˈmæl.ɑːrd/ or /ˈmæl.ərd/), or wild duck (Anas platyrhynchos), is a dabbling duck which breeds throughout the temperate and subtropical Americas, Europe, Asia, and North Africa, and has been introduced to New Zealand and Australia.

The male birds have a bright green or blue head, while the female's is light brown. The Mallard lives in wetlands, eats water plants, and is gregarious. It is also migratory. The Mallard is the ancestor of most domestic ducks, and can interbreed with other species of genus Anas.[2] However, a potentially terminal side effect of this vast interbreeding capability is gradual genetic dilution, which is causing rarer species of ducks to become at risk for extinction.

Contents

Taxonomy and evolution

The Mallard was one of the many bird species originally described by Linnaeus in his 18th century work, Systema Naturae, and still bears the first binomial name given to it.[3]

The Mallard is the ancestor of almost all of the varieties of domestic ducks. Ducks belong to the subfamily Anatinae of the waterfowl family Anatidae. The wild Mallard and Muscovy duck (Cairina moschata) are believed to be the ancestors of all domestic ducks.[4]

The name is derived from the Old French malart or mallart "wild drake", although its ultimate derivation is unclear. It may be related to an Old High German masculine proper name Madelhart, clues lying in the alternate English forms "maudelard" or "mawdelard".[5]

Mallards frequently interbreed with their closest relatives in the genus Anas, such as the American Black Duck, and also with species more distantly related, for example the Northern Pintail, leading to various hybrids that may be fully fertile. This is quite unusual among different species, and apparently is because the Mallard evolved very rapidly and not too long ago, during the Late Pleistocene only. The distinct lineages of this radiation are usually kept separate due to non-overlapping ranges and behavioural cues, but are still not fully genetically incompatible. Mallards and their domesticated conspecifics are, of course, also fully interfertile.[citation needed]

Mallards appear to be closer to their Indo-Pacific relatives than to their American ones judging from biogeography. Considering mtDNA D-loop sequence data,[6] they may have evolved more probably than not in the general area of Siberia; Mallard bones rather abruptly appear in food remains of ancient humans and other deposits of fossil bones in Europe, without a good candidate for a local predecessor species[citation needed]. The large ice age paleosubspecies which made up at least the European and west Asian populations during the Pleistocene has been named Anas platyrhynchos palaeoboschas[citation needed].

Haplotypes typical of American Mallard relatives and Spotbills can be found in Mallards around the Bering Sea.[7] The Aleutian Islands turned out to hold a population of Mallards that appear to be evolving towards a subspecies, as gene flow with other populations is very limited.[6]

The size of the Mallard varies clinally, and birds from Greenland, although larger than birds further south, have smaller bills and are stockier. It is sometimes separated as subspecies, the Greenland Mallard (A. p. conboschas).[citation needed]

Description

Iridescent blue-black-white speculum feathers of male

The Mallard is 56–65 centimetres (22–26 in) long (of which the body makes up around two-thirds), has a wingspan of 81–98 centimetres (32–39 in),[8] and weighs 0.9–1.2 kilograms (32–42 oz). The breeding male is unmistakable, with a bright bottle-green head, black rear end and a yellowish orange (can also contain some red) bill tipped with black (as opposed to the black/orange bill in females). It has a white collar which demarcates the head from the purple-tinged brown breast, grey brown wings, and a pale grey belly. The dark tail has white borders.[9] The female Mallard is a mottled light brown, like most female dabbling ducks, and has buff cheeks, eyebrow, throat and neck with a darker crown and eye-stripe.[9] However, both the female and male Mallards have distinct purple speculum edged with white, prominent in flight or at rest (though temporarily shed during the annual summer moult). Upon hatching, the plumage coloring of the duckling is yellow on the underside and face (with streaks by the eyes) and black on the backside (with some yellow spots) all the way to the top and back of the head. Its legs and bill are also black. As it nears a month in age, the duckling's plumage will start becoming drab, looking more like the female (though its plumage is more streaked) and its legs will lose their dark gray coloring.[9] Two months after hatching, the fledgling period has ended and the duckling is now a juvenile. Between three to four months of age, the juvenile can finally begin flying as its wings are fully developed for flight (which can be confirmed by the sight of purple speculum feathers). Its bill will soon lose its dark gray coloring and its sex can finally be distinguished by three factors:[citation needed]

  • Bill coloring: Yellow for males, Black and orange for females
  • Breast Feathers: Reddish-brown for males, Brown for females
  • Center Tail feather: Curled for males (called a Drake Feather), Straight for females

During the final period of maturity leading up to adulthood (6–10 months of age), the plumage of female juveniles remains the same while the plumage of male juveniles slowly changes to its recognizable colors.[citation needed] This plumage change also applies to adult Mallard males when they transition in and out of their non-breeding (eclipse) plumage at the beginning and the end of the summer molting period. The adulthood age for Mallards is 14 months and the average life expectancy is 20 years.

An American Black Duck (Anas rubripes, top left) and a male Mallard (Anas platyrhynchos, bottom right) in eclipse plumage

Several species of duck have brown-plumaged females which can be confused with the female Mallard. The female Gadwall (A. strepera) has an orange-lined bill, white belly, black and white speculum which is seen as a white square on the wings in flight, and is a smaller bird.[9]

In captivity, domestic ducks come in wild-type plumages, white, and other colours. Most of these colour variants are also known in domestic Mallards not bred as livestock, but kept as pets, aviary birds, etc., where they are rare but increasing in availability.

A noisy species, the male has a nasal call, and a high-pitched whistle, while the female has a deeper "quack" stereotypically associated with ducks.[10][11]

The Mallard is a rare example of both Allen's Rule and Bergmann's Rule in birds. Bergmann's Rule, which states that polar forms tend to be larger than related ones from warmer climates, has numerous examples in birds. Allen's Rule says that appendages like ears tend to be smaller in polar forms to minimize heat loss, and larger in tropical and desert equivalents to facilitate heat diffusion, and that the polar taxa are stockier overall. Examples of this rule in birds are rare, as they lack external ears. However, the bill of ducks is very well supplied with blood vessels and is vulnerable to cold.[citation needed]

Due to the malleability of the Mallard's genetic code, which gives it its vast interbreeding capability, mutations in the genes that decide plumage color are very common and have resulted in a wide variety of hybrids such as Brewer's duck (Mallard x Gadwall, Anas strepera).[12]

Distribution and habitat

Female landing

The Mallard is widely distributed across the Northern Hemisphere, North America from southern and central Alaska to Mexico, the Hawaiian Islands, and across Eurasia, from Iceland and southern Greenland and parts of Morocco (North Africa) in the west, Scandinavia to the north, and to Siberia, Japan, and China in the east.[8] It is strongly migratory in the northern parts of its breeding range, and winters farther south. For example, in North America it winters south to Mexico, but also regularly strays into Central America and the Caribbean between September and May.[13]

The Mallard inhabits a wide range of habitat and climates, from Arctic Tundra to subtropical regions. It is found in both fresh- and salt water wetlands, including parks, small ponds, rivers, lakes and estuaries, as well as shallow inlets and open sea within sight of the coastline. Water depths of less than 1 m (4 ft) are preferred, birds avoiding areas more than a few metres deep. They are attracted to bodies of water with aquatic vegetation.[11]

Bird with wings forward. Yellow bill, green head with white collar, brown body with blue wing feathers and orange feet.
Drake in flight

Behaviour

Feeding

The Mallard is omnivorous and very flexible in its food choice. Its diet may vary based on several factors, including the stage of the breeding cycle, short term variations in available food, nutrient availability, and inter- and intraspecific competition.[14] The majority of the Mallard's diet seems to be made up of gastropods, invertebrates (including beetles, flies, lepidopterans, dragonflies, and caddisflies), crustaceans, worms, many varieties of seeds and plant matter, and roots and tubers. During the breeding season, male birds were recorded to have eaten 37.6% animal matter and 62.4% plant matter, most notably Echinochloa crus-galli, and nonlaying females ate 37.0% animal matter and 63.0% plant matter, while laying females ate 71.9% animal matter and only 28.1% plant matter.[15] Plants generally make up a larger part of the bird's diet, especially during fall migration and in the winter.[16][17]

It usually feeds by dabbling for plant food or grazing; there are reports of it eating frogs. It usually nests on a river bank, but not always near water. It is highly gregarious outside of the breeding season and will form large flocks, which are known as a sord.[18]

Breeding

Mallard eggs and a nest
Female swimming with ducklings that are less than a week old

Mallards usually form pairs (in October and November) only until the female lays eggs at the start of nesting season which is around the beginning of spring (early March to late May), at which time she is left by the male who will join up with other males to await the molting period which begins in June. During the brief time before this, however, the males are still sexually potent and some of them will either remain on standby to sire replacement clutches (for female Mallards that have lost or abandoned their previous clutch) or forcibly mate with females of a different species that appear to be isolated or unattached.

The nesting period can be very stressful for the female; since she lays more than half her body weight in eggs and requires a lot of rest and a feeding/loafing area that is safe from predators. When seeking out a suitable nesting site, the female's preferences are areas that are well concealed, inaccessible to ground predators, or have few predators nearby. This can include urban areas that have roof gardens, enclosed courtyards, and flower boxes on window ledges more than one story up which prevents the ducklings from leaving safely without human intervention. The clutch is 8–13 eggs, which are incubated for 27–28 days to hatching with 50–60 days to fledgling. The ducklings are precocial and fully capable of swimming as soon as they hatch. However, Filial imprinting will compel them to instinctively stay near the mother not only for warmth and protection but also to learn about and remember their habitat as well as how and where to forage for food. When ducklings mature into flight-capable juveniles, they will learn about and remember their traditional migratory routes (unless they are born and raised in captivity). After this, the juveniles and the mother will either continue staying together (until the breeding season arrives) or they will finally part ways which can occur for two reasons.

  • The mother will leave the juveniles, knowing that they can fully fend for themselves.
  • The juveniles will leave the mother and set off on their own to seek out new sources of food and water, both natural and artificial.

When they pair off with mating partners, often one or several drakes will end up "left out". This group will sometimes target an isolated female duck, even when she's of a different species, and proceed to chase and peck at her until she weakens, at which point each male will take turns copulating with the female. Lebret (1961) calls this behaviour ‘Attempted Rape Flight’ and Cramp & Simmons (1977) speak of ‘rape-intent flights’. Male Mallards will also occasionally chase other male ducks of a different species, and even each other, in the same way. In one documented case of ‘homosexual necrophilia’, a male Mallard copulated with another male he was chasing after the chased male died upon flying into a glass window.[19]

Mallards are opportunistically targeted by brood parasites, occasionally having eggs laid in their nests by Redheads, Ruddy Ducks, Lesser Scaup, Gadwalls, Northern Shovelers, Northern Pintails, Cinnamon Teal, Common Goldeneyes, and other Mallards. These eggs are generally accepted when they resemble the eggs of the host Mallard, although the hen may attempt to eject them or even abandon the nest if parasitism occurs during egg laying.[20]

Conservation

The last male Mariana Mallard

The release of feral Mallards in areas where they are not native sometimes creates problems through interbreeding with indigenous waterfowl. These non-migratory Mallards interbreed with indigenous wild ducks from local populations of closely related species through genetic pollution by producing fertile offspring. Complete hybridization of various species of wild ducks gene pools could result in the extinction of many indigenous waterfowl. The wild Mallard itself is the ancestor of most domestic ducks and its naturally evolved wild gene pool gets genetically polluted in turn by the domesticated and feral populations.[21][22][23]

The Mallard is considered an invasive species in New Zealand. There, and elsewhere, Mallards are spreading with increasing urbanization and hybridizing with local relatives.[24] Over time, a continuum of hybrids ranging between almost typical examples of either species will develop; the speciation process beginning to reverse itself.[25] This has created conservation concerns for relatives of the Mallard, such as the Hawaiian Duck,[26] the A. s. superciliosa subspecies of the Pacific Black Duck,[27] the American Black Duck,[28] the Mottled Duck,[29] Meller's Duck,[30] the Yellow-billed Duck,[25] and the Mexican Duck,[31] in the latter case even leading to a dispute whether these birds should be considered a species[32] (and thus entitled to more conservation research and funding) or included in the Mallard.

The availability of Mallards, Mallard ducklings, and fertilized Mallard eggs for public sale and private ownership, either as livestock or as pets, is currently legal in the United States except for the state of Florida which has currently banned domestic ownership of Mallards. This is to prevent hybridisation with the native Mottled Duck.[33]

Mallards are also causing severe "genetic pollution" of South Africa's biodiversity by breeding with endemic ducks, although the Agreement on the Conservation of African-Eurasian Migratory Waterbirds applies to the Mallard. The hybrids of Mallard and the Yellow-billed Duck are fertile and can produce more hybrid offspring. If this continues, only hybrids will occur and in the long term this will result in the extinction of various indigenous waterfowl. The Mallard duck can cross breed with 63 other species and is posing a severe threat to the genetic integrity of indigenous waterfowl. Mallards and their hybrids compete with indigenous birds for resources such as food, nest sites and roosting sites.[23]

Mallards pond 2009.ogv
Several drakes swim in a pond

The Chinese Spotbill is currently introgressing into the Mallard populations of the Primorsky Krai, possibly due to habitat changes from global warming.[34] The Mariana Mallard was a resident allopatric population—in most respects a good species—apparently initially derived from Mallard-Pacific Black Duck hybrids;[35] unfortunately, it became extinct in the 1980s. In addition, feral domestic ducks interbreeding with Mallards have led to a size increase—especially in drakes—in most Mallards in urban areas. Rape flights between normal-sized females and such stronger males are liable to end with the female being drowned by the males' combined weight.[citation needed]

Anas platyrhynchos -Boston Harbor, Massachusetts, USA- parent and chicks-8.ogv
Ducklings following mother in Boston Harbor, USA

The Laysan Duck is an insular relative of the Mallard with a very small and fluctuating population. Mallards sometimes arrive on its island home during migration, and can be expected to occasionally have remained and hybridized with Laysan Ducks as long as these species exist. But these hybrids are less well adapted to the peculiar ecological conditions of Laysan Island than the local ducks, and thus have lower fitness, and furthermore, there were—apart from a brief time in the early 20th century when the Laysan Duck was almost extinct—always much more Laysan Ducks than stray Mallards. Thus, in this case, the hybrid lineages would rapidly fail.[citation needed]

In the cases mentioned above, however, ecological changes and hunting have led to a decline of local species; for example, the New Zealand Grey Duck population declined drastically due to overhunting in the mid-20th century.[36] In the Hawaiian Duck, it seems that hybrid offspring are less well-adapted to native habitat and that utilizing them in reintroduction projects makes these less than successful.[37] In conclusion, the crucial point underlying the problems of Mallards "hybridizing away" relatives is far less a consequence of Mallards spreading, but of local ducks declining; allopatric speciation and isolating behaviour have produced today's diversity of Mallard-like ducks despite the fact that in most if not all of these populations, hybridization must have occurred to some extent.[citation needed]

Relationship with humans

Mallards by Carl Friedrich Deiker (1875)

The Mallard is depicted in a marginal decoration of the 15th century English illuminated manuscript the Sherborne Missal.[38]

Since 1933, the Peabody Hotel in Downtown Memphis, Tennessee has maintained a long tradition of keeping one Mallard drake and four Mallard hens, called The Peabody Ducks, as a popular hotel attraction and as guests of honor. The Mallards are provided by a local farmer and friend of the Peabody Hotel and are rotated out and returned to the farm for a new team of Mallards every three months. This tradition has also been maintained and observed at the other Peabody Hotels in Little Rock, Arkansas and Orlando, Florida.[39]

The children's picture book Make Way for Ducklings, published in 1941 and winner of the 1942 Caldecott Medal for its illustrations, is the story of a pair of Mallards who decide to raise their family on an island in the lagoon in Boston Public Garden in Massachusetts.[40]

Duck Head, a U.S. clothing brand, uses the image of a Mallard's head as its logo.[41]

Mallard Drakes, or ducks that were stylized on them, are featured in Duck Hunt, a shooting game for the Nintendo Entertainment System.

See also

  • Rouen Duck: A domestic duck breed that is identical to the Mallard in terms of plumage coloring.

Footnotes

  1. ^ BirdLife International (2009). "Anas platyrhynchos". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/141504. Retrieved 13 August 2011. 
  2. ^ Phillips, John C. (1915.). "Experimental studies of hybridization among ducks and pheasants.". Journal of Experimental Zoology 18: 69–112. 
  3. ^ Linnaeus, Carl (1758) (in Latin). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 125. 
  4. ^ Anas platyrhynchos, Domestic Duck; DigiMorph Staff – The University of Texas at Austin
  5. ^ Simpson, John; Weiner, Edmund, ed (1989). "Mallard". Oxford English Dictionary (2nd edition ed.). Oxford: Clarendon Press. ISBN 0-19-861186-2. 
  6. ^ a b Kulikova et al. (2005)
  7. ^ Kulikova et al. (2004, 2005)
  8. ^ a b Cramp 1977, p. 505.
  9. ^ a b c d Cramp 1977, p. 506.
  10. ^ Rogers (2001)
  11. ^ a b Cramp 1977, p. 507.
  12. ^ http://web4.audubon.org/bird/BoA/F39_G4c.html
  13. ^ Herrera et al. (2006)
  14. ^ Krapu, Gary L.; Kenneth J. Reinecke (1992). "Foraging Ecology and Nutrition". In Bruce D. J. Batt. Ecology and management of breeding waterfowl. Minneapolis: University of Minnesota Press. p. 10. ISBN 0816620016. 
  15. ^ Swanson, George A.; Mavis I. Meyer, Vyto A. Adomaitis (1985). "Foods Consumed by Breeding Mallards on Wetlands of South-Central North Dakota". The Journal of Wildlife Management 49 (1). 
  16. ^ Gruenhagen, Ned M.; Leigh H. Fredrickson (1990). "Food Use by Migratory Female Mallards in Northwest Missouri". The Journal of Wildlife Management 54 (4). 
  17. ^ Combs, Daniel L.; Leigh H. Fredrickson (1996). "Foods Used by Male Mallards Wintering in Southeastern Missouri". The Journal of Wildlife Management (Allen Press) 60 (3). 
  18. ^ "Baltimore Bird Club. Group Name for Birds: A Partial List". http://baltimorebirdclub.org/gnlist.html. Retrieved 2007-06-03. 
  19. ^ Moeliker (2001). This paper was awarded with an Ig Nobel Prize in 2003 (MacLeod 2005).
  20. ^ Drilling, Nancy; Titman, Roger; Mckinney, Frank (2002). "Mallard (Anas platyrhynchos)". In Poole, A. The Birds of North America Online. Ithica: Cornell Lab of Ornithology. doi:10.2173/bna.658. http://bna.birds.cornell.edu/bna/species/658. Retrieved 1 February 2011. 
  21. ^ Mottled Ducks : The Problem : Hybridization; Florida Fish and Wildlife Conservation Commission, MyFWC.com
  22. ^ Environmental assessment for control of free-ranging resident Mallards in Florida, May 2002, Contact: Frank Bowers, U.S. Fish and Wildlife Service
  23. ^ a b Invasive Alien Bird Species Pose A Threat, Kruger National Park, Siyabona Africa Travel (Pty) Ltd – South Africa Safari Travel Specialist
  24. ^ Rhymer & Simberloff (1996)
  25. ^ a b Rhymer (2006)
  26. ^ Griffin et al. (1989), Rhymer & Simberloff (1996)
  27. ^ Gillespie (1985), Rhymer et al. (1994), Rhymer & Simberloff (1996), Williams & Basse (2006).
  28. ^ Johnsgard (1967), Avise et al. (1990), Rhymer & Simberloff (1996), Mank et al. (2004).
  29. ^ Mazourek & Gray (1994), Rhymer & Simberloff (1996), McCracken et al. (2001).
  30. ^ Young & Rhymer (1998)
  31. ^ Rhymer & Simberloff (1996), McCracken et al. (2001)
  32. ^ See AOU (1983)
  33. ^ "Mallard Possession Rule". Florida Fish and Wildlife Conservation Commission. http://myfwc.com/wildlifehabitats/Duck_Mallard_rule.htm. Retrieved 11 January 2011. 
  34. ^ Kulikova et al. (2004)
  35. ^ Yamashina (1948)
  36. ^ Williams & Basse 2006
  37. ^ Rhymer & Simberloff (1996), see also Kirby et al. (2004)
  38. ^ Clark, Kenneth (1977). Animals and Men. London: Thames and Hudson. pp. 107. ISBN 0-500-23257-1. 
  39. ^ http://www.peabodymemphis.com/peabody-ducks/
  40. ^ McCloskey, Robert (1961) [1941] (Hardback). Make Way For Ducklings. New York: The Viking Press. ISBN 0-670-45149-5. 
  41. ^ History of the Brand, Duck Head International LLC website, accessed October 23, 2010

References

  • American Ornithologists' Union (AOU) (1983): Check-list of North American Birds (6th edition). American Ornithologists' Union, Washington, DC.
  • Avise, John C.; Ankney, C. Davison & Nelson, William S. (1990): Mitochondrial Gene Trees and the Evolutionary Relationship of Mallard and Black Ducks. Evolution 44(4): 1109–1119. doi:10.2307/2409570 (HTML abstract and first page image)
  • Bagemihl, Bruce (1999): Biological Exuberance: Animal Homosexuality and Natural Diversity: 479–481. St. Martin's Press. ISBN 0312192398
  • Cramp, Stanley, ed (1977). Handbook of the Birds of Europe the Middle East and North Africa, the Birds of the Western Palearctic, Volume 1: Ostrich to Ducks. Oxford: Oxford University Press. ISBN 0-19-857358-8. 
  • Gillespie, Grant D. (1985): Hybridization, introgression, and morphometric differentiation between Mallard (Anas platyrhynchos) and Grey Duck (Anas superciliosa) in Otago, New Zealand. Auk 102 (3): 459–469. PDF fulltext
  • Griffin, C.R.; Shallenberger, F.J. & Fefer, S.I. (1989): Hawaii's endangered waterbirds: a resource management challenge. In: Sharitz, R.R. & Gibbons, I.W. (eds.): Proceedings of Freshwater Wetlands and Wildlife Symposium: 155–169. Savannah River Ecology Lab, Aiken, South Carolina.
  • Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006): Nuevos registros para la avifauna de El Salvador. ["New records for the avifauna of El Salvador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 1–19. [Spanish with English abstract] PDF fulltext
  • Johnsgard, Paul A. (1967): Sympatry Changes and Hybridization Incidence in Mallards and Black Ducks. American Midland Naturalist 77(1): 51–63. doi:10.2307/2423425 (HTML abstract and first page image)
  • Johnson, Kevin P. & Sorenson, Michael D. (1999): Phylogeny and biogeography of dabbling ducks (genus Anas): a comparison of molecular and morphological evidence. Auk 116 (3): 792–805. PDF fulltext
  • Kirby, Ronald E.; Sargeant, Glen A. & Shutler, Dave (2004): Haldane's rule and American black duck × mallard hybridization. Canadian Journal of Zoology 82(11): 1827–1831. doi:10.1139/z04-169 (HTML abstract)
  • Kulikova, Irina V.; Zhuravlev, Yury N. & McCracken, Kevin G. (2004): Asymmetric hybridization and sex-biased gene flow between Eastern Spot-billed Ducks (Anas zonorhyncha) and Mallards (A. platyrhynchos) in the Russian Far East. Auk 121 (3): 930–949. [English with Russian abstract] DOI: 10.1642/0004-8038(2004)121[0930:AHASGF]2.0.CO;2 PDF fulltext
  • Kulikova, Irina V.; Drovetski, S.V.; Gibson, D.D.; Harrigan, R.J.; Rohwer, S.; Sorenson, Michael D.; Winker, K.; Zhuravlev, Yury N. & McCracken, Kevin G. (2005): Phylogeography of the Mallard (Anas platyrhynchos): Hybridization, dispersal, and lineage sorting contribute to complex geographic structure. Auk 122 (3): 949–965. [English with Russian abstract] DOI: 10.1642/0004-8038(2005)122[0949:POTMAP]2.0.CO;2 PDF fulltext. Erratum: Auk 122 (4): 1309. DOI: 10.1642/0004-8038(2005)122[0949:POTMAP]2.0.CO;2
  • MacLeod, Donald (2005): Necrophilia among ducks ruffles research feathers. Education Guardian (March 8). Retrieved 2006-DEC-09.
  • Mank, Judith E.; Carlson, John E. & Brittingham, Margaret C. (2004): A century of hybridization: Decreasing genetic distance between American black ducks and mallards. Conservation Genetics 5(3): 395–403. doi:10.1023/B:COGE.0000031139.55389.b1 (HTML abstract)
  • Mazourek, J.C. & Gray, P.N. (1994): The Florida duck or the mallard? Florida Wildlife 48 (3): 29–31. DOC fulltext
  • McCracken, Kevin G.; Johnson, William P. & Sheldon, Frederick H. (2001): Molecular population genetics, phylogeography, and conservation biology of the mottled duck (Anas fulvigula). Conservation Genetics 2 (2): 87–102. doi:10.1023/A:1011858312115 PDF fulltext
  • Moeliker, C. W. "Kees" (2001): The first case of homosexual necrophilia in the Mallard Anas platyrhynchos (Aves: Anatidae). Deinsea 8: 243–247. PDF fulltext
  • Rhymer, Judith M. (2006): Extinction by hybridization and introgression in anatine ducks. Acta Zoologica Sinica 52(Supplement): 583–585. PDF fulltext
  • Rhymer, Judith M. & Simberloff, Daniel (1996): Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27: 83–109. doi:10.1146/annurev.ecolsys.27.1.83 (HTML abstract)
  • Rhymer, Judith M.; Williams, Murray J. & Braun, Michael J (1994). Mitochondrial analysis of gene flow between New Zealand Mallards (Anas platyrhynchos) and Grey Ducks (A. superciliosa). Auk 111 (4): 970–978. PDF fulltext
  • Rogers, D. (2001): Animal Diversity Web: Anas platyrhynchos. Retrieved 2006-DEC-08.
  • Williams, Murray & Basse, Britta (2006): Indigenous gray ducks, Anas superciliosa, and introduced mallards, A. platyrhynchos, in New Zealand: processes and outcome of a deliberate encounter. Acta Zoologica Sinica 52(Supplement): 579–582. PDF fulltext
  • Yamashina, Y. (1948). "Notes on the Marianas mallard". Pacific Science 2: 121–124. 

media* Young, H. Glyn; Rhymer, Judith M. (1998). "Meller's duck: A threatened species receives recognition at last". Biodiversity and Conservation 7: 1313–1323. doi:10.1023/A:1008843815676. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes diazi group, formerly regarded as a separate species (AOU 1998). A. fulvigula, A. rubripes, A. wyvilliana, A. laysanensis, and some Old World forms sometimes are included in this species (AOU 1983, 1998). Allozyme data presented by Browne et al. (1993) indicate that A. platyrhynchos is specifically distinct from wyvilliana and laysanensis. Mitochondrial DNA data indicate an extremely close evolutionary relationship between mallards and black ducks, and, in conjunction with geographic distributions, suggest that the black duck is a recent evolutionary derivative of a more broadly distributed mallard-black duck ancestor (Avise et al. 1990). See Livezey (1991) for a phylogenetic analysis and classification (supergenera, subgenera, infragenera, etc.) of dabbling ducks based on comparative morphology. See Byers and Cary (1991) for information on morphological differences among wild, urban, and game-farm mallards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!