Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Marsh harriers in the air are easiest to recognize by their long wings held in a shallow V as they fly low along the open space. They make large circles as they watch for prey, mostly gliding with occasional powerful wingbeats. Sometimes, they force water fowl to take cover under water so often that they become exhausted and are easily grabbed with their long legs. Although they also nest on the Wadden Islands, they go south for the winter, staying anywhere between the Flevopolders and Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

During the breeding season, pairs form which may last for a number of seasons. The spectacular courtship display involves the male flying in circles at a great height over the breeding area before falling close to the ground, performing elaborate sequences of tumbles. Occasionally the female may join him, and the pair lock talons and tumble through the air together. As the season progresses the male may be seen dropping food into the female's talons in mid-air (4). The nest, which may measure up to 80cm in diameter, is constructed on the ground with grass, reeds and sticks by the female. 3-8 eggs are laid from late April, and both parents contribute to feeding the chicks (2). Hunting occurs at a height of 2-6 meters above ground; when prey is located the bird suddenly drops down with its talons outstretched. Food taken includes small mammals and birds, carrion and sometimes insects, frogs and fish (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Marsh harriers are recognised as harriers by their long, narrow tails, long legs and wings held in a 'V' in flight. This species is the largest of the harriers and has broad, rounded wings. Members of the genus Circus possess an owl-like 'ruff' of facial feathers that disguises very large ear openings, which enable the bird to detect prey species by the noises they produce. The plumage colour is variable, but mainly brown. Females and immature individuals have creamy coloured crowns and throats; mature males have pale-grey wings with a dark brown body and wings. Calls include a lapwing-like mewing and a 'chattering' alarm call (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 48-56 cm, envergure 115-130 cm, poids 400-800 g.

C’est une espèce de plaine qui évite les zones forestières et montagneuses. L’habitat préférentiel est constitué d’eaux peu profondes envahies de grandes roselières ou typhaies. D’autres milieux tels que les tourbières, les champs irrigués, les prairies et cultures peuvent être utilisés, notamment comme terrains de chasse, lorsque les roselières sont insuffisantes.

L’espèce se nourrit surtout d’animaux terrestres et aquatiques tels que les petits rongeurs et oiseaux. Les cadavres et les animaux malades sont également consommés. La taille et la diversité des espèces dépendent des circonstances locales, la proie la plus facile étant préférée. La chasse se fait à faible hauteur (2 à 6 m), en utilisant la végétation au sol et les accidents de terrain pour surprendre les proies. Les captures sur l’eau sont rares.

Le Busard des roseaux est normalement un chasseur solitaire. Il peut migrer et dormir au sol en groupe. Le mâle est parfois bigame et peut même s’accoupler avec une 3e femelle. Toutefois, cette dernière est habituellement délaissée dès qu’il doit consacrer son temps aux premières nichées écloses. La reproduction est solitaire à semi-coloniale, le couple acceptant le voisinage d’autres nids à quelques dizaines de mètres. Le territoire du site de nid est faiblement marqué, seuls les abords immédiats étant défendus contre le passage d’individus de la même espèce. Lors des belles journées, le mâle cercle ou vole acrobatiquement à grande hauteur. Les parades en compagnie de la femelle, qui incluent de fausses attaques, ont lieu plus bas et à faible distance du site de nid. Le mâle nourrit la femelle dès le début de printemps et elle dépend entièrement de son approvisionnement pendant l’incubation et les premiers jours d’élevage des jeunes.

Le nid est un entassement important d’herbes, de roseaux et de rameaux qui atteint 50 à 80 cm de diamètre pour 25-30 cm de hauteur (voire plus s’il est situé au-dessus de l’eau). La femelle seule le construit, le mâle édifiant de faux nids et des plates-formes. La ponte de 3 à 8 œufs (max. 12) débute à la mi-avril. L’incubation dure de 31 à 38 jours par œuf, commençant avec le 1er, parfois le 2e ou le 3e. L’éclosion est asynchrone, sauf pour les premiers œufs qui peuvent éclore le même jour. Les jeunes explorent les environs du nid à l’âge de 1 mois et s’envolent une semaine plus tard.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"Circus aeruginosus, commonly called the Western Marsh Harrier or Eurasian Marsh Harrier, is a large bird of prey that resides in temperate and subtropical western Eurasia and adjacent Africa, but winters in the Indian subcontinent."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

"Distribution size (in km2): 13500000. Global range: West Central Palearctic, Africa, South East Asia. Indian subcontinent range: North Afghanistan, Sub-Himalayas from South East Afghanistan, Indus valley to Assam valley, South Assam hills (Meghalaya, Cachar, Manipur), Bangladesh, Peninsula, Sri Lanka, Maldives, South Andaman, Afghanistan, North West mountains, Ladakh, Lakshadweep"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

Not endemic.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

A scarce summer visitor to Britain, marsh harriers are also found in Europe, the Middle East, Central and northern Asia, and parts of Africa. In Britain the species mainly breeds in East Anglia, but can be seen on the south and east coast as far north as Scotland whilst it is migrating. It can also occasionally be seen in Wales and Ireland. Small numbers of individuals over-winter in East Anglia, Kent and south Wales (3). There are records of marsh harriers in Britain that date from the Iron Age, about 3000 years ago (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"The largest among Harriers, the Western Marsh Harrier has a characteristic owl-like ruff of facial feathers covering their large ear openings, broad rounded wings held in a V in flight, long narrow tails and long legs. Adult males are dark brown in colour with pale rufous head, neck and breast, and silvery-grey wings tipped with black and a silvery grey tail. Adult females and juveniles are dark chocolate brown in colour with creamy crowns and throats"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 54-59cm. Wingspan: 115 to 130 cm. Weight: 400 to 650 g in males and 500 to 800 g in females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"a) Circus aeruginosus aeruginosus (Linnaeus, 1758) - Europe and Asia Minor E into C Asia, E to upper R Yenisey and Mongolia; winters in W & S Europe, Africa S of Sahara, and in Indian Subcontinent and Sri Lanka - This species is widely migratory throughout its range. b) Circus aeruginosus harterti Zedlitz, 1914 - NW Africa, from Morocco to Tunisia - resident all year in north-west Africa."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Behaviour It is mainly migratory, with populations in Western Europe, North Africa and at the south of its range in Asia being generally resident (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Migrant birds leave their breeding grounds in September and October, wintering from France south as far as sub-Saharan Africa, and east as far as the Middle East (del Hoyo et al. 1994). They begin their return journey in February and March, arriving in March and April (del Hoyo et al. 1994, Snow and Perrins 1998, Ferguson-Lees and Christie 2001). Migration is generally on a broad front, although there is some concentration at a few sites (Brown et al. 1982). Hundreds of birds occasionally gather at roosting sites, sometimes with other harriers such as C. pygargus, but otherwise they are usually solitary, associating only temporarily at especially rich feeding sites (del Hoyo et al. 1994, Snow and Perrins 1998, Ferguson-Lees and Christie 2001). They have a slightly greater tendency to be gregarious while on migration but the above still generally applies. Birds fly c.10-30 m above the ground (Brown et al. 1982). Habitat The species inhabits extensive areas of dense marsh vegetation, in fresh or brackish water, generally in lowlands but up to 2,000 m in Asia and 3,000 m on its wintering grounds in Cameroon (del Hoyo et al. 1994). Diet It is a generalist predator taking a variety of prey types, with small birds generally preferred but mammals such as voles, rabbits and rats being more important in parts of its range (del Hoyo et al. 1994). Breeding site The nest is a pile of reeds built in dense marsh vegetation (del Hoyo et al. 1994). Management information The species requires extensive wetland in its breeding range (del Hoyo et al. 1994).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"A. Global: Habitat systems: Terrestrial; Freshwater; Marine. Forest Dependency: Does not normally occur in forest. Altitude: 0 - 3000 m. General Habitats: Wetlands (inland) - Seasonal/Intermittent/Irregular Rivers/Streams/Creeks, Bogs, Marshes, Swamps, Fens, Peatlands, Permanent Freshwater Lakes (over 8ha), Permanent Freshwater Marshes/Pools (under 8ha), Permanent Inland Deltas; Marine Intertidal - Salt Marshes (Emergent Grasses); Artificial/Terrestrial - Arable Land. Breeding Habitats: Artificial landscapes (terrestrial) - Arable land; Inland Wetlands - Bogs, marshes, swamps, fens, peatlands, Freshwater lakes (>8 ha) - permanent, Freshwater marshes/pools (<8 ha) - permanent, Inland deltas - permanent, Rivers, streams, creeks -seasonal/intermittent/irregular. B. Indian Subcontinent: Frequents marshes, jheels and flooded rice fields. Usually at elevations of up to 2000m in the hills."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.408 - 10.404
  Nitrate (umol/L): 1.335 - 5.632
  Salinity (PPS): 6.428 - 34.299
  Oxygen (ml/l): 6.341 - 7.967
  Phosphate (umol/l): 0.273 - 0.455
  Silicate (umol/l): 2.917 - 9.916

Graphical representation

Temperature range (°C): 9.408 - 10.404

Nitrate (umol/L): 1.335 - 5.632

Salinity (PPS): 6.428 - 34.299

Oxygen (ml/l): 6.341 - 7.967

Phosphate (umol/l): 0.273 - 0.455

Silicate (umol/l): 2.917 - 9.916
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Marsh harriers are usually associated with wetlands, as the common name would suggest (2). Breeding occurs amongst reeds or sedges, usually in large reed beds. However there are records of some individuals breeding in cereal fields, or within small areas of reeds located amongst arable land or saltmarsh. Hunting generally occurs over agricultural land or open habitat containing aquatic vegetation (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Full migrant. A widespread winter visitor throughout the Indian subcontinent.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Carnivores. Feeds on insects, fish, frogs, small birds, reptiles, mammals and carrion."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"500,000 - 2,000,000 mature individuals (2009)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Unlike other Hariers, it spends a considerable amount of time sitting on the ground or soaring in the sky. Flies leisurely for a few metres above marsh vegetation, occassionally dropping to the ground to seize prey. Calls include a lapwing-like mewing and a 'chattering' alarm call. A territorial bird in breeding season. Even in winters, it is less social than other Harriers, which often gather in large flocks. However, flocks of around 100 Western Marsh Harriers have been observed to roost together in Keoladeo National Park of Rajasthan (India) in November and December each year. They assemble in grasslands dominated by Desmostachya bipinnata and Vetiver (Chrysopogon zizanioides). When disturbed by humans, they may use floating carpets of Common Water Hyacinth (Eichhornia crassipes) instead."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum longevity: 20.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Not known to breed or nest in India.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Circus aeruginosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Circus aeruginosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACTTAATCTTCGGCGCTTGAGCCGGCATAGTCGGCACCGCCCTTAGCCTACTTATTCGCGCAGAACTTGGCCAACCAGGCACACTACTAGGTGATGATCAAATCTATAATGTAATCGTTACCGCACATGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTCGGGAACTGACTAGTCCCACTCATAATCGGCGCCCCCGACATAGCCTTCCCACGCATAAACAACATGAGCTTCTGACTACTTCCCCCATCTTTCCTCCTCCTATTAGCCTCCTCAACAGTAGAAGCAGGGGCTGGTACCGGATGAACTGTCTACCCCCCACTAGCCGGCAACATAGCCCATGCTGGCGCCTCAGTAGATTTAGCTATCTTCTCCCTACACCTAGCTGGAATCTCATCTATCCTAGGGGCAATTAACTTCATCACAACCGCTATTAACATAAAACCCCCAGCCCTCTCCCAATACCAAACACCCCTATTCGTATGATCTGTCCTCATTACTGCTGTCCTACTATTACTCTCTCTCCCAGTCCTTGCTGCTGGCATCACCATACTACTAACGGACCGAAACCTTAATACAACATTCTTTGACCCTGCCGGCGGAGGCGACCCTATCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAGGTCTACATCCTAATCCTGCCTGGATTCGGAATCATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Vorisek, P.

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over 10 years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in 10 years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Least Concern (ver 3.1) Year Published: 2009 Assessor/s: BirdLife International Reviewer/s: Bird, J., Butchart, S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor, winter visitor and resident breeder?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed under Annex 1 of EC Birds Directive; Appendix II of the Bern Convention and the Birds of Conservation Concern Red List. Protected in the UK under Schedule 1 of the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 93,000-140,000 breeding pairs, equating to 279,000-420,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 0.5-2 million individuals, although further validation of this estimate is needed.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unset
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Major threats include wetland desiccation and drainage; persecution by shooting; pollution, especially from excessive pesticide use in and around wetlands (although widespread bans have reduced this threat somewhat), and poisoning by heavy metals, notably the consumption of lead-shot through feeding on contaminated waterbirds (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). The historical threat of hunting in southern Europe has mostly subsided, but illegal shooting is still rife locally, notably on Malta (Ferguson-Lees and Christie 2001). The species is also highly vulnerable to the effects of potential wind energy development (Strix 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Past threats include drainage altred habitats, persecution by game keepers, and egg shell thinning by use of organochlorine pesticides like DDT. Current threats include shrinking marsh habitats, predation by foxes, poisoning and egg collecting, as well as disturbance of nesting sites."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The species underwent a decline in numbers in the 18th and 19th centuries due to the effects of habitat drainage and persecution for predating upon game species. The population declined to just a single pair between 1959 and 1971, mainly as a result of egg-shell thinning caused by organochloride pesticides such as DDT. After 1972 the population began to recover; in 1994 there were 129 pairs, and numbers have continued to increase. Current threats include the deliberate disturbance of nesting sites, egg collecting, illegal poisoning and predation by foxes. The small size of reedbed habitats may result in an increased impact of disturbance (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:No."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The marsh harrier will benefit from the protection and creation of reedbed habitat (2). Egg collecting, nest disturbance and illegal poisoning must be controlled. Prevention of scrub encroachment and the maintenance of suitable water levels will maintain appropriate habitat and deter foxes, the main predator. As this harrier nests in close association with intensive agricultural land, levels of pesticides must be monitored. Research is being conducted on the breeding biology, food and hunting behaviour of the species in Britain and the Netherlands (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western Marsh Harrier

The western marsh harrier (Circus aeruginosus) is a large harrier, a bird of prey from temperate and subtropical western Eurasia and adjacent Africa. It is also known as the Eurasian marsh harrier.

Formerly, a number of relatives were included in C. aeruginosus, which was then known as "marsh harrier". The related taxa are now generally considered to be separate species: the eastern marsh harrier (C. spilonotus) and the possibly distinct Papuan harrier (C. (s.) spilothorax) of eastern Asia and the Wallacea, the swamp harrier (C. approximans) of Australasia and the Madagascar marsh harrier (C. maillardi) of the western Indian Ocean islands.

The western marsh harrier is often divided into two subspecies, the widely migratory C. a. aeruginosus which is found across most of its range, and C. a. harterti which is resident all-year in north-west Africa.

Description[edit]

A fairly pale adult female (note brown remiges and yellow eye) winters near Hodal (Faridabad district, Haryana, India)

The western marsh harrier is 43 to 54 cm in length, and has a wingspan of 115 to 130 cm and a weight of 400 to 650 g in males and 500 to 800 g in females. It is a large, bulky harrier with fairly broad wings, and has a strong and peculiar sexual dichromatism. The male's plumage is mostly a cryptic reddish-brown with lighter yellowish streaks, which are particularly prominent on the breast. The head and shoulders are mostly pale greyish-yellowish. The rectrices and the secondary and tertiary remiges are pure grey, the latter contrasting with the brown forewing and the black primary remiges at the wingtips. The upperside and underside of the wing look similar, though the brown is lighter on the underwing. Whether from the side or below, flying males appear characteristically three-colored brown-grey-black. The legs, feet, irides and the cere of the black bill are yellow.

The female is almost entirely chocolate-brown. The top of the head, the throat and the shoulders have of a conspicuously lighter yellowish colour; this can be clearly delimited and very contrasting, or (particularly in worn plumage) be more washed-out, resembling the male's head colours. But the eye area of the female is always darker, making the light eye stand out, while the male's head is altogether not very contrastingly coloured and the female lacks the grey wing-patch and tail. Juveniles are similar to females, but usually have less yellow, particularly on the shoulders.

There is a rare hypermelanic morph with largely dark plumage. It is most often found in the east of the species' range. Juveniles of this morph may look entirely black in flight.

Distribution and ecology[edit]

The male is characterised by the very clear chestnut brown mantle and the grey secondaries and black outer primaries

This species has a wide breeding range from Europe and northwestern Africa to Central Asia and the northern parts of the Middle East. It breeds in almost every country of Europe but is absent from mountainous regions and subarctic Scandinavia. It is rare but increasing in Great Britain where it has spread as far as eastern Scotland.[2] In the Middle East there are populations in Turkey, Iraq, and Iran, while in Central Asia the range extends eastwards as far as north-west China, Mongolia, and the Lake Baikal region of Siberia.

Most populations of the western marsh harrier are migratory or dispersive. Some birds winter in milder regions of southern and western Europe, while others migrate to the Sahel, Nile basin and Great Lakes region in Africa, or to Arabia, the Indian subcontinent, and Myanmar. The all-year resident subspecies harterti inhabits Morocco, Algeria, and Tunisia.

Vagrants have reached Iceland, the Azores, Malaysia, and Sumatra. The first documented (but unconfirmed) record for the Americas was one bird reportedly photographed on 4 December 1994 at Chincoteague National Wildlife Refuge in Accomack County, Virginia. Subsequently, there were confirmed records from Guadeloupe (winter of 2002/2003) and from Laguna Cartagena National Wildlife Refuge in Puerto Rico (early 2004 and January/February 2006).[3]

The female usually is identifiable by the rather dark plumage except the creamy crown, nape, and throat

Like the other marsh harriers, it is strongly associated with wetland areas, especially those rich in common reed (Phragmites australis). It can also be met with in a variety of other open habitats, such as farmland and grassland, particularly where these border marshland. It is a territorial bird in the breeding season, and even in winter it seems less social than other harriers, which often gather in large flocks.[4] But this is probably simply due to habitat preferences, as the marsh harriers are completely allopatric while several of C. aeruginosus grassland and steppe relatives winter in the same regions and assemble at food sources such as locust outbreaks. Still, in Keoladeo National Park of Rajasthan (India) around 100 Eurasian marsh harriers are observed to roost together each November/December; they assemble in tall grassland dominated by Desmostachya bipinnata and vetiver (Chrysopogon zizanioides), but where this is too disturbed by human activity they will use floating carpets of common water hyacinth (Eichhornia crassipes) instead – the choice of such roost sites may be to give early warning of predators, which will conspicuously rustle through the plants if they try to sneak upon the resting birds[5]

It hunts in typical harrier fashion, gliding low over flat open ground on its search for prey, with its wings held in a shallow V-shape and often with dangling legs.

Diet[edit]

It feeds on small mammals, small birds, insects, reptiles, and frogs.[6][7]

Reproduction[edit]

The start of the breeding season varies from mid-March to early May. Western marsh harrier males often pair with two and occasionally three females. Pair bonds usually last for a single breeding season, but some pairs remain together for several years.

The ground nest is made of sticks, reeds and grasses. It is usually built in a reedbed, but the species will also nest in arable fields. There are between three and eight eggs in a normal clutch. The eggs are oval in shape and white in colour, with a bluish or greenish tinge when recently laid. The eggs are incubated for 31–38 days and the young birds fledge after 35–40 days.[citation needed]

Status and conservation[edit]

Wintering female hunting near Kolkata (West Bengal, India)
Western marsh harrier in Estonia

The western marsh harrier declined in many areas between the 19th and the late 20th centuries due to persecution, habitat destruction and excessive pesticide use. It is a now a protected species in many countries. Its numbers are rising again in many places, most notably perhaps in Great Britain, where a single breeding female was left in 1971, whereas today over 200 pairs are present.

It still faces a number of threats, including the shooting of birds migrating through the Mediterranean region. They are vulnerable to disturbance during the breeding season and also liable to lead shot poisoning. Still, the threats to this bird have been largely averted and it is today classified as Species of Least Concern by the IUCN.[1]

Footnotes[edit]

References[edit]

  • American Ornithologists' Union (AOU) (2000): Forty-second supplement to the American Ornithologists' Union Check-list of North American Birds. Auk 117(3): 847–858. DOI: 10.1642/0004-8038(2000)117[0847:FSSTTA]2.0.CO;2 PDF fulltext
  • Banks, Richard C.; Cicero, Carla; Dunn, Jon L.; Kratter, Andrew W.; Rasmussen, Pamela C.; Remsen, J.V. Jr.; Rising, James D. & Stotz, Douglas F. (2005): Forty-sixth supplement to the American Ornithologists' Union Check-list of North American Birds. Auk 122(3): 1026–1031. DOI: 10.1642/0004-8038(2005)122[1026:FSTTAO]2.0.CO;2 PDF fulltext
  • Clarke, R.; Prakash, V.; Clark, W.S.; Ramesh, N. & Scott, D. (1998): World record count of roosting harriers Circus in Blackbuck National Park, Velavadar, Gujarat, north-west India. Forktail 14: 70-71. PDF fulltext
  • Merkord, Christopher L.; Rodríguez, Rafy & Faaborg, John (2006): Second and third records of Western Marsh-Harrier (Circus aeruginosus) for the Western Hemisphere in Puerto Rico. Journal of Caribbean Ornithology 19(1): 42-44. PDF fulltext
  • Verma, Ashok (2002): A large roost of Eurasian Marsh Harriers Circus aeruginosus at Keoladeo National Park, Bharatpur, India. Forktail 18: 150-151. PDF fulltext

Further reading[edit]

  • Clarke, Roger (1995): The Marsh Harrier. Hamlyn, London.
  • Forsman, Dick (1999): The Raptors of Europe and The Middle East: a Handbook of Field Identification. T & A D Poyser, London.
  • Snow, David W. & Perrins, Christopher M. (eds.) (1998): The Birds of the Western Palearctic (Concise ed., Vol. 1). Oxford University Press. ISBN 0-19-854099-X
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!