Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range

Andes of Colombia to Tierra del Fuego and Falkland Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Circus cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACNTAATCTTCGGCGCTTGAGCTGGCATAGTCGGCACCGCCCTCAGCCTACTCATTCGCGCAGAACTCGGTCAACCAGGCACCCTTCTAGGTGATGATCAAATCTATAACGTAATCGTCACCGCACATGCCTTTGTAATAATTTTCTTCATAGTCATGCCAATCATAATCGGAGGCTTCGGAAACTGACTAGTCCCACTCATAATCGGCGCCCCTGACATGGCCTTCCCACGCATAAACAATATAAGCTTCTGACTACTACCCCCATCTTTCCTCCTCTTACTAGCCTCCTCAACAGTAGAAGCAGGAGCTGGTACCGGATGAACTGTTTACCCCCCATTAGCTGGCAACATAGCCCATGCTGGCGCCTCAGTAGACTTGGCTATCTTCTCCTTACATTTAGCTGGAGTCTCATCCATCCTAGGAGCAATTAACTTCATTACAACCGCTATTAACATAAAACCCCCAGCCCTCTCTCAATACCAAACACCCCTATTCGTATGATCTGTTCTCATTACTGCTGTCCTACTATTACTCTCACTTCCAGTCCTAGCTGCCGGCATCACCATACTACTAACGGACCGAAACCTTAATACAACATTCTTCGACCCTGCCGGCGGAGGCGATCCTATCCTATACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTTTATATCCTANNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Circus cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cinereous harrier

The cinereous harrier (Circus cinereus) is a South American bird of prey of the harrier family. Its breeding range extends from the Tierra del Fuego through Argentina and Chile to Bolivia, Paraguay, Peru and southern Brasil; and across the Andes north to Colombia. The bird's population is declining but due to its large range is not considered vulnerable.[2] The term cinereous, deriving from the Latin word for ashy, describes its colouration.[3]

Description[edit]

The male's plumage is dark grey above with black wingtips and a white rump. The underparts are pale grey, with a rufous streaked belly. The female's plumage is brown above, with a white rump, and cream coloured underneath, with a streaked belly similar to the males. The female is larger than the male with an average size of 46 cm (18 in) compared to the male's 40 cm (16 in). The wingspan is 90–115 cm (35–45 in). Since the 44.5 cm (17.5 in) tail comprises about 56% of this raptor's total length, this species ties with the long-tailed hawk as the raptor with the longest tail relative to its body size.[4]

Habitat and Ecology[edit]

This bird can be found in different open habitats, ranging from lowland marshes to the Andean Altiplano at a maximum altitude of 450 metres (1,480 ft). Like other harriers it nests on the ground. It is usually considered to be sedentary, and may migrate during April and May and returning to breeding grounds between September and October.[5]

Reproduction[edit]

During the breeding season, males and females engage in large aerial courtship displays and chatter very loudly. Eggs are laid in November and fledged by January. Nests are located in vegetation and up to 40 centimetres (16 in) across and 30 centimetres (12 in) deep.[6]

Diet[edit]

Its diet is variable, due to a wide range and variety of habitats. Its usual prey are small rodents and birds, notably chicks of coots and waders, reptiles, amphibians and insects.[7]

References[edit]

  1. ^ BirdLife International (2012). "Circus cinereus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ http://www.birdlife.org/datazone/speciesfactsheet.php?id=3408
  3. ^ http://www.arkive.org/cinereous-harrier/circus-cinereus/
  4. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  5. ^ Gould, J. and Darwin, C.R. (1839) Birds Part 3 No. 2 of The zoology of the voyage of H.M.S. Beagle. Smith Elder and Co
  6. ^ Ferguson-Lees, J. and Christie, D.A. (2001). Raptors of the World: An Identification Guide to the Birds of Prey of the World. New York: Houghton Mifflin. 
  7. ^ http://neotropical.birds.cornell.edu/portal/species/overview?p_p_spp=121916


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!