Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Biology

The pallid harrier preys on small mammals, birds and large insects. These include voles, mice and gerbils, larks and pipits, grasshoppers and locusts (2). It spends a large part of its day hunting (2), foraging over 20 kilometres from its roost (5). It flies low over the ground, dropping down to capture prey spotted on the ground (2). Tall grass provides valuable cover as the harrier steals up on flocks of larks feeding on the ground (5). The pallid harrier nests on its own, or in a loose group of three to five pairs. The nest is a pile of grass situated on the ground in meadows, scrub or swamps, protected by vegetation (5). Typically four to five eggs are laid in May and June (2), which are incubated for 30 days. Usually only two or three young survive to fledge at 35 to 40 days old. It is generally the female that incubates the eggs and broods the nestlings, while the male provides food for the chicks (5). In August and September, the pallid harriers leave their breeding grounds and undertake the great migration to their warmer wintering grounds (2). The European populations migrate mostly to Africa, whilst the Asian populations migrate both to East Africa and southern Asia (5). Here they will stay until March or April, when they begin the long journey back to the breeding areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This migratory bird of prey, like other harriers, has distinct male and female plumage. The pallid harrier male has very pale grey upperparts and is white below. In flight, the distinctive black wing tips can be seen (2). The female is brown, with a paler belly and a heavily marked breast and head (2). Young pallid harriers have colouration similar to the female, except with a rusty coloured underbody (2). The genus name of the pallid harrier, Circus, refers to the male's circling, acrobatic flight display, undertaken to impress a female during courtship (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"Circus macrourus, commonly called the Pallid Harrier, is a migratory medium-sized raptor that breeds in southern parts of eastern Europe and central Asia and winters mainly in India and southeast Asia."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

"Distribution size (in km2): 5840000. Global range: East Europe to Central Asia, Africa to South East Asia. Indian subcontinent range: South to East Afghanistan, sub-Himalayan region, Sri lanka, Maldives, South Andaman, Afghanistan, North West Himalayas, Lakshadweep."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

Not endemic.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Central Eurasia; winters to s Africa, India and Myanmar.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The pallid harrier's present breeding range extends from the Ukraine and southern Russia, to north-western China and western Mongolia (2) (5). Formerly, the breeding range used to be much greater, extending further into Eastern Europe (2). It winters mainly in sub-Saharan Africa, and from Pakistan, India and Sri Lanka, east to south China (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Slim winged and slender bodied Harrier. Adult males are pale ashy grey in colour, with a very pale grey head and underbody, grey upperparts, dark wedge on primaries, long narrow pointed black-tipped wings and a long white tail cross-barred with grey. Adult females brown, irregularly barred with strong head pattern, dark eye-stripe, owl-like ruff around head, dark ear coverts, pale collar, distinctive underwing pattern and pale primaries. Juveniles have narrow white supercilium, a broad pale collar, extensive dark-ear covert patches, unstreaked buff underparts and underwing coverts, even barring and a pale crescent base on underwing primaries. May also show a rusty breast band."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 46-51cm. Wingspan: 95–120 cm. Weight: 315 g in males and 445 g in females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

"Hen Harrier, Montagu's Harrier"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"A. Global: Landmass Type: Continent Habitat systems: Terrestrial; Freshwater. Forest Dependency: Low. Altitude: 0 - 4000 m. General Habitats: Forest - Boreal; Savanna - Dry; Grassland - Temperate, Subtropical/Tropical Dry; Wetlands (inland)- Bogs, Marshes, Swamps, Fens, Peatlands. Breeding Habitats: Forest - Boreal forest; Grassland - Subtropical/tropical (lowland) dry grassland, Temperate grassland. B. Indian subcontinent: Undulating plateaus, grassy hillsides, cultivation and semi-desert."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The pallid harrier breeds in grassy plains and dry steppe, often close to small rivers, lakes and marshlands (5). In winter it occupies similar habitat, but can also be found on unirrigated wheat fields, open woodland and mountain plateau, making occasional visits to marshes and rice paddies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Full migrant. Widespread winter visitor throughout India.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Carnivore. Feeds on grasshoppers, lizards, frogs, nestling or disabled birds as well as larks and pipits, small mammals like voles, mice and gerbils etc."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"18,000 - 30,000 mature individuals (2003)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"This solitary bird spends a large part of the day hunting, foraging to distances of 20km from its roost. Sailing gracefully over standing crops and grasslands, this bird scans the countryside tirelessly on outspread, nearly motionless wings and swoops down rapidly to pounce upon prey almost as soon as it sights its quarry. This bird prefers to perch on the ground instead of a bush or tree. Though it is belived to have a a call similar to that of C. pygargus and C. cyaneus, this bird is usually very quiet and is mostly silent in winter."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Not within Indian limits.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Circus macrourus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAATCTTCGGCGCTTGAGCTGGCATAGTCGGCACCGCCCTTAGCCTACTCATCCGCGCAGAACTTGGCCAACCGGGCACACTCCTAGGCGACGACCAAATCTACAATGTAATCGTCACCGCACATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTCGGAAACTGATTAGTCCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCGCGCATAAACAATATAAGCTTCTGACTGCTCCCTCCCTCTTTCCTCCTCCTACTAGCTTCCTCAACAGTGGAAGCAGGGGCTGGTACCGGATGAACTGTCTACCCCCCATTAGCTGGTAACATAGCCCACGCCGGTGCCTCAGTAGACCTGGCCATCTTCTCCTTACATCTAGCTGGAGTCTCATCCATCCTAGGAGCAATTAACTTTATTACAACCGCTATTAACATAAAACCCCCAGCCCTCTCTCAATACCAAACACCACTATTCGTATGATCTGTCCTCATTACTGCTGTCCTACTATTACTCTCACTCCCAGTCCTAGCTGCTGGCATCACCATACTACTAACGGACCGAAACCTTAATACAACATTCTTCGACCCTGCCGGCGGGGGCGATCCCATCTTATACCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Circus macrourus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

"Red List Category & Criteria: Near Threatened (ver 3.1) Year Published: 2008 Assessor/s: BirdLife International Reviewer/s: Taylor, J., Butchart, S., Pople, R., Burfield, I. Contributor/s: Corso, A., Murphy, P., Katzner, T., Hall, P., Simmons, R., Morozov, V., Pomeroy, D., Brouwer, J., Vintchevski, A., Tyler, S., Bragin, E."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) by the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Decreasing
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

"In breeding range, destruction and modification of habitat by humans for agriculture and pasture land. In wintering grounds, main threats include loss of grasslands due to human activity and use of harmful pesticides."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Globally, pallid harrier populations are drastically declining (2), particularly in Europe, where numbers declined by up to 30 percent from 1970 to 1990 and the species continued to decline from 1990 to 2000 (6). The declines are so significant that the pallid harrier no longer occurs in Moldova, Belarus and Romania, where it used to breed (2) (6). In the past, harrier populations were reduced by persecution as 'vermin' and the extensive use of pesticides and rodenticides (5). Over the last 10 to 20 years, persecution and use of damaging chemicals has decreased in its breeding range, but the use of harmful pesticides, rodenticides and other toxic chemicalscontinues in many parts of the winter range (5). Possibly the greatest threat to the pallid harrier at present is the conversion of grasslands to agricultural land, and degradation of grasslands by burning, cutting and overgrazing. This is occurring throughout the range of the pallid harrier, destroying vital breeding, roosting and foraging habitat (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:No."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The pallid harrier is listed as a Species of European Conservation Concern Category 3, Appendix II of the Convention on International Trade in Endangered Species (CITES), Annex II of the Bonn and Bern Conventions, and Annex I of the EU Birds Directive. However, despite the number of lists it appears on, the pallid harrier remains rare, poorly studied and declining (5). In 2003, an International Action Plan for the pallid harrier was developed, with the aim of conserving the bird, and promoting population recovery to a level at which it no longer qualifies for Near Threatened (5). This has led to the proposal of numerous conservation actions, including encouraging conservation of grasslands, carrying out surveys and research on the pallid harrier, and lobbying for legislation that bans the use of harmful pesticides in its winter range (5). The pallid harrier now requires definite action, rather than any further listings, plans or proposals, to ensure its future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pallid harrier

The pale or pallid harrier (Circus macrourus) is a migratory bird of prey of the harrier family. It breeds in southern parts of eastern Europe and central Asia (such as Iran) and winters mainly in India and southeast Asia. It is a very rare vagrant to Great Britain and western Europe, although remarkably a juvenile wintered in Norfolk in the winter of 2002/2003.

This medium-sized raptor breeds on open plains, bogs and heathland. In winter it is a bird of open country.

Circus macrourus.jpg

Description[edit]

Egg, Collection Museum Wiesbaden

This is a typical harrier, with long wings held in a shallow V in its low flight. It also resembles other harriers in having distinct male and female plumages. Adults measure 40–48 cm (16–19 in) long with a wingspan of 95–120 cm (37–47 in). Males weigh 315 g (11.1 oz) while the slightly larger females weigh 445 g (15.7 oz). The male is whitish grey above and white below, with narrow black wingtips. It differs from the hen harrier in its smaller size, narrower wings, paler colour, and different wing tip pattern. The female is brown above with white upper tail coverts, hence females and the similar juveniles are often called "ringtails". Her underparts are buff streaked with brown. It is best distinguished from the female hen harrier on structure. It is very similar to the female Montagu's harrier, but has darker and more uniform secondaries from below.

Circus pygargus juvenile in flight at little rann of kutch.jpg

Diet[edit]

Pallid harriers hunt small mammals, lizards and birds, surprising them as they drift low over fields and moors.

The nest of this species is on the ground. Four to six whitish eggs are laid.

References[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!