Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Biology

The pallid harrier preys on small mammals, birds and large insects. These include voles, mice and gerbils, larks and pipits, grasshoppers and locusts (2). It spends a large part of its day hunting (2), foraging over 20 kilometres from its roost (5). It flies low over the ground, dropping down to capture prey spotted on the ground (2). Tall grass provides valuable cover as the harrier steals up on flocks of larks feeding on the ground (5). The pallid harrier nests on its own, or in a loose group of three to five pairs. The nest is a pile of grass situated on the ground in meadows, scrub or swamps, protected by vegetation (5). Typically four to five eggs are laid in May and June (2), which are incubated for 30 days. Usually only two or three young survive to fledge at 35 to 40 days old. It is generally the female that incubates the eggs and broods the nestlings, while the male provides food for the chicks (5). In August and September, the pallid harriers leave their breeding grounds and undertake the great migration to their warmer wintering grounds (2). The European populations migrate mostly to Africa, whilst the Asian populations migrate both to East Africa and southern Asia (5). Here they will stay until March or April, when they begin the long journey back to the breeding areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This migratory bird of prey, like other harriers, has distinct male and female plumage. The pallid harrier male has very pale grey upperparts and is white below. In flight, the distinctive black wing tips can be seen (2). The female is brown, with a paler belly and a heavily marked breast and head (2). Young pallid harriers have colouration similar to the female, except with a rusty coloured underbody (2). The genus name of the pallid harrier, Circus, refers to the male's circling, acrobatic flight display, undertaken to impress a female during courtship (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"Circus macrourus, commonly called the Pallid Harrier, is a migratory medium-sized raptor that breeds in southern parts of eastern Europe and central Asia and winters mainly in India and southeast Asia."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Circus macrourus breeds primarily in the steppes of Asiatic Russia, Kazakhstan and north-west China. Small populations breed in Azerbaijan, Romania, Turkey and Ukraine. A minority winter in south-east and central Europe, north Africa and the Middle East but most migrate to the Afrotropics (Sudan, South Sudan, Eritrea, Djibouti, Ethiopia, Somalia, Kenya, Uganda, Rwanda, Burundi, Tanzania, Malawi, Zambia, Zimbabwe, Mozambique, Chad, Niger, Mali, Senegal, Gambia, Sierra Leone, Guinea-Bissau, Liberia, Ivory Coast, Ghana, Togo, Benin, Burkina Faso, Nigeria, Cameroon, Central African Republic, Democratic Republic of Congo, Angola, Namibia, Botswana, Swaziland and South Africa) and the Indian subcontinent (Afghanistan, Pakistan, India, Sri Lanka, Nepal, Bangladesh and Myanmar) (Thiollay 1994). There are also records from the Maldives. In 2007, six pairs bred in the Moscow region for the very first time(A. Vintchevski in litt. 2007). The global population is estimated at 9,000-15,000 pairs (Galushin et al. 2003), and has shown marked declines and range contractions. The status of the European population (310-1,200 pairs in Azerbaijan, Romania, Turkey, Ukraine and western Russia, occupying 25-49% of the global breeding range) was recently reassessed (Galushin et al. 2003; BirdLife International 2004a). Following a large decline in Europe during 1970-1990 (Tucker and Heath 1994), when up to 30% of birds were lost (particularly from the key population in European Russia), the species continued to decline in 1990-2000, and overall trends exceeded 30% over three generations (18 years) (BirdLife International 2004a). It appears that the species has been extirpated from Moldova and Belarus, where it bred formerly (Galushin et al. 2003, BirdLife International 2004a). In Asia, however, the population is presumed to be more stable. Surveys in the Kustanay Oblast region (northern Kazakhstan) from 1997 to 2004 indicate a fluctuating but ostensibly stable population of 1,500-2,000 pairs, nesting at a density of 9.4-25 pairs per 100 km2 (Bragin 1999, E. Bragin in litt. 2005). No other detailed surveys are known from the species's Asiatic range, although anecdotal evidence from southern Kazakhstan (Almaty to Chockpack Bird Station) suggests that it is locally abundant(A. Corso in litt. 2005). Assessment of the status of this species is complicated by the fact that on breeding territories numbers fluctuate in response to environmental conditions, probably numbers of small mammals. Thus, high or low numbers in any given year or two-year period may be indicative of change in demographics or they may be indicative of change in local environment (and birds may go elsewhere without their population size changing) (T. Katzner in litt. 2005). Reliable records from migration routes and wintering grounds are also difficult to obtain owing to the rarity of the species, its broad-front migration strategy, and difficulties in field identification, although important concentrations of birds have been identified in parts of India and Africa (Galushin et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Distribution size (in km2): 5840000. Global range: East Europe to Central Asia, Africa to South East Asia. Indian subcontinent range: South to East Afghanistan, sub-Himalayan region, Sri lanka, Maldives, South Andaman, Afghanistan, North West Himalayas, Lakshadweep."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

Not endemic.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Central Eurasia; winters to s Africa, India and Myanmar.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The pallid harrier's present breeding range extends from the Ukraine and southern Russia, to north-western China and western Mongolia (2) (5). Formerly, the breeding range used to be much greater, extending further into Eastern Europe (2). It winters mainly in sub-Saharan Africa, and from Pakistan, India and Sri Lanka, east to south China (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Slim winged and slender bodied Harrier. Adult males are pale ashy grey in colour, with a very pale grey head and underbody, grey upperparts, dark wedge on primaries, long narrow pointed black-tipped wings and a long white tail cross-barred with grey. Adult females brown, irregularly barred with strong head pattern, dark eye-stripe, owl-like ruff around head, dark ear coverts, pale collar, distinctive underwing pattern and pale primaries. Juveniles have narrow white supercilium, a broad pale collar, extensive dark-ear covert patches, unstreaked buff underparts and underwing coverts, even barring and a pale crescent base on underwing primaries. May also show a rusty breast band."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 46-51cm. Wingspan: 95–120 cm. Weight: 315 g in males and 445 g in females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

"Hen Harrier, Montagu's Harrier"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It breeds in semi-desert, steppe and forest-steppe up to 2,000 m, where its favoured nesting sites are wet grasslands close to small rivers and lakes, and marshlands (Galushin et al. 2003, Snow and Perrins 1998). The species has also been found to breed in agricultural areas, at least when agriculture is non-intensive (Terraube et al. 2009). A small minority of the population breeds in the boreal forest and forest-tundra zones, north of its main breeding range (Kuznetsov 1994; Morozov in litt. 1999), where it nests in clearings and other open areas (Galushin et al. 2003). Semi-desert, scrub, savanna and wetlands are used in winter (J. Brouwer in litt.). The species is migratory, with most birds wintering in sub-Saharan Africa or south-east Asia. They leave their breeding grounds between August and November and return in March and April (del Hoyo et al. 1994). Birds migrate on a broad front, with only minor concentrations at bottleneck sites (del Hoyo et al. 1994, Ferguson-Lees and Christie 2001). Although birds are most often seen singly, females and juveniles can form parties of 10-15 on migration (Snow and Perrins 1998, Ferguson-Lees and Christie 2001). Birds fly at c.1-9 m above the ground when hunting (del Hoyo et al. 1994, Snow and Perrins 1998); they fly generally higher on migration but tend to remain from c.1-15 m above the ground (Brown et al. 1982).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"A. Global: Landmass Type: Continent Habitat systems: Terrestrial; Freshwater. Forest Dependency: Low. Altitude: 0 - 4000 m. General Habitats: Forest - Boreal; Savanna - Dry; Grassland - Temperate, Subtropical/Tropical Dry; Wetlands (inland)- Bogs, Marshes, Swamps, Fens, Peatlands. Breeding Habitats: Forest - Boreal forest; Grassland - Subtropical/tropical (lowland) dry grassland, Temperate grassland. B. Indian subcontinent: Undulating plateaus, grassy hillsides, cultivation and semi-desert."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The pallid harrier breeds in grassy plains and dry steppe, often close to small rivers, lakes and marshlands (5). In winter it occupies similar habitat, but can also be found on unirrigated wheat fields, open woodland and mountain plateau, making occasional visits to marshes and rice paddies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Full migrant. Widespread winter visitor throughout India.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Carnivore. Feeds on grasshoppers, lizards, frogs, nestling or disabled birds as well as larks and pipits, small mammals like voles, mice and gerbils etc."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"18,000 - 30,000 mature individuals (2003)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"This solitary bird spends a large part of the day hunting, foraging to distances of 20km from its roost. Sailing gracefully over standing crops and grasslands, this bird scans the countryside tirelessly on outspread, nearly motionless wings and swoops down rapidly to pounce upon prey almost as soon as it sights its quarry. This bird prefers to perch on the ground instead of a bush or tree. Though it is belived to have a a call similar to that of C. pygargus and C. cyaneus, this bird is usually very quiet and is mostly silent in winter."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Not within Indian limits.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Circus macrourus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAATCTTCGGCGCTTGAGCTGGCATAGTCGGCACCGCCCTTAGCCTACTCATCCGCGCAGAACTTGGCCAACCGGGCACACTCCTAGGCGACGACCAAATCTACAATGTAATCGTCACCGCACATGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGAGGCTTCGGAAACTGATTAGTCCCACTCATAATCGGCGCCCCCGATATAGCCTTCCCGCGCATAAACAATATAAGCTTCTGACTGCTCCCTCCCTCTTTCCTCCTCCTACTAGCTTCCTCAACAGTGGAAGCAGGGGCTGGTACCGGATGAACTGTCTACCCCCCATTAGCTGGTAACATAGCCCACGCCGGTGCCTCAGTAGACCTGGCCATCTTCTCCTTACATCTAGCTGGAGTCTCATCCATCCTAGGAGCAATTAACTTTATTACAACCGCTATTAACATAAAACCCCCAGCCCTCTCTCAATACCAAACACCACTATTCGTATGATCTGTCCTCATTACTGCTGTCCTACTATTACTCTCACTCCCAGTCCTAGCTGCTGGCATCACCATACTACTAACGGACCGAAACCTTAATACAACATTCTTCGACCCTGCCGGCGGGGGCGATCCCATCTTATACCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Circus macrourus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Bragin, E., Brouwer, J., Corso, A., Hall, P., Katzner, T., Morozov, V., Murphy, P., Pomeroy, D., Simmons, R., Tyler, S. & Vintchevski, A.

Justification
This species is known to be undergoing steep population decline in Europe, although numbers in its Asiatic strongholds are thought to be more stable. Thus it is probably experiencing a moderately rapid population decline overall, and consequently it is categorised as Near Threatened.


History
  • 2012
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Near Threatened (ver 3.1) Year Published: 2008 Assessor/s: BirdLife International Reviewer/s: Taylor, J., Butchart, S., Pople, R., Burfield, I. Contributor/s: Corso, A., Murphy, P., Katzner, T., Hall, P., Simmons, R., Morozov, V., Pomeroy, D., Brouwer, J., Vintchevski, A., Tyler, S., Bragin, E."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) by the IUCN Red List 2006 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated at 9,000-15,000 pairs.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Decreasing
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In its breeding range it is primarily threatened by the destruction and degradation of steppe grasslands through conversion to arable agriculture, burning of vegetation, intensive grazing of wet pastures and the clearance of shrubs and tall weeds (Galushin et al. 2003, E. Bragin in litt. 2007). Fires are started by farmers, arsonists and dry thunderstorms(E. Bragin in litt. 2007). On its wintering grounds it is thought to be negatively affected by the use of harmful pesticides, rodenticides and other toxic chemicals (R. Simmons in litt. 1999; Galushin et al. 2003), although this requires further research, and by the loss of grassland due to burning, cutting and overgrazing (Galushin et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"In breeding range, destruction and modification of habitat by humans for agriculture and pasture land. In wintering grounds, main threats include loss of grasslands due to human activity and use of harmful pesticides."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Globally, pallid harrier populations are drastically declining (2), particularly in Europe, where numbers declined by up to 30 percent from 1970 to 1990 and the species continued to decline from 1990 to 2000 (6). The declines are so significant that the pallid harrier no longer occurs in Moldova, Belarus and Romania, where it used to breed (2) (6). In the past, harrier populations were reduced by persecution as 'vermin' and the extensive use of pesticides and rodenticides (5). Over the last 10 to 20 years, persecution and use of damaging chemicals has decreased in its breeding range, but the use of harmful pesticides, rodenticides and other toxic chemicalscontinues in many parts of the winter range (5). Possibly the greatest threat to the pallid harrier at present is the conversion of grasslands to agricultural land, and degradation of grasslands by burning, cutting and overgrazing. This is occurring throughout the range of the pallid harrier, destroying vital breeding, roosting and foraging habitat (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) India Listed Species:Yes. Appendix:II. CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora) Global Listed Species:Yes. Appendix:II. AEWA (Agreement on the Conservation of African-Eurasian Migratory Waterbirds) Listed Species:Yes. Appendix:II. IWPA (Indian Wildlife Protection Act, 1972) Listed Species:No."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
It is listed in Appendix II of CITES, Annex II of the Bonn and Bern Conventions and in Annex I of the EU Birds Directive. It is also listed in the Red Data Books of Belarus, Ukraine, Russia and Turkey (Galushin et al. 2003; Kiliç and Eken 2004). It occurs in five state nature reserves in Russia and in Naurzum and Korgaljin Nature Reserves in Kazakhstan (Galushin et al. 2003). An International Action Plan for the species was produced in 2003 (Galushin et al. 2003).

Conservation Actions Proposed
Encourage conservation of wetlands and ponds in typical steppe grassland and semi-desert. Support moderate grazing and conservation of grasslands. Develop survey methodology (including GIS) and carry out surveys, primarily in the core breeding range and, secondarily, to establish its northern and southern range limits as well as to search for new nesting places outside core breeding grounds. Carry out research into diet and foraging range size, and their role in the movement of populations. Lobby for enactment and enforcement of legislation banning the use of harmful pesticides in the winter range, and in the recovering agricultural economy in the breeding range. Survey grassland and thorn-forest areas in African and Indian winter range for significant roosting concentrations, including tracking birds by means of satellite telemetry as soon as feasible. Review roost site and catchment area management at winter roosts, most urgently in areas where agriculture is changing due to new irrigation schemes, and pursue any necessary conservation action. Carry out research into pesticide residues in corpses, and pesticide use in winter roost catchment areas. Encourage full legal protection and education in countries on migration routes and in the winter range (Galushin et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The pallid harrier is listed as a Species of European Conservation Concern Category 3, Appendix II of the Convention on International Trade in Endangered Species (CITES), Annex II of the Bonn and Bern Conventions, and Annex I of the EU Birds Directive. However, despite the number of lists it appears on, the pallid harrier remains rare, poorly studied and declining (5). In 2003, an International Action Plan for the pallid harrier was developed, with the aim of conserving the bird, and promoting population recovery to a level at which it no longer qualifies for Near Threatened (5). This has led to the proposal of numerous conservation actions, including encouraging conservation of grasslands, carrying out surveys and research on the pallid harrier, and lobbying for legislation that bans the use of harmful pesticides in its winter range (5). The pallid harrier now requires definite action, rather than any further listings, plans or proposals, to ensure its future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pallid harrier

The pale or pallid harrier (Circus macrourus) is a migratory bird of prey of the harrier family. It breeds in southern parts of eastern Europe and central Asia (such as Iran) and winters mainly in India and southeast Asia. It is a very rare vagrant to Great Britain and western Europe, although remarkably a juvenile wintered in Norfolk in the winter of 2002/3.

This medium-sized raptor breeds on open plains, bogs and heathland. In winter it is a bird of open country.

Pallid harrier roosting in Little Rann of Kutch, India

Description[edit]

This is a typical harrier, with long wings held in a shallow V in its low flight. It also resembles other harriers in having distinct male and female plumages. Adults measure 40–48 cm long with a wingspan of 95–120 cm. Males weigh 315 g while the slightly larger females weigh 445 g. The male is whitish grey above and white below, with narrow black wingtips. It differs from the hen harrier in its smaller size, narrower wings, pale colour different wing tip pattern.

The female is brown above with white upper tail coverts, hence females and the similar juveniles are often called "ringtails". Her underparts are buff streaked with brown. It is best distinguished from the female hen harrier on structure. It is very similar to the female Montagu's harrier, but has darker and more uniform secondaries from below.

Pallid harrier female in flight at Little Rann of Kutch, India

Diet[edit]

Pallid harriers hunt small mammals, lizards and birds, surprising them as they drift low over fields and moors.

The nest of this species is on the ground. Four to six whitish eggs are laid.

References[edit]

  1. ^ "Iran's Birds - Pallid Harrier". Iran deserts. Retrieved March 2, 2013. 
  2. ^ BirdLife International (2013). "Circus macrourus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 

Further reading[edit]

Identification

Forsman, Dick (1995) Field identification of female and juvenile Montagu's and Pallid Harriers Dutch Birding 17(2): 41-54

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!