Overview

Brief Summary

Biology

White-backed vultures are scavengers, feeding on the soft muscle, organ tissue and bone fragments of large carcasses (2). With their large, broad wings they can soar and circle for hours as they search for carrion (6), sometimes following ungulates as they undertake their regular migrations (5). Their excellent eyesight enables them to spot food from high in the air, and they also keep an eye on other vultures, quickly following if they see another making a sudden descent (6). Up to 200 white-backed vultures can gather at a carcass; an enormous elephant carcass may even attract a thousand (2). With so many birds trying to feed, fights are inevitable (4). Accompanied with grunts and goose-like hisses and cackles (4), the scrum of vultures can be seen inserting their long, bare necks under the skin of the carcass or crawling into the ribcage as they feed on the dead remains (2). After gorging themselves, the vultures may bathe together with other species at a favourite site, or rest with their wings spread and backs to the sun (4). White-backed vultures breed at the start of the dry season, nesting in loose colonies of 2 to 13 birds. The nest is a platform of sticks, lined with grass and green leaves, situated in the crown or fork of a large tree. Generally a single egg is laid, which is incubated for 56 days. The pale grey chick is fed by both parents until they fledge at 120 to 130 days of age (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This is Africa's most common large vulture (4), an accomplished scavenger that feeds on the carcasses of Africa's large animals. Its plumage is dark brown with black skin on the neck and head, making the white lower-back, for which it is named, even more prominent (2). The white-backed vulture has black eyes and a strong, slightly hooked black bill, contrasting with its pale crown and hindneck (4). As they age, the plumage of white-backed vultures becomes paler and plainer, especially the female's; conversely, juveniles are darker, with lighter brown streaks on their feathers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is the most widespread and common vulture in Africa, although it is now undergoing rapid declines. It occurs from Senegal, Gambia and Mali in the west, throughout the Sahel region to Ethiopia and Somalia in the east, through East Africa into Mozambique, Zimbabwe, Botswana, Namibia and South Africa in the south. Its global population has been estimated at 270,000 individuals. Consistent with other vulture species, it has declined by over 90% in West Africa (J. M. Thiollay in litt. 2006), and it has largely disappeared from Ghana apart from Mole National Park (F. Dowsett-Lemaire in litt. 2011), Niger (no records away from W National Park since 1997, J. Brouwer in litt. 2012) and Nigeria (no sightings in 2011 in last stronghold of Yankari Game Reserve, nor anywhere else, and possibly extirpated from the country, P. Hall in ltt. 2011). The species has also declined in Sudan and South Sudan (Nikolaus 2006), Somalia (A. Jama in litt. 2011) and Kenya (c.52% declines in Masai Mara over c.15 years, M. Virani in litt. 2006, Virani et al. 2011), but is apparently more stable in Ethiopia (Nikolaus 2006), Tanzania (D. Peterson in litt. 2006), Uganda (short-term increases [Pomeroy et al. 2012]) and across southern Africa where an estimated 40,000 individuals remain (R. Simmons in litt. 2006). An ongoing study near Kimberley, South Africa, shows the number of breeding pairs has increased by 72% in 22 years (from 50 to 86 breeding pairs) (A. Anthony in litt. 2015). However McKean et al. (2013) suggest that if current levels of exploitation continue in South Africa, the species could become locally extinct by 2034 or sooner.Overall it is suspected to have declined very rapidly.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sub-Saharan Africa: all S of Sahara south to N Namibia, N South Africa except forest area.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Supplier: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Open plains and savanna of Africa south of the Sahara.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Ranges from Mauritania, east to Ethiopia, and south through East Africa to South Africa (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A medium-sized, brownish vulture

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, BirdLife International

Supplier: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

All dark bill and marked contrast between the underwing-coverts and flight feathers from below.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, BirdLife International

Supplier: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Primarily a lowland species of open wooded savanna, particularly areas of Acacia. It requires tall trees for nesting. However it has also been recorded nesting on electricity pylons in South Africa (de Swardt 2013). A gregarious species congregating at carcasses, in thermals and at roost sites. It nests in loose colonies.


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Savannas

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Supplier: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The white-backed vulture inhabits open savanna and wooded country with game animals and livestock, up to 3,000 metres above sea level (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Movements and dispersal

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Supplier: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gyps africanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATACCTAATCTTCGGCGCTTGAGCTGGCATAGTCGGCACTGCTCTCAGCCTTCTCATCCGTGCAGAACTCGGTCAGCCAGGCACTCTCCTAGGCGATGACCAAATCTACAACGTAGTCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTCGTTCCACTTATAATTGGTGCTCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTTCTCCTACTAGCCTCCTCAACAGTGGAAGCAGGGGCTGGTACAGGATGAACCGTCTACCCCCCACTAGCCGGCAACATAGCCCATGCTGGAGCCTCAGTAGACTTAGCCATCTTCTCCCTACACCTAGCAGGGATCTCATCTATTCTAGGAGCAATCAACTTCATCACCACAGCCATTAACATAAAACCACCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGGTCTGTCCTCATTACCGCAGTCCTACTACTACTCTCACTCCCCGTCTTAGCCGCTGGCATCACTATACTACTTACAGACCGAAACCTCAACACAACGTTCTTCGATCCCGCCGGAGGAGGTGACCCAGTTCTATACCAACACCTCTTCTGATTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gyps africanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bcd+3bcd+4bcd

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Symes, A.

Contributor/s
Baker, N., Barlow, C., Bowden, C., Genero, F., Hancock, P., Millington, L., Ndang'ang'a, P., Peterson, D., Pomeroy, D., Simmons, R., Thiollay, J., Thomsett, S., Virani, M., Scott, M., Buij, R., Ogada, D., Jama, A., Roxburgh, L., Dowsett-Lemaire, F., Hall, P., Scott, A., Kendall, C., Brouwer, J., Anthony, A., Mhlanga, W., Goodwin, W., Rainey, H. & Mundy, P.

Justification
This species has declined severely in parts of its range and overall it is suspected to have undergone a very rapid decline owing to habitat loss and conversion to agro-pastoral systems, declines in wild ungulate populations, hunting for trade, persecution, collisions and poisoning. These declines are likely to continue into the future. Recently published data suggests these declines are even more serious than previously thought. For this reason it has been uplisted to Critically Endangered.


History
  • 2012
    Endangered (EN)
  • Near Threatened (NT)
  • Near Threatened (NT)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5