Overview

Brief Summary

Biology

White-backed vultures are scavengers, feeding on the soft muscle, organ tissue and bone fragments of large carcasses (2). With their large, broad wings they can soar and circle for hours as they search for carrion (6), sometimes following ungulates as they undertake their regular migrations (5). Their excellent eyesight enables them to spot food from high in the air, and they also keep an eye on other vultures, quickly following if they see another making a sudden descent (6). Up to 200 white-backed vultures can gather at a carcass; an enormous elephant carcass may even attract a thousand (2). With so many birds trying to feed, fights are inevitable (4). Accompanied with grunts and goose-like hisses and cackles (4), the scrum of vultures can be seen inserting their long, bare necks under the skin of the carcass or crawling into the ribcage as they feed on the dead remains (2). After gorging themselves, the vultures may bathe together with other species at a favourite site, or rest with their wings spread and backs to the sun (4). White-backed vultures breed at the start of the dry season, nesting in loose colonies of 2 to 13 birds. The nest is a platform of sticks, lined with grass and green leaves, situated in the crown or fork of a large tree. Generally a single egg is laid, which is incubated for 56 days. The pale grey chick is fed by both parents until they fledge at 120 to 130 days of age (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This is Africa's most common large vulture (4), an accomplished scavenger that feeds on the carcasses of Africa's large animals. Its plumage is dark brown with black skin on the neck and head, making the white lower-back, for which it is named, even more prominent (2). The white-backed vulture has black eyes and a strong, slightly hooked black bill, contrasting with its pale crown and hindneck (4). As they age, the plumage of white-backed vultures becomes paler and plainer, especially the female's; conversely, juveniles are darker, with lighter brown streaks on their feathers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Gyps africanus is the most widespread and common vulture in Africa, although it is now undergoing rapid declines. It occurs from Senegal, Gambia and Mali in the west, throughout the Sahel region to Ethiopia and Somalia in the east, through East Africa into Mozambique, Zimbabwe, Botswana, Namibia and South Africa in the south. Its global population has been estimated at 270,000 individuals. Consistent with other vulture species, it has declined by over 90% in West Africa (J. M. Thiollay in litt. 2006), and it has largely disappeared from Ghana apart from Mole National Park (F. Dowsett-Lemaire in litt. 2011), Niger (no records away from W National Park since 1997, J. Brouwer in litt. 2012) and Nigeria (no sightings in 2011 in last stronghold of Yankari Game Reserve, nor anywhere else, and possibly extirpated from the country, P. Hall in ltt. 2011). The species has also declined in Sudan and South Sudan (Nikolaus 2006), Somalia (A. Jama in litt. 2011) and Kenya (c.52% declines in Masai Mara over c.15 years, M. Virani in litt. 2006, Virani et al. 2011), but is apparently more stable in Ethiopia (Nikolaus 2006), Tanzania (D. Peterson in litt. 2006), and across southern Africa where an estimated 40,000 individuals remain (R. Simmons in litt. 2006). Nevertheless, it is suspected to have declined very rapidly overall.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Open plains and savanna of Africa south of the Sahara.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sub-Saharan Africa: all S of Sahara south to N Namibia, N South Africa except forest area.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Ranges from Mauritania, east to Ethiopia, and south through East Africa to South Africa (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A medium-sized, brownish vulture

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, BirdLife International

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

All dark bill and marked contrast between the underwing-coverts and flight feathers from below.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, BirdLife International

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Primarily a lowland species of open wooded savanna, particularly areas of Acacia. It requires tall trees for nesting. A gregarious species congregating at carcasses, in thermals and at roost sites. It nests in loose colonies.


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Savannas

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The white-backed vulture inhabits open savanna and wooded country with game animals and livestock, up to 3,000 metres above sea level (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Movements and dispersal

Resident

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Lack 2010

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.7 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gyps africanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATACCTAATCTTCGGCGCTTGAGCTGGCATAGTCGGCACTGCTCTCAGCCTTCTCATCCGTGCAGAACTCGGTCAGCCAGGCACTCTCCTAGGCGATGACCAAATCTACAACGTAGTCGTCACCGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTCGTTCCACTTATAATTGGTGCTCCCGACATAGCCTTTCCACGCATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTTCTCCTACTAGCCTCCTCAACAGTGGAAGCAGGGGCTGGTACAGGATGAACCGTCTACCCCCCACTAGCCGGCAACATAGCCCATGCTGGAGCCTCAGTAGACTTAGCCATCTTCTCCCTACACCTAGCAGGGATCTCATCTATTCTAGGAGCAATCAACTTCATCACCACAGCCATTAACATAAAACCACCTGCCCTCTCCCAATACCAAACACCCCTATTCGTATGGTCTGTCCTCATTACCGCAGTCCTACTACTACTCTCACTCCCCGTCTTAGCCGCTGGCATCACTATACTACTTACAGACCGAAACCTCAACACAACGTTCTTCGATCCCGCCGGAGGAGGTGACCCAGTTCTATACCAACACCTCTTCTGATTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gyps africanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+3bcd+4bcd

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Baker, N., Barlow, C., Bowden, C., Genero, F., Hancock, P., Millington, L., Ndang'ang'a, P., Peterson, D., Pomeroy, D., Simmons, R., Thiollay, J., Thomsett, S., Virani, M., Scott, M., Buij, R., Ogada, D., Jama, A., Roxburgh, L., Dowsett-Lemaire, F., Hall, P., Scott, A., Kendall, C. & Brouwer, J.

Justification
This species has declined severely in parts of its range and overall it is suspected to have undergone a very rapid decline owing to habitat loss and conversion to agro-pastoral systems, declines in wild ungulate populations, hunting for trade, persecution, collisions and poisoning. These declines are likely to continue into the future. For this reason it has been uplisted to Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 2011, BirdLife International

Source: Afrotropical birds in the RMCA

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species's global population has been estimated at 270,000 individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species faces similar threats to other African vultures, being susceptible to habitat conversion to agro-pastoral systems, loss of wild ungulates leading to a reduced availability of carrion, hunting for trade, persecution and poisoning. In East Africa, the primary issue is poisoning (particularly from the highly toxic pesticide carbofuran), which occurs primarily outside protected areas; the large range sizes of this and G. rueppellii species puts them at significant risk as it means they inevitably spend considerable time outside protected areas (Ogada and Keesing 2010, Otieno et al. 2010, Kendall and Virani in press). Recent evidence from wing-tagging and telemetry studies suggests that annual mortality, primarily from incidental poisoning, can be as high as 25% for G. africanus (Kendall and Virani in press). In addition, the ungulate wildlife populations on which this species relies have declined precipitously throughout East Africa, even in protected areas (Western et al. 2009). In 2007, diclofenac, a non-steroidal anti-inflammatory drug often used for livestock, and which is fatal to Gyps spp. when ingested at livestock carcasses, was found to be on sale at a veterinary practice in Tanzania (BirdLife International 2007). It was also reported that in Tanzania, a Brazilian manufacturer has been aggressively marketing the drug for veterinary purposes (C. Bowden in litt. 2007) and exporting it to 15 African countries (BirdLife International 2007). In southern Africa, vultures are caught and consumed for perceived medicinal and psychological benefits (McKean and Botha 2007), and the decline and possible extirpation in Nigeria has been attributed to the trade in vulture parts for traditional juju practices (P. Hall in litt. 2011). As a result of this and environmental pressures, it is predicted that the population of G. africanus in Zululand could be become locally extinct in 26 years, unless harvest rates have been underestimated, in which case local extinction could be 10-11 years away (McKean and Botha 2007). There is evidence that it is captured for international trade; for example in 2005, 13 individuals of this species being kept illegally in Italy were reportedly confiscated (F. Genero in litt. 2005). Electrocution on powerlines is also a problem in parts of its range, and it is vulnerable to nest harvesting or disturbance by humans (Bamford et al. 2009); perhaps more so than G. rueppellii, as it breeds in trees rather than on inaccessible cliffs (C. Kendall in litt. 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The white-backed vulture has been impacted by a number of threats, resulting in a decline in numbers in recent years. Consequently, in 2007 the IUCN Red List uplisted the species from Least Concern to Near Threatened (1). These population declines have been caused by a combination of factors: the loss and conversion of the vulture's habitat for agriculture, declines in wild ungulate populations reducing the availability of carrion, hunting for use in traditional medicine, capture for the illegal live trade (7), electrocution on electricity pylons, drowning in farm reservoirs (8), persecution and poisoning (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species occurs in a number of protected areas thoughout its range. A press release was circulated in July 2007 to raise awareness of the impacts of hunting for medicinal and cultural reasons in southern Africa (McKean and Botha 2007). In 2007, a survey began to establish the extent of diclofenac use for veterinary purposes in Tanzania (BirdLife International 2007), and in 2008 an awareness-raising campaign at a conference of the World Organisation for Animal Health in Senegal led to a resolution being adopted unanimously by more than 160 delegates to "request Members to consider their national situation with the aim to seek measures to find solutions to the problems caused by the administration of diclofenac in livestock" (Woodford et al. 2008, C. Bowden in litt. 2008).

Conservation Actions Proposed
Establish a monitoring network for African vultures. Establish legal protection for the species in range states. Raise awareness amongst pastoralists of the dangers of using poisons for pest control. Eliminate the veterinary use of diclofenac and other toxic drugs in Africa. Limit the hunting of game to improve the availability of carrion. Carry out education and awareness programmes, particularly targetted at farmers, to reduce persecution, unintentional poisoning and hunting for cultural reasons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A number of protected areas in Africa hold populations of white-backed vultures, including Serengeti National Park in Tanzania, a World Heritage Site (9). Yet the recent declines are worrying and further action is clearly required. Recommended measures include establishing legal protection for the species in all range countries, establishing a vulture monitoring network, and determining the most significant threats and seeking solutions (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-backed vulture

The white-backed vulture (Gyps africanus) is an Old World vulture in the family Accipitridae, which also includes eagles, kites, buzzards and hawks. It is closely related to the European griffon vulture, G. fulvus. Sometimes it is called African white-backed vulture to distinguish it from the Oriental white-backed vulture—nowadays usually called white-rumped vulture—to which it was formerly believed to be closely related.

The white-backed vulture is a typical vulture, with only down feathers on the head and neck, very broad wings and short tail feathers. It has a white neck ruff. The adult’s whitish back contrasts with the otherwise dark plumage. Juveniles are largely dark. This is a medium-sized vulture; its body mass is 4.2 to 7.2 kilograms (9.3–15.9 lb), it is 78 to 98 cm (31 to 39 in) long and has a 1.96 to 2.25 m (6 to 7 ft) wingspan.[2][3][4]

Like other vultures it is a scavenger, feeding mostly from carcasses of animals which it finds by soaring over savannah. It also takes scraps from human habitations. It often moves in flocks. It breeds in trees on the savannah of west and east Africa, laying one egg. The population is mostly resident.

As it is rarer than previously believed, its conservation status was reassessed from Least Concern to Near Threatened in the 2007 IUCN Red List.[5] In 2012 it was further uplisted to Endangered.[6] In 2013 it is further uplisted to Critically Endangered.[7]

Footnotes[edit]

  1. ^ IUCN Red List 2012.
  2. ^ "White-backed vulture videos, photos and facts - Gyps africanus". ARKive. Retrieved 2011-05-31. 
  3. ^ Raptors of the World by Ferguson-Lees, Christie, Franklin, Mead & Burton. Houghton Mifflin (2001), ISBN 0-618-12762-3
  4. ^ "African White-backed Vulture". Oiseaux-birds. Retrieved 2011-10-11. 
  5. ^ See BirdLife International (2007a. b).
  6. ^ "Recently recategorised species". Birdlife International (2012). Retrieved 15 June 2012. 
  7. ^ "15 bird species in India in critically endangered list". The Hindu. Retrieved 26 Nov 2013. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!