Articles on this page are available in 2 other languages: Spanish (7), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Most of the sooty shearwater's life is spent out at sea, flying fast over the ocean with rapid wingbeats, or gliding low over the water's surface (4). Feeding mostly on small fish, shrimp and other crustaceans, squid and jellyfish (2) (3), the sooty shearwater may snatch its prey from the ocean surface or plunge, from flight, into the water, and pursue its prey underwater. Propelling itself though the water with powerful beats of its wings, the sooty shearwater is known to reach depths of 67 metres (3). Sooty shearwaters arrive at their breeding colonies at the end of September or very early October, with egg laying, at least in New Zealand, taking place between mid-November and early December (3). Burrows, measuring up to three metres long, are dug into the ground, under tussock grass, low scrub, or Olearia forest (3). Like all shearwaters, albatrosses and petrels, sooty shearwater females lay just a single egg into this burrow (6), which is then incubated for around 53 days (3). The chick hatches around the middle of January (3), and is then fed by both parents, who spend their days foraging at sea, returning at night to feed their chick. These night time visits are somewhat boisterous, with the parents crashing through the trees and landing on the island with a loud thump (2). At 97 days of age, in late April or early May, the chick fledges and leaves its nest to head out to sea. Sooty shearwaters generally start breeding at the ages of five to seven (3). They typically mate for life (2), attracting a partner through a duet of courtship calls and gentle mutual nibbling (3). Upon the completion of breeding, sooty shearwaters commence their impressive migration north. From New Zealand, this bird travels to the regions off Japan, Alaska or California, before returning to New Zealand for the subsequent breeding season. Electronic tracking of this species has revealed that the sooty shearwater undertakes the longest migration of any animal tracked to date (9). Travelling in a figure-eight pattern across the Pacific Ocean, this small but intrepid bird covers an astounding 65,000 kilometres. Undertaking this great journey allows the sooty shearwater to exploit the greater abundance of prey found in the North Pacific at that time of the year (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This large, slender shearwater (4), with dark grey-brown plumage (5), flies effortlessly over the ocean with its long, narrow wings (4). The wings have a silvery lining (5), and a patchy white underside which may be conspicuous as it flies over the sea (4). Indeed, shearwaters are named for they way in which the wings, held stiff and motionless, skim the water's surface as they glide fast and low over the waves (7). Its long, blackish-grey bill has (4), like other shearwaters, a hooked tip and sharp blades, enabling it to efficiently handle slippery fish prey (6). Two tubular nostrils are situated on the upper bill, a unique feature of the Procellariiformes, a group of birds which includes the shearwaters, albatrosses and petrels (6). Infrequently heard in flight, the sooty shearwater is a noisy bird when ashore; its most common calls are a der-rer-ah or coo-roo-ah (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic and Pacific Oceans. Europe and North America south to South Africa and southern South America in Atlantic. In Pacific, North America, Northeastern Asia to south of Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range

The sooty shearwater has an exceptionally wide distribution, being found in most major oceans except for northern parts of the Indian Ocean (3). It breeds on islands off New Zealand, Australia and southern Chile, as well as on the Falkland Islands (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Ardenna grisea is an abundant shearwater, breeding on islands off New Zealand, Australia and Chile, and the Falkland Islands (Malvinas). In Australia there are colonies on 17 islands (all of less than 1,000 pairs), southern Chile (many colonies, some up to 200,000 pairs and up to 4 million birds on Isla Guafo; Reyes-Arriagada et al. 2007) and the Falklands (10,000-20,000 pairs) and more than 80 colonies in New Zealand (totalling c.5 million pairs) (Marchant and Higgins 1990). In 1970-71, the Snares Islands colonies were estimated to support 2,750,000 breeding pairs (del Hoyo et al. 1992; Heather and Robertson 1997). The total world population is thought to be over 20 million birds (Heather and Robertson 1997). Although this is an extremely numerous species, there are persistent signs of a current decline (Brooke 2004). In New Zealand, the number of burrows in the largest colony (on the Snares islands) declined by 37% between 1969-1971 and 1996-2000, and burrow occupancy may also have declined, indicating that an overall population decline may have occurred (Warham and Wilson 1982; Scofield 2002). Elsewhere the mainland New Zealand, colonies are in decline and certain offshore colonies have not responded to predator control (Gaze 2000; Jones 2000). In the California Current, Sooty Shearwater numbers have fallen by 90% in the last 20 years (Veit et al. 1996). It remains uncertain whether this has resulted from population declines or distributional shifts (Spear and Ainley 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: on islands off southeastern Australia, New Zealand, and southern South America (Wollaston and Deceit, probably also Huafo and Mocha, off Chile; off Tierra del Fuego; Falkland Islands). RANGES: at sea widely in Pacific and Atlantic Oceans; north to southern Bering Sea and Aleutian Islands in Pacific and to Labrador and Greenland in Atlantic; fairly common off east coast of North America, abundant off west coast (National Geographic Society 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

semi-cosmopolitan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S S. Am., New Zealand, se Australia; winters to n Pacific, n Atlantic.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 4 cm

Weight: 787 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 40-46 cm, Wingspan: 94-104 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Puffinus griseus
Catalog Number: USNM 47214
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): J. Xantus
Year Collected: 1860
Locality: Cape San Lucas, Baja California Sur, Mexico, North America
  • Type: Coues. (Not Earlier Than April 25) 1864. Proc. Acad. Nat. Sci. Philadelphia. for 1864: 124.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It nests on islands and headlands in large colonies. Burrows are dug for breeding under tussock grass, low scrub and on the Snares Islands under Olearia forest. Birds typically do not return to their natal colonies until age four. It feeds on fish, crustacea and cephalopods, caught while diving. Short (1-3 days) and long (5-15 days) provisioning trips are made by parents; longer trips allow foraging along the Antarctic Polar Front, reducing competition close to breeding grounds and allowing vast colonies to persist.


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pelagic. In spring and summer off California, concentrates in relatively shallow, cool waters, especially where strong thermal gradients mark the edge of upwellings (Briggs and Chu 1986). Nests in burrows on islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 30862 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18271 samples.

Environmental ranges
  Depth range (m): 0 - 138
  Temperature range (°C): -1.542 - 29.391
  Nitrate (umol/L): 0.025 - 29.581
  Salinity (PPS): 30.118 - 36.586
  Oxygen (ml/l): 3.157 - 8.121
  Phosphate (umol/l): 0.051 - 2.219
  Silicate (umol/l): 0.565 - 74.475

Graphical representation

Depth range (m): 0 - 138

Temperature range (°C): -1.542 - 29.391

Nitrate (umol/L): 0.025 - 29.581

Salinity (PPS): 30.118 - 36.586

Oxygen (ml/l): 3.157 - 8.121

Phosphate (umol/l): 0.051 - 2.219

Silicate (umol/l): 0.565 - 74.475
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Open ocean and islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shearwaters are oceanic birds, typically found far from land (6), apart from during the breeding season when the sooty shearwater can be found on islands and headlands (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Makes long transequatorial migrations between breeding and nonbreeding ranges, though some birds may spend the nonbreeding period south of the equator. Migrates along Atlantic coast of U.S. May-June; to Canada Labrador, and southern Greenland July-late September. Moves eastward out to sea in late northern summer. Millions of migrants occur off U.S. Pacific coast in northern spring and summer (Briggs and Chu 1986). Sporatically common to abundant off Pacific coast of Costa Rica mainly May-October (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Travel to northern hemisphere for summer months, breeds in southern hemisphere from September to May.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on small fishes, squids, and crustaceans. Also eats offal thrown overboard from ships. Feeds on food items made available by feeding of small tuna in eastern Tropical Pacific (Au and Pitman 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish and crustaceans mainly. Also squid and jellyfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May form huge flocks in nonbreeding season. Often in loose flocks of a few to 50 or more birds (Costa Rica, Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Breeding Category

Visitor
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds mostly during October-May in southern South America (Hilty and Brown 1986). Eggs are laid usually in late November. Clutch size is 1. Incubation lasts about 56 days. Chick remains in burrow for about 3 months; begins to fly at 100+ days after hatching (Terres 1980). Nests in colonies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds at 5-9 years old. Nests in burrows among colonies on islands. 1 egg incubated by both partners for 52-56 days. Young hatchling is fed by both parents. Hatchling leaves nest after about 90 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Puffinus griseus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTTGGCGCATGAGCCGGTATAGTCGGAACCGCCCTCAGCCTACTTATCCGCGCAGAACTTGGTCAACCAGGGACACTCCTGGGAGATGACCAAATCTACAATGTAATCGTTACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCCGTCATAATTGGAGGATTTGGAAACTGATTAGTTCCCCTCATAATCGGTGCACCCGACATAGCATTCCCACGTATAAATAACATAAGCTTCTGACTACTACCCCCATCCTTCCTCCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGGTGAACTGTGTACCCTCCTTTAGCTGGTAACCTTGCCCATGCCGGAGCCTCAGTCGATCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCTTCTATCCTAGGGGCAATCAACTTCATTACAACAGCTATCAACATAAAACCCCCAGCTCTATCACAGTATCAAACCCCTCTATTCGTATGATCCGTGCTCATCACTGCCGTCCTACTCCTACTCTCACTTCCAGTCCTCGCAGCAGGAATCACTATACTATTAACAGACCGAAACCTAAACACTACATTCTTTGACCCAGCTGGTGGAGGAGATCCAGTCCTATATCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTCATCTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Puffinus griseus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species is classified as Near Threatened because although it has a very large global population it is thought to have undergone a moderately rapid decline owing to the impact of fisheries, the harvesting of its young and possibly climate change.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5N - Secure

United States

Rounded National Status Rank: N5N - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is roughly estimated to number > c.20,000,000 individuals (Brooke, 2004), while national population estimates include: c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in China; >c.1,000 individuals on migration in Japan and >c.1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Harvesting young birds or 'muttonbirding' currently accounts for the take of around a quarter of a million birds annually (del Hoyo et al. 1992; Heather and Robertson 1997), but is unlikely to account for the scale of the decline. Populations are no longer ravaged by pelagic drift-nets which formerly drowned up to 350,000 birds annually (Ogi et al. 1993). Longline fisheries are responsible for large numbers of deaths of this and many other seabird species. Some authorities postulate that the decline may be associated with climate change, as investigation into the biological impact of recent climatic trends suggests either large-scale shifts in the foraging distribution of the species during the Boreal summer, or dramatic reductions in abundance and survival rate (Ainley et al 1995; Veit et al. 1996, 1997; Spear and Ainley 1999; Wahl and Tweit 2000; Oedekoven et al. 2001; Hyrenbach and Veit 2003; Veit et al. 1996). Rats (Rattus rattus and R. norvegicus) have been shown to predate on eggs and chicks, although the extent of the impact is unknown (Jones et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Many are killed in the Japanese gill-net fishery in the North Pacific (Lensink 1984, King 1984, DeGange and Day 1991) and in the halibut fishery off central California (protective legislation enacted, King 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Despite being a common species, the declines observed in populations of sooty shearwaters are of concern (8). Several factors have been cited as the reasons behind these declines, including hunting, fisheries and possibly climate change (8). In southern New Zealand, young sooty shearwaters are hunted by native Maori for food and oil, with around 250,000 young birds thought to be taken from their burrows each year (2). The sooty shearwater is also impacted by longline fisheries (8), a practice which is responsible for the deaths of large numbers of seabirds worldwide (10). This fishing method involves a single line up to 130 kilometres long, with thousands of baited hooks attached to it, being pulled behind a boat. Sooty shearwaters, foraging in the ocean, try to eat the bait from the line as it is set behind the boat, but instead swallow the hooks and are dragged under and drowned (11). Finally, it is thought that this species is vulnerable to changes in their food supply, which may result from either commercial fisheries, or global climate change (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is monitored at some sites and has been extensively studied in parts of its range. Some breeding grounds are protected and have benefited from eradications of introduced predators.

Conservation Actions Proposed
Continue monitoring key colonies and migration bottlenecks. Research the key threats driving declines and assess appropriate responses. Buffer important colonies against invasive species invasions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A number of the sooty shearwater's breeding grounds are protected (8); for example Snares Island, New Zealand, is a National Nature Reserve and forms part of the New Zealand Subantarctic Islands World Heritage Site (12). Efforts by conservation organisations to save albatross from dieing on longline fishing hooks will also benefit the sooty shearwater (11). Numerous devices can be used to prevent these unnecessary deaths; a study which examined the use of one such device, an integrated weight so that the longline sinks out of the bird's reach faster, revealed its effectiveness in reducing the mortality of sooty shearwaters (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Near Threatened
  • Woehler E.J. (compiler) 2006. Species list prepared for SCAR/IUCN/BirdLife International Workshop on Antarctic Regional Seabird Populations, March 2005, Cambridge, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sooty shearwater

The sooty shearwater (Puffinus griseus) is a medium-large shearwater in the seabird family Procellariidae. In New Zealand it is also known by its Māori name tītī and as muttonbird, like its relatives the wedge-tailed shearwater (P. pacificus) and the Australian short-tailed shearwater (P. tenuirostris).

It appears to be particularly closely related to the great (P. gravis) and short-tailed shearwaters, all blunt-tailed, black-billed species, but its precise relationships are obscure.[2][3][4] In any case, these three species are among the larger species of shearwater which might belong into a separate genus Ardenna.[5][6]

Description[edit]

Up close, the chocolate-coloured plumage can be appreciated

Sooty shearwaters are 40–51 cm in length with a 94–110 cm wingspan.[7] It has the typical "shearing" flight of the genus, dipping from side to side on stiff wings with few wing beats, the wingtips almost touching the water. Its flight is powerful and direct, with wings held stiff and straight, giving the impression of a very small albatross. This shearwater is identifiable by its dark plumage, which is responsible for its name. In poor viewing conditions, it looks all black, but in good light, it shows as dark chocolate-brown a silvery strip along the center of the underwing.

Usually loud, sooty shearwaters coo and croak while on the breeding grounds.

In the Atlantic, it is the only such bird, whereas in the Pacific part of its range, other all-dark large shearwaters are found. The short-tailed shearwater in particular is almost impossible to tell apart from the present species at a distance.[8]

Distribution and movements[edit]

Upper body of a bird swimming off the shore of California

Sooty shearwaters breed on small islands in the south Pacific and south Atlantic Oceans, mainly around New Zealand, the Falkland Islands, Tierra del Fuego and also in the Auckland Islands and Phillip Island off Norfolk Island. They start breeding in October, and incubate their young for about 54 days. Once the chick hatches, the parents raise their chick for 86 to 109 days.[7]

They are spectacular long-distance migrants, following a circular route,[9] traveling north up the western side of the Pacific and Atlantic Oceans at the end of the nesting season in March–May, reaching subarctic waters in June–July where they cross from west to east, then returning south down the eastern side of the oceans in September–October, reaching to the breeding colonies in November. They do not migrate as a flock, but rather as single individuals, associating only opportunistically; in June 1906 for example, two were shot near Guadalupe Island off Baja California, Mexico, several weeks before the bulk of the population would pass by.[10] Likewise, the identity of numerous large dark shearwaters observed in October 2004 off Kwajalein in the Marshall Islands remains enigmatic; they might have been either sooty or short-tailed shearwaters, but neither species is generally held to pass through this region at that time.[8]

In the Atlantic Ocean, they cover distances in excess of 14,000 km (8,700 mi) from their breeding colony on the Falkland Islands (52°S 60°W) north to 60 to 70°N in the North Atlantic Ocean off north Norway; distances covered in the Pacific are similar or larger; although the Pacific Ocean colonies are not quite so far south, at 35 to 50°S off New Zealand, and moving north to the Aleutian Islands, the longitudinal width of the ocean makes longer migrations necessary. Recent tagging experiments have shown that birds breeding in New Zealand may travel 74,000 km in a year, reaching Japan, Alaska and California, averaging more than 500 km per day.[11]

In Great Britain, they move south in late August and September; with strong north and north-west winds, they may occasionally become "trapped" in the shallow, largely enclosed North Sea, and heavy passages[clarification needed] may be seen flying back north up the British east coast as they re-trace their steps back to the Atlantic over northern Scotland.

Ecology and status[edit]

A small portion of a huge flock off the shore of California, United States in September

The sooty shearwater feeds on fish and squid. They can dive up to 68 m deep for food,[11] but more commonly take surface food, in particular often following whales to catch fish disturbed by them. They will also follow fishing boats to take fish scraps thrown overboard.

They breed in huge colonies and the female lays one white egg. These shearwaters nest in burrows lined with plant material, which are visited only at night to avoid predation by large gulls.

In New Zealand, about 250,000 mutton birds are harvested for oils, food and fats each year by the native Māori.[7] Young birds just about to fledge are collected from the burrows, plucked, and often preserved in salt.

Its numbers have been declining in recent decades, and it is presently classified as near threatened by the IUCN.[1] In 2009, the harvest reported record-low catches, on average a trapping cage would yield nearly 500 birds; in 2009 the number was estimated to be closer to 40 per cage.

Inspiration for Hitchcock's The Birds[edit]

On August 18, 1961, the Santa Cruz Sentinel reported that thousands of crazed sooty shearwaters[12] were sighted on the shores of North Monterey Bay in California, regurgitating anchovies, flying into objects, and dying on the streets. The incident sparked the interest of local resident Alfred Hitchcock, along with a story about spooky bird behavior by British writer Daphne du Maurier, helping to inspire Hitchcock's 1963 thriller The Birds, a cautionary tale of nature revolting against man.[13] The film is now ranked among the American Film Institute's top 10 thrillers of the last century.

Scientists looking at the stomach contents of turtles and seabirds gathered in 1961 Monterey Bay ship surveys have found toxin-making algae were present in 79% of the plankton[14] the creatures ate. "I am pretty convinced that the birds were poisoned," says ocean environmentalist Sibel Bargu of Louisiana State University. "All the symptoms were extremely similar to later bird poisoning events in the same area."

Plankton expert Raphael Kudela of USC points to leaky septic tanks installed amid a housing boom around Monterey Bay in the early 1960s as the ultimate culprit that may have fed the toxic algae[15] "It is to some extent a natural phenomenon, and the best thing we can do is monitor for the presence of toxins, and treat impacted wildlife."

References[edit]

  1. ^ a b BirdLife International (2012). "Puffinus griseus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Austin, Jeremy J. (1996). "Molecular Phylogenetics of Puffinus Shearwaters: Preliminary Evidence from Mitochondrial Cytochrome b Gene Sequences". Molecular Phylogenetics and Evolution 6 (1): 77–88. doi:10.1006/mpev.1996.0060. PMID 8812308. 
  3. ^ Heidrich, Petra; Amengual, José F. & Wink, Michael (1998). "Phylogenetic relationships in Mediterranean and North Atlantic shearwaters (Aves: Procellariidae) based on nucleotide sequences of mtDNA". Biochemical Systematics and Ecology 26 (2): 145–170. doi:10.1016/S0305-1978(97)00085-9. 
  4. ^ Austin, Jeremy J.; Bretagnolle, Vincent & Pasquet, Eric (2004). "A global molecular phylogeny of the small Puffinus shearwaters and implications for systematics of the Little-Audubon's Shearwater complex". Auk 121 (3): 847–864. doi:10.1642/0004-8038(2004)121[0847:AGMPOT]2.0.CO;2. 
  5. ^ Penhallurick, John & Wink, Michael (2004). "Analysis of the taxonomy and nomenclature of the Procellariiformes based on complete nucleotide sequences of the mitochondrial cytochrome b gene". Emu 104 (2): 125–147. doi:10.1071/MU01060. 
  6. ^ Rheindt, F. E. & Austin, Jeremy J. (2005). "Major analytical and conceptual shortcomings in a recent taxonomic revision of the Procellariiformes – A reply to Penhallurick and Wink (2004)". Emu 105 (2): 181–186. doi:10.1071/MU04039. 
  7. ^ a b c McGonigal, David (2008). Antarctica: Secrets of the Southern Continent. Buffalo, NY: Firefly Books. p. 220. ISBN 978-1-55407-398-6. 
  8. ^ a b VanderWerf, Eric A. (2006). "Observations on the birds of Kwajalein Atoll, including six new species records for the Marshall Islands". Micronesica 38 (2): 221–237. 
  9. ^ http://news.nationalgeographic.com/news/2006/08/060808-bird-migration.html/
  10. ^ Thayer, John E. and Bangs, Outram (1908). "The Present State of the Ornis of Guadaloupe Island". Condor 10 (3): 101–106. doi:10.2307/1360977. 
  11. ^ a b Shaffer, S.A.; Tremblay, Y.; Weimerskirch, H.; Scott, D.; Thompson, D.R.; Sagar, P.M.; Moller, H.; Taylor, G.A.; Foley, D.G.; Block, B.A. & Costa, D.P. (2006). "Migratory shearwaters integrate oceanic resources across the Pacific Ocean in an endless summer". PNAS 103 (34): 12799–12802. doi:10.1073/pnas.0603715103. PMC 1568927. PMID 16908846.  Supporting figures
  12. ^ Live Science. "Hitchcock's Crazed Birds Blamed on Toxic Algae". Livescience.com. Retrieved on 2013-04-03.
  13. ^ American Film Institute. Afi.com. Retrieved on 2013-04-03.
  14. ^ Vergano, Dan. (2011-12-28) Detroit Free Press. "Mystery of incident that inspired Hitchcock's 'The Birds' solved?" December 28, 2011. Freep.com. Retrieved on 2013-04-03.
  15. ^ Kudela, R. et al. (2005). "Harmful Algal Blooms in Coastal Upwelling Systems". Oceonography 18 (2): 184–197. doi:10.5670/oceanog.2005.53. 

Further reading[edit]

  • Bull, John L.; Farrand, John Jr.; Rayfield, Susan & National Audubon Society (1977): The Audubon Society field guide to North American birds, Eastern Region. Alfred A. Knopf, New York. ISBN 0-394-41405-5
  • Harrison, Peter (1988): Seabirds (2nd ed.). Christopher Helm, London. ISBN 0-7470-1410-8
  • Gillson, Greg (2008): Field separation of Sooty and Short-tailed Shearwaters off the west coast of North America Birding 40(2): 34–40.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!