Overview

Distribution

Range

Costa Rica to Brazil; Africa, Madagascar and Comoro Islands.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is subject to upredictable local nomadic movements (Johnsgard 1978) (usually of less than 500 km) in relation to variations in water and food availability (Madge and Burn 1988). Breeding commences at the start of the local rainy season (del Hoyo et al. 1992) with the species nesting individually (Langrand 1990, Hockey et al. 2005) or in loose colonies or small groups (del Hoyo et al. 1992). Adults undergo a post-breeding flightless moult period lasting for 18-25 days during which they are particularly vulnerable and seek the cover of densely vegetated wetlands (Kear 2005a). When not breeding the species is gregarious and may forage in flocks of up to several thousands of individuals (Kear 2005a). The species mainly forages at night (del Hoyo et al. 1992) (although it may also feed diurnally during the winter) (Madge and Burn 1988). Habitat The species inhabits a wide variety of freshwater wetlands (del Hoyo et al. 1992) including lakes, swamps (Kear 2005a), marshes, large rivers, river deltas, flood-plains (Madge and Burn 1988), reservoirs (Madge and Burn 1988, Kear 2005a), sewage farms (Africa) (Johnsgard 1978) and estuaries (Kear 2005a), and is commonly encountered feeding in rice fields (Kear 2005a). It shows a preference for wetlands in open country (del Hoyo et al. 1992) (although it is likely to inhabit fresh or brackish waters in more forested areas in South America) (Johnsgard 1978) with mud or sandbars for roosting and rich shoreline (Johnsgard 1978), emergent and surface vegetation (Brown et al. 1982). Adults require densely vegetated permanent wetlands for cover during their flightless post-breeding moult period (Hockey et al. 2005, Kear 2005a), although breeding birds prefer more ephemeral wetlands (Hockey et al. 2005). Diet Its diet consists of grasses (e.g. Echinochloa spp.), aquatic seeds e.g. of water-lilies Nyphaea and Nymphoides spp., rice (del Hoyo et al. 1992), pondweeds (e.g. Potamogeton spp.) (Hockey et al. 2005) and tubers (especially in the dry season) (Kear 2005a), as well as aquatic invertebrates such as molluscs, crustaceans and insects (del Hoyo et al. 1992), the consumption of which is highest during the rains (Kear 2005a). Breeding site The nest is a depression (Johnsgard 1978) or low construction of vegetation (Kear 2005a) placed over or at varying distances from water, usually in stands of dense vegetation (e.g. long grass, sedge or rice) (Kear 2005a) on dry ground or in reedbeds (Johnsgard 1978, del Hoyo et al. 1992), occasionally also in open crevices in trees (South America) (Madge and Burn 1988, Kear 2005a). The species may nest in solitary pairs (Langrand 1990, Hockey et al. 2005) with nests placed more then 75 m apart (Africa) (Brown et al. 1982, Hockey et al. 2005), although it may also nest in loose colonies or small groups (del Hoyo et al. 1992).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years (captivity) Observations: One specimen lived nearly 12 years at Woodland Park Zoo in Seattle (http://www.zoo.org/). Anecdotal evidence suggests these animals may live over 15 years in captivity, which is plausible even if unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocygna viduata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTCATCTTCGGAGCATGAGCAGGAATAATCGGCACCGCACTTAGCTTGCTAATCCGTGCAGAACTGGGACAACCTGGAACTCTTCTAGGGGACGATCAAATCTACAACGTAATCGTCACGGCCCACGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATCATAATTGGAGGCTTCGGAAACTGATTAGTTCCCCTGATAATCGGTGCCCCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCCTCCTTCTCCTGGCCTCATCCACTGTAGAAGCCGGTGCCGGCACAGGATGAACCGTATACCCACCCCTAGCAGGAAATCTAGCCCACGCTGGAGCATCAGTGGACCTAGCCATTTTCTCCCTCCATCTAGCTGGTATTTCCTCTATCCTAGGGGCCATTAACTTCATTACCACAGCCGTCAACATAAAACCACCTGCACTATCACAGTACCAAACCCCCCTATTCGTGTGGTCCGTCCTAATCACTGCCATCCTACTCCTCCTATCACTACCCGTACTTGCTGCCGGCATCACAATACTGCTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTGTACCAACACCTGTTCTGATTTTTCGGACATCCAGAGGTATACATCCTAATTTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocygna viduata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population is estimated to number 1,700,000-2,800,000 individuals.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is susceptible to avian botulism (van Heerden 1974) and avian influenza (Gaidet et al. 2007) so may be threatened by future outbreaks of these diseases. Utilisation The species is hunted for local consumption and trade in Malawi (Bhima 2006) and is hunted in Botswana (Herremans 1998). It is also hunted and traded at traditional medicine markets in Nigeria (Nikolaus 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-faced whistling duck

The white-faced whistling duck (Dendrocygna viduata) is a whistling duck that breeds in sub-Saharan Africa and much of South America.

This species is gregarious, and at favoured sites, the flocks of a thousand or more birds arriving at dawn are an impressive sight. As the name implies, these are noisy birds with a clear three-note whistling call.

Description[edit]

The three-note whistling call of the white-faced whistling duck

Problems playing this file? See media help.

This species has a long grey bill, long head and longish legs. It has a white face and crown, and black rear head. The back and wings are dark brown to black, and the underparts are black, although the flanks have fine white barring. The neck is chestnut. All plumages are similar, except that juveniles have a much less contrasted head pattern.

Range and habitat[edit]

The white-faced whistling duck has a peculiar disjunctive distribution, occurring in Africa and South America. It has been suggested that they may have been transported to new locations by humans. The habitat is still freshwater lakes or reservoirs, with plentiful vegetation, where this duck feeds on seeds and other plant food.

Ecology[edit]

This is an abundant species. It is largely resident, apart from local movements which can be 100 km or more.

Breeding[edit]

It nests on a stick platform near the ground, and lays 8-12 eggs. Trees are occasionally used for nesting.

Conservation[edit]

The white-faced whistling duck is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!