Overview

Comprehensive Description

Characteristics


Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Costa Rica to Brazil; Africa, Madagascar and Comoro Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is subject to upredictable local nomadic movements4 (usually of less than 500 km) in relation to variations in water and food availability3. Breeding commences at the start of the local rainy season1 with the species nesting individually6, 7 or in loose colonies or small groups1. Adults undergo a post-breeding flightless moult period lasting for 18-25 days during which they are particularly vulnerable and seek the cover of densely vegetated wetlands2. When not breeding the species is gregarious and may forage in flocks of up to several thousands of individuals2. The species mainly forages at night1 (although it may also feed diurnally during the winter)3. Habitat The species inhabits a wide variety of freshwater wetlands1 including lakes, swamps2, marshes, large rivers, river deltas, flood-plains3, reservoirs2, 3, sewage farms (Africa)4 and estuaries2, and is commonly encountered feeding in rice fields2. It shows a preference for wetlands in open country1 (although it is likely to inhabit fresh or brackish waters in more forested areas in South America)4 with mud or sandbars for roosting and rich shoreline4, emergent and surface vegetation5. Adults require densely vegetated permanent wetlands for cover during their flightless post-breeding moult period2, 7, although breeding birds prefer more ephemeral wetlands7. Diet Its diet consists of grasses (e.g. Echinochloa spp.), aquatic seeds e.g. of water-lilies Nyphaea and Nymphoides spp., rice1, pondweeds (e.g. Potamogeton spp.)7 and tubers (especially in the dry season)2, as well as aquatic invertebrates such as molluscs, crustaceans and insects1, the consumption of which is highest during the rains2. Breeding site The nest is a depression4 or low construction of vegetation2 placed over or at varying distances from water, usually in stands of dense vegetation (e.g. long grass, sedge or rice)2 on dry ground or in reedbeds1, 4, occasionally also in open crevices in trees (South America)2, 3. The species may nest in solitary pairs6, 7 with nests placed more then 75 m apart (Africa)5, 7, although it may also nest in loose colonies or small groups1.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years (captivity) Observations: One specimen lived nearly 12 years at Woodland Park Zoo in Seattle (http://www.zoo.org/). Anecdotal evidence suggests these animals may live over 15 years in captivity, which is plausible even if unverified.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocygna viduata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTCATCTTCGGAGCATGAGCAGGAATAATCGGCACCGCACTTAGCTTGCTAATCCGTGCAGAACTGGGACAACCTGGAACTCTTCTAGGGGACGATCAAATCTACAACGTAATCGTCACGGCCCACGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATCATAATTGGAGGCTTCGGAAACTGATTAGTTCCCCTGATAATCGGTGCCCCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCCTCCTTCTCCTGGCCTCATCCACTGTAGAAGCCGGTGCCGGCACAGGATGAACCGTATACCCACCCCTAGCAGGAAATCTAGCCCACGCTGGAGCATCAGTGGACCTAGCCATTTTCTCCCTCCATCTAGCTGGTATTTCCTCTATCCTAGGGGCCATTAACTTCATTACCACAGCCGTCAACATAAAACCACCTGCACTATCACAGTACCAAACCCCCCTATTCGTGTGGTCCGTCCTAATCACTGCCATCCTACTCCTCCTATCACTACCCGTACTTGCTGCCGGCATCACAATACTGCTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTGTACCAACACCTGTTCTGATTTTTCGGACATCCAGAGGTATACATCCTAATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocygna viduata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total regarded as a minimum by Wetlands International (2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is susceptible to avian botulism11 and avian influenza12 so may be threatened by future outbreaks of these diseases. Utilisation The species is hunted for local consumption and trade in Malawi8 and is hunted in Botswana10. It is also hunted and traded at traditional medicine markets in Nigeria9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-faced Whistling Duck

The White-faced Whistling Duck (Dendrocygna viduata) is a whistling duck that breeds in sub-Saharan Africa and much of South America.

This species is gregarious, and at favoured sites, the flocks of a thousand or more birds arriving at dawn are an impressive sight. As the name implies, these are noisy birds with a clear three-note whistling call.

Contents

Description [edit]

This species has a long grey bill, long head and longish legs. It has a white face and crown, and black rear head. The back and wings are dark brown to black, and the underparts are black, although the flanks have fine white barring. The neck is chestnut. All plumages are similar, except that juveniles have a much less contrasted head pattern.

Range and habitat [edit]

The White-faced Whistling Duck has a peculiar disjunct distribution, occuring in Africa and South America. It has been suggested that they may have been transported to new locations by humans. The habitat is still freshwater lakes or reservoirs, with plentiful vegetation, where this duck feeds on seeds and other plant food.

Ecology [edit]

This is an abundant species. It is largely resident, apart from local movements which can be 100 km or more.

Breeding [edit]

It nests on a stick platform near the ground, and lays 8-12 eggs. Trees are occasionally used for nesting.

Conservation [edit]

The White-faced Whistling Duck is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Gallery [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!