Articles on this page are available in 2 other languages: Chinese (Simplified) (4), Dutch (1) (learn more)

Overview

Brief Summary

Fulmars can be seen flying over the North Sea the entire year. However you are only likely to see them at sea or in their breeding area off the northern coast of Northern England, Scotland or Helgoland. If they end up on a Dutch beach then they probably ran into a storm or are victims of an oil spill or marine litter. Fulmars have a strong beak with a sharp arched point, which allows them to tear off pieces of their prey. They eat just about anything found in the upper sea surface, including plastic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fulmarus glacialis, or Nothern Fulmar, sea bird found primarily in subarctic regions of the north Atlantic and north Pacific oceans. This species's walking skills are limited, but it is a strong flyer. It feeds on fish, squid, plankton, jellyfish, and carrion, diving several feet deep into the water in order to retrieve its prey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 45-50 cm, envergure 102-112 cm, poids moyen 610-1 000 g.

L’habitat fréquenté est océanique, l’espèce ne venant à terre que durant la saison de reproduction. Les sites de nid sont sur des falaises ou de hauts escarpements rocheux qui font face à la mer. Les corniches herbeuses ou terreuses sont préférées à la roche nue.

Le Fulmar se nourrit de crustacés, de céphalopodes, de poissons et de cadavres (notamment de mammifères marins). Il pêche normalement en surface mais peut atteindre 4 m en plongée.

L’espèce est très grégaire, autant sur les sites de nid (colonies lâches atteignant plusieurs milliers de couples dans le nord de son aire de distribution) que pendant les phases alimentaires, où elle se concentre en fonction des disponibilités en proies. Le Fulmar est monogame et les mêmes couples se reforment souvent d’une année sur l’autre, après une séparation en fin d’été. Le changement de partenaire ou de site de nid est rare après une reproduction réussie. Les jeunes se dispersent sur de grandes distances alors que les adultes quittent les eaux côtières pendant la mue d’août à octobre, mais reviennent visiter les colonies dès la fin de l’automne.

Le nid est une simple dépression sur le sol, parfois garnie de quelques cailloux. Les œufs sont déposés à partir de mai et la plupart éclosent en juillet, pour un envol fin août-début septembre.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Northern Fulmar is found breeding throughout the north Atlantic and north Pacific, ranging from Japan and the United Kingdom in the south, to the high Arctic in the north. Northern populations are migratory, travelling south as the sea freezes over. Southern populations are more dispersive, but do not usually reach zones of warm water. Young birds may make transoceanic crossing and general wander further than the less mobile adults (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; range extends from the Arctic to North Carolina
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-arctic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern fulmars are found throughout the northern Atlantic and Arctic oceans in the northern hemisphere. They occur as far south as Cape Cod, Massachusetts in the western Atlantic, the British Isles in the eastern Atlantic, Japan in the western Pacific and California in the eastern Pacific. There are 3 recognized subspecies: F. g. glacialis in the northernmost Atlantic, F. g. audubonii is found in the lower Arctic of the north Atlantic, and F. g. rodgersii is found in the north Pacific.

Northern fulmars range widely across the Atlantic, with individuals regularly traveling between North America and Britain, including immature individuals. In the western Atlantic, most northern fulmars in 11 large colonies above 65 degrees North latitude in eastern Canada. Additional breeding colonies are found in Greenland, Newfoundland, and Labrador. Concentrations of northern fulmars occur around Newfoundland in early spring and some evidence suggests a general northwards movement in populations between May and July. Fledglings disperse southwards rapidly from breeding colonies in September and October. In winter the majority of northern fulmars occur in offshore waters and are rarely observed.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

  • Huettmann, F., A. Diamond. 2000. Seabird migration in the Canadian northwest Atlantic Ocean: moulting locations and movement patterns of immature birds. Canadian Journal of Zoology, 78: 624-627.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1992. Handbook of the Birds of the World, Volume I. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Discontinuously circumpolar, breeding in the north Atlantic, north Pacific, and Arctic oceans. In North America breeds in colonies along the coasts of Alaska, the Canadian Arctic, and in Greenland (Godfrey 1966). Highly pelagic. Two large colonies in the Bering Sea include light-plumaged birds almost exclusively, whereas dark-plumaged birds dominate colonies in the Gulf of Alaska and Aleutian Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern Pacific and Atlantic oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

There are 4 color morphs of northern fulmars: very dark, dark, light, and very light. Color morphs seem to differ in their distribution during the breeding season and in the timing of their molt. The 3 recognized subspecies are distinguished by differences in bill length and thickness and the proportion of the different color morphs, although the subspecies do have individuals of multiple color morphs generally. Individuals of different color morphs seem to mate indiscriminantly, although breeding colonies tend to be made up mainly of a single color morph. Immature individuals cannot be distinguished from adults. Most molting occurs in July. Molting seems to make some populations unable to fly, but not others. Males are slightly larger, on average 835 g whereas females average 700 g (range of masses is 450 to 1000 g). The sexes are similar in overall appearance. Northern fulmars are from 45 to 50 cm long with wingspans of 102 to 112 cm.

Northern fulmars have thick, yellow to gray bills with darker areas over the "tubes." Their legs and feet are flesh-colored to gray. Dark color morphs are more common in the southern portions of their range in the Atlantic and the northern portions of their range in the Pacific. Light color morphs are more common in the northern portion of the range in the Pacific. Atlantic populations tend to have robust bills and are almost exclusively light color morphs, whereas Pacific populations have bills that are more slender and exhibit the full range of color variation. Light morphs are uniformly pale, with head, neck, and ventral surfaces white and with their backs and wings being gray. Dark morphs are uniformly dark gray. Nearly all individuals of any color morph have a light to white patch on the dorsal surface of their wings formed by the exposed lighter portion of their primaries, this is only lacking in the darkest of individuals. Individuals can vary between the very dark ("double dark") and light ("double light") morphs described above. Variation is more of less continuous, but is divided into 4 morph categories for convenience.

Northern fulmars can be confused with pink-footed shearwaters (Puffinus creatopus) or flesh-footed shearwaters (Puffinus carneipes), but can be distinguished by their thick, rounded heads and stubby bills.

Range mass: 450 to 1000 g.

Average mass: 700 to 835 g.

Range length: 45 to 50 cm.

Range wingspan: 102 to 112 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 48 cm

Weight: 609 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 45-51 cm, Wingspan: 102-112 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Northern Fulmar typically breeds on cliffs and rock faces, but also occasionally on flatter ground sometimes up to 1 km inland. It will also breed near human habitation, sometimes even on occupied houses along the seafront of towns. Its diet comprises of variable quantities of fish, squid and zooplankton (especially amphipods), and it will also feed on fish offal and carrion (e.g. whale blubber). Most of its food is obtained by surface seizing but it will also plunge (del Hoyo et al. 1992). Tracking at Bear Island (Norway) revealed breeders forage close to the colony, preferring the continental shelf. As chicks became older parents foraged further from the colony, eventually regularly embarking on long trips to the Norwegian coast (Weimerskirch et al. 2001).

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 375220 specimens in 1 taxon.
Water temperature and chemistry ranges based on 303801 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 24.405
  Nitrate (umol/L): 0.038 - 16.868
  Salinity (PPS): 19.618 - 36.385
  Oxygen (ml/l): 4.763 - 9.084
  Phosphate (umol/l): 0.109 - 1.252
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -1.109 - 24.405

Nitrate (umol/L): 0.038 - 16.868

Salinity (PPS): 19.618 - 36.385

Oxygen (ml/l): 4.763 - 9.084

Phosphate (umol/l): 0.109 - 1.252

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern fulmars are found in ocean waters over continental shelves. They are found from the pack ice of Arctic waters to temperate waters. They seem to prefer shelf break habitats (the area where the continental shelf begins to descend towards the sea floor) or areas over the continental slope. They are rarely seen more than 100 km from shore. They breed on rocky cliffs and islands up to 1 km inland, but typically close to the water or coastal. They have occasionally been reported nesting on human structures, like houses in coastal areas.

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Pelagic. Nests in colonies primarily on sea cliffs, less frequently on low flat rocky islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 375220 specimens in 1 taxon.
Water temperature and chemistry ranges based on 303801 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.109 - 24.405
  Nitrate (umol/L): 0.038 - 16.868
  Salinity (PPS): 19.618 - 36.385
  Oxygen (ml/l): 4.763 - 9.084
  Phosphate (umol/l): 0.109 - 1.252
  Silicate (umol/l): 0.565 - 16.169

Graphical representation

Temperature range (°C): -1.109 - 24.405

Nitrate (umol/L): 0.038 - 16.868

Salinity (PPS): 19.618 - 36.385

Oxygen (ml/l): 4.763 - 9.084

Phosphate (umol/l): 0.109 - 1.252

Silicate (umol/l): 0.565 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sea cliffs and open ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Travels south in winter, but not far, remaining in cold waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Northern fulmars eat fish, squid, and large zooplankton such as amphipods (Thysanoessa, Hyperia, Gammarus, and Themisto species). They are opportunistic feeders and also take discarded fish and carrion, such as whale, walrus, and seal blubber. They eat a wide variety of prey, but seem to prefer fish with high fat content. They drink seawater. They capture prey mainly at the surface, but will occasionally dive as well. Northern fulmars often accompany fishing fleets, forming large aggregations to take advantage of fish waste. They are one of the few bird species with a well-developed sense of smell and are thought to use olfaction to detect prey. They tend to forage at marine upwellings that cause temporary concentrations of large zooplankton, including areas near ice sheets or upwelling associated with feeding gray whales (Eschrictius robustus) or trawling operations. Northern fulmars travel widely in search of food. During the breeding season individual leave the colony on foraging trips of 4 to 5 days that may take them up to 460 km from the colony, although most foraging is within 100 km of the colony.

Animal Foods: fish; carrion ; mollusks; aquatic crustaceans; cnidarians; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on fishes, mollusks, crustaceans. Surface feeder; floats or swims on surface of water while eating; may dive below surface. Follows fishing ships. Drinks seawater.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Crustaceans and fish, plus squid, marine worms, and carrion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Northern fulmars are important predators and scavengers in arctic and temperate pelagic waters. They occur in large breeding colonies with other cliff-nesting seabirds, including murres (Uria), kittiwakes (Rissa), and cormorants (Phalacrocorax). They may use areas of breeding islands with more vegetation and soil accumulation than these other species. They feed on large zooplankton brought to the surface by feeding gray whales (Eschrictius robustus) and are often found in close association with black-legged kittiwakes (Rissa tridactyla) in arctic waters.

Northern fulmars are susceptible to various diseases, including viral ornithosis, which can be transmitted to humans, and shellfish paralysis. Ectoparasites reported are chewing lice (Procellariphaga brevifimbiata, Saemundssonia occidentalis, and Perineus nigrolimbatus), endoparasites reported are nematodes (Stegophorus stellaepolaris).

Mutualist Species:

  • murres (Uria)
  • kittiwakes (Rissa)
  • cormorants (Phalacrocorax)
  • gray whales (Eschrictius robustus)
  • black-legged kittiwakes (Rissa tridactyla)

Commensal/Parasitic Species:

  • chewing lice (Procellariphaga brevifimbiata)
  • chewing lice (Saemundssonia occidentalis)
  • chewing lice (Perineus nigrolimbatus)
  • nematodes (Stegophorus stellaepolaris)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern fulmars are preyed on by red foxes (Vulpes vulpes) and Arctic foxes (Vulpes lagopus) at breeding colonies. Other introduced predators include ground squirrels (Spermophilus) and rats (Rattus norvegicus). Northern fulmars are not susceptible to these terrestrial predators, except at breeding colonies. They will spit a foul smelling oil at predators when threatened.

Known Predators:

  • red foxes (Vulpes vulpes)
  • Arctic foxes (Vulpes lagopus)
  • ground squirrels (Spermophilus)
  • rats (Rattus norvegicus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Fulmarus glacialis (kittiwake, guillemots, fulmar petrel, little auk, puffin) is prey of:
Alopex lagopus

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Fulmarus glacialis (kittiwake, guillemots, fulmar petrel, little auk, puffin) preys on:
Animalia

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: A 1970s population estimate for the eastern Bering Sea and Aleutian Islands was about 490,000 pairs; in 1990, 55,000 pairs in 10 colonies were counted along the western Bering Sea coast (Vyatkin 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Hunted for flesh and feathers. Nests raided by arctic weasels, glaucous and herring gulls. See Hatch (1987) for demographic data from Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Northern fulmars are one of the few species of birds with a well-developed sense of smell. They may use olfaction to detect and find prey and can be attracted to areas by fish oil smells. Similar to other petrels and shearwaters, they emit a strong, musky odor. Individuals emit this odor when handled and colonies and flocks are easily detected by their smell. Birds sometimes engage in allopreening upon returning to breeding colonies.

Northern fulmar vocalizations have been described as "cackling" or "braying" at various speeds. These vocalizations are used during courtship, at approaches to nesting colonies, and in aggression against intruders. They make other calls as well, described as grunts, mewing, and spitting, which warns a threat that these birds are about to spit stomach oil at them, a defensive mechanism. Hatchlings use a food-begging call that stimulates parents to regurgitate.

They also use a variety of visual displays in aggressive encounters, including raising their wings, rushing at other birds, and pushing their breasts against the other bird. They also use their spitting call and oil spitting in aggressive encounters.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Northern fulmars have exceptionally long lifespans. Average adult life expectancy is estimated at 31.8 years. Birds have been reported breeding at over 50 years old. Annual survival rates are approximately 0.988 for adults. Most mortality is during the egg and early hatchling phase.

Typical lifespan

Status: wild:
50 (high) years.

Average lifespan

Status: wild:
31.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 51 years (wild) Observations: Ageing has not been detected in these animals (Roger Gosden 1996), though it is possible that mortality increases with age. In one study in the wild, the oldest bird was at least 51 years-old (Paul Thompson, pers. comm.).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Northern fulmars are monogamous and rejoin their mates each year at the same nest site for breeding. If an individual's mate dies, they will mate with a young, inexperienced mate following year, but at the same nest site. Males and females associate at the nesting colony for a few weeks before they lay an egg. They copulate frequently, then both depart to forage during the pre-laying phase.

Mating System: monogamous

During the pre-laying period, females store sperm in their reproductive tract and begin the process of yolk formation, which takes about 23 days. After yolk formation, females ovulate, the egg is fertilized, and the female returns to the colony and lays her egg within a few hours of arrival. Egg-laying occurs about 3 weeks after breeding.

Northern fulmars begin to breed in April and lay their eggs in late May to early June in large colonies on ledges and among rocks. They may also nest in areas with more soil and vegetation than other seabirds and will even nest on buildings and walls. Nests are fairly simple scrapes, sometimes lined with bits of vegetation. From 80 to 99% of nests are re-used by at least 1 member of the original pair each year. Females lay a single, white egg and incubation lasts for 47 to 53 days. The process of hatching takes from 4 to 5 days. Young fledge at 49 to 58 days in early September, with the last young northern fulmars leaving their natal sites by early October. Sexual maturity is not reached until 5 to 20 years old (average 8 years in males, 12 years in females).

Breeding interval: Northern fulmars breed once yearly.

Breeding season: Breeding occurs in the late spring and early summer, beginning in May.

Range eggs per season: 1 to 1.

Range time to hatching: 47 to 53 days.

Range fledging age: 49 to 58 days.

Average fledging age: 53 days.

Range age at sexual or reproductive maturity (female): 5 to 20 years.

Average age at sexual or reproductive maturity (female): 12 years.

Range age at sexual or reproductive maturity (male): 5 to 20 years.

Average age at sexual or reproductive maturity (male): 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous ; sperm-storing

Average eggs per season: 1.

Both parents incubate the eggs, staying on the nest for from 1 to 11 (average 4.6) days until relieved by the other parent. Males often take particularly long incubation shifts at the beginning of incubation, presumably to allow the female to recover from laying the egg. Young hatch with a light covering of down and are closely tended by parents for 10 to 16 days after hatching, after which parents primarily visit the nest to feed their young. They are able to thermoregulate at 3 to 6 days old. Parents feed their young by regurgitation in response to the chick's food begging call. Young fledge at 49 to 58 (average 53) days old, about 4 to 5 days after the parents have stopped feeding them. Young fledge at 115 to 119% of adult body mass.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Hatch, S., D. Nettleship. 1998. Northern fulmar (Fulmarus glacialis). The Birds of North America Online, 361: 1-20. Accessed July 13, 2009 at http://bna.birds.cornell.edu.proxy.lib.umich.edu/bna/species/361.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1992. Handbook of the Birds of the World, Volume I. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg laying occurs May-July (early June in western Gulf of Alaska). Clutch size: 1. One brood per year. Incubation by both parents, in turn, lasts 46-51 days. Young leave nest at 49-58 days. First breeds at 7-9 years. Nesting colony may include up to 200,000 birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

First breeds between 6 and 12 years old. Nests are built on cliff ledges among colonies. 1 egg is incubated by both partners for 49-53 days. Young hatchling is fed by both parents. First capable of flight at 41-57 days old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fulmarus glacialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTCCAACCACAAAGACATTGGCACCCTATATCTAATTTTCGGCGCATGAGCTGGCATAGTCGGAACTGCCCTCAGCCTACTTATTCGTGCAGAACTTGGTCAGCCAGGAACCCTCTTAGGAGATGACCAAATCTATAATGTAATCGTTACTGCCCATGCCTTCGTAATAATTTTCTTCATAGTGATACCAGTCATAATTGGAGGATTCGGAAACTGACTAGTCCCTCTCATAATCGGTGCGCCCGACATGGCATTCCCACGTATAAATAACATAAGCTTCTGACTACTGCCCCCATCCTTCCTTCTCCTACTAGCCTCATCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTCTACCCACCCCTAGCCGGCAATCTAGCCCATGCCGGAGCCTCAGTCGACCTAGCTATCTTCTCCCTCCACCTAGCTGGTGTATCCTCTATCCTAGGGGCTATCAACTTCATCACAACAGCCATCAACATAAAACCCCCAGCTCTATCACAATACCAAACCCCTTTATTCGTATGATCCGTCCTTATCACTGCCATCCTACTCTTACTTTCACTTCCAGTTTTGGCTGCAGGAATCACCATATTACTAACAGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGCGGAGGAGACCCAGTCTTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTGATCCTACCGTGATTTGGAATTATCTCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fulmarus glacialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 143
Specimens with Barcodes: 157
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5