Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Podiceps auritus

A medium-sized (12-15 inches) grebe, the Horned Grebe in summer is most easily identified by its dark back and head, brown neck and flanks, and conspicuous yellow feather plumes on the head. In winter, this species becomes black above and pale below. This species is perhaps most easily confused with the related Eared Grebe (Podiceps nigricollis); that species may be separated from the Horned Grebe in summer by its black neck and flanks and in winter by its darker neck and face. The Horned Grebe occurs across wide area of the Northern Hemisphere. In North America, this species breeds across central Alaska, western Canada, and locally in the western United States, wintering along the Pacific coast from Alaska to Baja California, along the Atlantic coast from Nova Scotia to Texas, inland in the southeastern U.S., and locally in the interior west. In the Old World, this species breeds from Iceland and Scotland east to eastern Siberia, wintering as far south as the Mediterranean Sea and the Korean peninsula. Horned Grebes breed in small ponds and shallow marshes, preferring areas with thick vegetation to more open water. In winter, this species may be found on large bodies of water, including lakes, bays, and inshore waters near the coast. Horned Grebes primarily eat small insects in summer, switching to small fish during the winter. In appropriate habitat, Horned Grebes may be observed floating low in the water, periodically diving down to capture prey. Like most grebes, this species must run and flap along the surface of the water in order to become airborne, subsequently flying swiftly low over the water. Also like most grebes, this species’ legs are positioned at the far end of its body, making it an adept swimmer but rendering it almost entirely unable to move on land. Horned Grebes are most active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: central and southern Alaska and Canada south to Idaho, northern South Dakota, northern Iowa, and central Wisconsin, with the highest breeding densities in southwestern Manitoba; Iceland, Faroes, Eurasia. WINTERS: in North America, mainly along the coast south to California, Texas, Florida (less commonly interiorly, from the Great Lakes south); in Old World south to Mediterranean Sea, Iran, and Japan. Areas of highest winter density include northwestern Washington and the Gulf Coast near Pensacola (Florida); to a lesser degree, various national wildlife refuges along the Atlantic coast from South Carolina to southeastern Canada (Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; Oceania; winter range extends from the Scotian Shelf to Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Podiceps auritus can be found across from Iceland, northern United Kingdom and Scandinavia in Europe, and throughout the centre of Russia to the Pacific coast. It also breeds in southern Alaska (USA), in most of western and central Canada, and in northern USA. Wintering grounds occur further south, including the North Sea, Adriatic Sea, Black Sea and the Caspian Sea, as well as the coast Japan, Korea and China, and the USA down to California on the Pacific coast and Texas on the Atlantic coast (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Horned grebes are found in the Nearctic and Palearctic regions. They breed from Alaska and northern Canada south through the Canadian prairie provinces to Washington, Montana, South Dakota, and Wisconsin. Populations winter along the Pacific coast from Alaska to Mexico, along the Altantic coast from Nova Scotia to the gulf coast, and on large inland lakes such as the great lakes. They also breed and winter in Eurasia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

  • Bull, J., J. Farrand Jr. 1988. The Audubon Society Field Guide To North American Birds--Eastern Region. New York: Alfred A. Knopf.
  • Farrand, J. 1988b. Western Birds--An Audubon Handbook. New York: McGraw--Hill Book Company.
  • Farrand, J. 1988a. Eastern Birds--An Audubon Handbook. New York: McGraw--Hill Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Horned grebes are found in the Nearctic and Palearctic regions. They breed from Alaska and northern Canada south through the Canadian prairie provinces to Washington, Montana, South Dakota, and Wisconsin. Populations winter along the Pacific coast from Alaska to Mexico, along the Altantic coast from Nova Scotia to the gulf coast, and on large inland lakes such as the great lakes. They also breed and winter in Eurasia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

  • Bull, J., J. Farrand Jr. 1988. The Audubon Society Field Guide To North American Birds--Eastern Region. New York: Alfred A. Knopf.
  • Farrand, J. 1988b. Western Birds--An Audubon Handbook. New York: McGraw--Hill Book Company.
  • Farrand, J. 1988a. Eastern Birds--An Audubon Handbook. New York: McGraw--Hill Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Atlantic south to Texas. North Pacific south to southern California. Also Black, Caspian, and Aral Seas. China and Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Horned grebes look like small ducks with short, pointed bills. They are 31 to 38 cm long and weigh 300 to 570 g. Breeding adults have a reddish neck, breast, and flanks. They have black heads, and dark throats and backs. They also have orange or golden plumes of feathers on the sides of their heads that look a little like horns. In winter, horned grebes are much duller. They have white cheeks, throat and breast, and a dark crown, nape and back.

Male and female horned grebes look alike, but males are slightly larger and more brightly colored. Juveniles look similar to adults.

Range mass: 300 to 570 g.

Range length: 31 to 39 cm.

Sexual Dimorphism: sexes alike; male larger; female more colorful; ornamentation

  • Godfrey, W. 1986. The Birds of Canada--Revised Edition. Ottawa: National Museums of Canada.
  • Stedman, S. 2000. Horned grebe (Podiceps auritus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 505. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Horned grebes resemble small, compact ducks with short, pointed bills. They are 31 to 38 cm long and weigh 300 to 570 g. Breeding adults have a reddish neck, breast, and flanks. The back and throat are dark, and the head is nearly black. Conspicuous orange-buff to golden ear plumes distinguish the species from other grebes and give it its name. The bills of horned grebes are dark and the breast is white. The winter plumage of horned grebes is rather drab. The cheeks, throat, and breast are white, with a dark crown, nape, and back. The bill is duller than in the breeding plumage.

Male and female horned grebes are similar in appearance, but males are slightly larger, heavier and more brightly colored. Juveniles look similar to adults.

Horned grebes look like small ducks with short, pointed bills. They are 31 to 38 cm long and weigh 300 to 570 g. Breeding adults have a reddish neck, breast, and flanks. They have black heads, and dark throats and backs. They also have orange or golden plumes of feathers on the sides of their heads that look a little like horns. In winter, horned grebes are much duller. They have white cheeks, throat and breast, and a dark crown, nape and back.

Male and female horned grebes look alike, but males are slightly larger and more brightly colored. Juveniles look similar to adults.

Range mass: 300 to 570 g.

Range length: 31 to 39 cm.

Sexual Dimorphism: sexes alike; male larger; female more colorful; ornamentation

  • Godfrey, W. 1986. The Birds of Canada--Revised Edition. Ottawa: National Museums of Canada.
  • Stedman, S. 2000. Horned grebe (Podiceps auritus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 505. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 34 cm

Weight: 453 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 35 cm, Wingspan: 45 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Marshes, ponds and lakes, occasionally along sluggish streams (breeding); bays, estuaries and seacoasts, and in migration commonly in inland freshwater habitats, especially lakes and rivers (nonbreeding) (AOU 1983). Nest on small and large lakes and ponds (about 0.1 ha or larger), in calm waters of marshes, along rivers and streams. Favors areas with much open water. Usually nests among tall vegetation in shallow water. Highest breeding densities occur in pothole marshes of aspen woodland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is fully migratory (del Hoyo et al. 1992) and travels over land in stages on a broad front, some populations only moving short distances to the nearest ice-free coast (Fjeldsa 2004). The species breeds from April to August (del Hoyo et al. 1992) in solitary isolated pairs (del Hoyo et al. 1992, Fjeldsa 2004), small loose colonies occasionally forming on lakes with rich extensive feeding areas (Fjeldsa 2004). During the non-breeding season the species usually remains solitary or forages in pairs or small groups (Snow and Perrins 1998) although flocks of up to c.500 individuals may gather occasionally on the sea during the winter (Fjeldsa 2004) and flocks of up to 60 individuals may travel together on passage (Snow and Perrins 1998). Habitat Breeding The species breeds on small, shallow fresh (del Hoyo et al. 1992), brackish or slightly alkaline (Fjeldsa 2004) waters between 0.5 and 2 m deep and between 1 and 20 ha in area (Snow and Perrins 1998) with rich floating (Konter 2001), submergent and emergent vegetation (Fjeldsa 2004). Habitats include small pools, marshes with patches of open water and secluded sections of larger lakes and rivers (del Hoyo et al. 1992). Non-breeding In its wintering range the species frequents coastal inshore waters (del Hoyo et al. 1992) up to 10-20 m in depth (Fjeldsa 2004) including sheltered bays (del Hoyo et al. 1992), lagoons and estuaries (Ogilvie and Rose 2003). It may also occur on large lake and river systems south of its breeding range (del Hoyo et al. 1992, Fjeldsa 2004). Diet Its diet consists predominantly of fish and invertebrates such as adult and larval insects (e.g. beetles, dragonflies, mayflies, water bugs, damselflies and caddisflies), crustaceans (del Hoyo et al. 1992) (e.g. brine shrimp, cladocerans, amphipods, decapods (del Hoyo et al. 1992), crayfish (Fjeldsa 2004) and crabs (Konter 2001)), molluscs and worms (del Hoyo et al. 1992). Fish and crustaceans are more important components of the diet during the winter when the species is at sea (del Hoyo et al. 1992). Breeding site The nest is a platform of aquatic vegetation either floating and anchored to emergent vegetation, built from the lake bottom (where water is shallow) or built on rocks at water level (del Hoyo et al. 1992). Management information At a breeding lake in Scotland (Loch Ruthven) sedge beds are being extended to provide more nesting habitat for the species (Ogilvie and Rose 2003).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season, horned grebes live on freshwater lakes that have some open water and some marsh vegetation. They may also nest in marshes, small sloughs, ponds, and occasionally on rivers. Horned grebes spend the winters in coastal saltwater habitats such as protected bays and exposed shores, and occasionally on large freshwater lakes.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season, horned grebes are found predominantly on prairie and boreal freshwater lakes with both open waters and marsh vegetation. They may also nest in marshes, small sloughs with weedy margins, ponds, and occasionally on rivers. Horned grebes overwinter in coastal saltwater habitats such as protected bays and exposed shores, and occasionally on large freshwater lakes.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5356 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.540 - 11.540
  Nitrate (umol/L): 2.924 - 2.924
  Salinity (PPS): 33.014 - 33.014
  Oxygen (ml/l): 6.452 - 6.452
  Phosphate (umol/l): 0.458 - 0.458
  Silicate (umol/l): 2.440 - 2.440
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater lakes and ponds, and coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in winter habitat in West mainly in October, departs for northern breeding areas mostly by April, peak influx in south-central Canada breeding areas early May. May aggregate at staging areas and resting areas during migration. Migrates day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Travel singly to coastal areas in the south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet mainly small fishes, crustaceans and aquatic insects; also amphibians and leeches; aquatic insects predominate in summer, crustaceans and fishes in winter. Forages by diving in shallow water, often near emergent vegetation; also picks food from surface or from vegetation (Terres 1980, Johnsgard 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Horned grebes eat aquatic arthropods in the summer and fish and crustaceans in the winter. They may also occasionally eat Hirudinea, tadpoles, Caudata, and some plant material. Horned grebes capture their prey by diving underwater. They swallow small prey underwater, but bring large items to the surface to eat.

Like most other grebes, horned grebes swallow many feathers. This probably helps them digest fish bones and other sharp objects.

Horned grebes drink water while swimming. They drink by filling their bill with water and tipping their head back to let the water drain into their throat.

Animal Foods: amphibians; fish; insects; mollusks; terrestrial worms; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of horned grebes consists mainly of aquatic arthropods in the summer and fish and crustaceans in the winter. Leeches, tadpoles, salamanders, and some plant material may also be consumed on occasion. On the wintering grounds, mollusks may also be consumed. Horned grebes capture their prey by diving underwater. They swallow small items while underwater, but bring large items to the surface to manipulate before swallowing.

Like most other grebes, horned grebes swallow many feathers. These feathers presumably aid in digestions of sharp objects such as fish bones.

Animal Foods: amphibians; fish; insects; mollusks; terrestrial worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Insects, mostly, also consumes crustaceans, fish, tadpoles, leeches, salamanders, and some plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Horned grebes affect the populations of the animals that they eat. They also compete with some fish species for aquatic invertebrate prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult horned grebes do not have many predators. Incubating adults are vulnerable while on the nest, and may be killed by Mustela vison or other predators.

Horned grebe eggs are eaten by Procyon lotor, Corvus, Pica pica, Fulica americana and Larus.

Known Predators:

  • American minks (Mustela_vison)
  • crows (Corvus)
  • black-billed magpies (Pica_pica)
  • American coots (Fulica_americana)
  • gulls (Larus)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Horned grebes affect the populations of the animals that they eat. They also compete with some fish species for aquatic invertebrate prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Adult horned grebes do not have many predators. Incubating adults are vulnerable while on the nest, and may fall prey to mink or other predators.

Horned grebe eggs are taken by raccoons, crows, black-billed magpies, American coots and various gull species.

Adult horned grebes do not have many predators. Incubating adults are vulnerable while on the nest, and may be killed by mink or other predators.

Horned grebe eggs are eaten by raccoons, crows, black-billed magpies, American coots and gulls.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Primarily nongregarious, except at staging and resting areas prior to and during migration. Predation may result in high nest losses. Size of breeding territory reflects location and abundance of food supply.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Horned grebes use many different physical displays and calls to communicate with each other. Most calls that horned grebes use are to attract and keep their mate or to defend their territory. A breeding pair may call together in duet. They are mostly silent during the winter.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Horned grebes exhibit very complex and varied physical displays that they use to communicate with one another. They also use vocalizations to communicate, particularly during the breeding season. Most of the vocalizations relate to the establishment and maintenance of the pair bond, and to territory and brood defense. Members of a breeding pair sometimes trill in duet.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild horned grebes lived at least five years and two months.

Range lifespan

Status: wild:
5.2 (high) years.

Average lifespan

Status: wild:
62 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The oldest known wild horned grebes lived at least five years and two months.

Range lifespan

Status: wild:
5.2 (high) years.

Average lifespan

Status: wild:
62 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Oldest banded individual was 7 years of age (http://www.euring.org/data_and_codes/longevity.htm). Maximum longevity in this species may be considerably underestimated, however, in part because a relatively low number of birds is banded every year (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs are laid mid-May to mid-July in southern Canada. Average clutch size is 4-6. Incubation lasts usually 22-25 days, by both sexes. Young are tended by one or both parents, most fledge by 6-7 weeks. Renests if nest destroyed. Usually one pair (sometimes several) per pothole.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Horned grebes begin breeding when they are 1 year old, and usually raise one brood per year. Breeding pairs form in the winter or spring, and may breed together for more than one year. Like other grebes, horned grebes have complex courtship rituals. Both the male and female may perform these displays, and many displays are performed together. For example, the male and female run on top of the water together with their “horn” feathers raised, then dive together, and then run along the water together again with pieces of plant in their bills. These ceremonies are one way that members of a pair communicate with each other.

Mating System: monogamous

Horned grebes begin breeding when they are 1 year old, and usually raise one brood per year. They breed between mid-May and early October. The male and female both build the nest, which is located in shallow water among vegetation. The nest is made of floating wet plant material, and is attached to standing vegetation.

The female lays 3 to 8 (usually 5 to 7) eggs at a rate of approximately one every other day. The eggs are whitish to buff when they are laid, but they quickly become stained red and brown from the nest material. Both parents incubate the eggs for 23 to 24 days. The precocial chicks are able to swim and dive immediately after hatching, but are often seen riding on their parent's back for the first week after they hatch. The parents brood the chicks for about 9 days after hatching, and feed them for up to 14 days. Chicks become independent at 20 to 25 days old, but cannot fly until they are 41 to 50 days old.

Breeding interval: Horned grebes breed once yearly.

Breeding season: Horned grebes breed between mid-May and early October, with peak activity occurring June through August.

Range eggs per season: 3 to 8.

Average eggs per season: 6.

Range time to hatching: 23 to 24 days.

Average fledging age: 0 days.

Range time to independence: 20 to 25 days.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both adults build the nest and incubate the eggs. After the chicks have hatched, horned grebe parents carry them on their backs often for the first 10 days. They also feed the chicks for 10 to 14 days after hatching.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin Company.
  • Bull, J., J. Farrand Jr. 1988. The Audubon Society Field Guide To North American Birds--Eastern Region. New York: Alfred A. Knopf.
  • Collins, H. 1981. Harper & Row's Complete Guide To North American Wildlife--Eastern Edition. New York: Harper & Row Publishers.
  • Ransom, J. 1981. Harper & Row's Complete Field Guide To North American Wildlife--Western Edition. New York: Harper & Row Publishers.
  • Stedman, S. 2000. Horned grebe (Podiceps auritus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 505. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Horned grebes begin breeding when they are 1 year old, and usually raise one brood per year. Pairs form in the winter or spring, and may breed together for more than one season. Like other grebes, horned grebes display complex courtship rituals that involve many different ceremonies and displays. Courtship displays involve posturing by both the male and the female. They rise up on the water to a vertical position, head feathers raised fully. They then dive together, and both come up with bits of weeds carried in the bill. They rush along the water, side by side, carrying the weeds (Kaufman 1996).

Mating System: monogamous

Horned grebes begin breeding when they are 1 year old, and usually raise one brood per year. They breed between mid-May and early October, with peak activity occurring June through August. The nest site is located in shallow water among marsh growth. It is built by both sexes and consists of a floating mass of wet plant material with an indentation in the center for the eggs. The nest is anchored by standing vegetation (Kaufman 1996; Ransom 1981).

The female lays 3 to 8 (usually 5 to 7) eggs at a rate of approximately one every other day. The initially whitish to buff eggs quickly become stained red and brown from the nest material. Both parents incubate the eggs for 23 to 24 days. The precocial chicks are able to swim and dive immediately after hatching, but are commonly seen riding on their parent's back for the first week after hatching. The parents brood the young for approximately 9 days after hatching, and feed them for up to 14 days. Chicks become essentially independent at 20 to 25 days old, but cannot fly until they are 41 to 50 days old.

Breeding interval: Horned grebes breed once yearly.

Breeding season: Horned grebes breed between mid-May and early October, with peak activity occurring June through August.

Range eggs per season: 3 to 8.

Average eggs per season: 6.

Range time to hatching: 23 to 24 days.

Average fledging age: 0 days.

Range time to independence: 20 to 25 days.

Range age at sexual or reproductive maturity (female): 1 (low) years.

Average age at sexual or reproductive maturity (female): 1 years.

Range age at sexual or reproductive maturity (male): 1 (low) years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both adults build the nest and incubate the eggs. After the chicks have hatched, horned grebe parents carry them on their backs often for the first 10 days. They also feed the chicks for 10 to 14 days after hatching.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Kaufman, K. 1996. Lives of North American Birds. Boston: Houghton Mifflin Company.
  • Bull, J., J. Farrand Jr. 1988. The Audubon Society Field Guide To North American Birds--Eastern Region. New York: Alfred A. Knopf.
  • Collins, H. 1981. Harper & Row's Complete Guide To North American Wildlife--Eastern Edition. New York: Harper & Row Publishers.
  • Ransom, J. 1981. Harper & Row's Complete Field Guide To North American Wildlife--Western Edition. New York: Harper & Row Publishers.
  • Stedman, S. 2000. Horned grebe (Podiceps auritus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 505. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest is built by both sexes in shallow water among marsh vegetation. 4-6 eggs, incubated by both partners for 22-25 days. Young are fed by both parents, can swim or ride on parents' backs. First capable of flight around 55-60 days.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Podiceps auritus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Podiceps auritus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCACAAAGACATTGGCACCCTATACCTAATCTTTGGCGCATGAGCCGGCATAGTCGGCACAGCTCTAAGCCTACTCATCCGTGCAGAACTAGGCCAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAATGTAATCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATTGGAGGATTTGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCACCATCCTTCTTACTCCTCCTAGCTTCATCAACAGTAGAAGCTGGAGCAGGTACAGGATGAACTGTATACCCACCATTAGCTGGTAACCTAGCCCATGCTGGCGCCTCAGTAGACCTAGCCATTTTCTCACTCCACCTAGCAGGTGTATCCTCCATCCTAGGAGCAATTAACTTCATCACAACTGCCATCAACATAAAACCACCAGCCCTCTCACAGTACCAAACCCCCCTATTCGTATGATCCGTACTCATTACCGCCGTCCTACTACTACTCTCACTCCCAGTCCTTGCCGCTGGCATTACCATATTACTAACAGACCGAAACCTAAATACTACATTCTTCGACCCTGCTGGAGGTGGAGATCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTCCCAGGATTTGGAATTATCTCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of horned grebes appear to have declined in recent decades. Loss of wetland habitat is a threat to horned grebe populations. Oil spills and pesticide accumulation in their aquatic habitats also hurt horned grebe populations. Other threats to horned grebes include accidentally eating plastics and lead, and becoming tangled in fishing nets.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of horned grebes appear to have declined in recent decades, but solid data is lacking (Kaufman 1996). Habitat loss and degradation are major threats to horned grebe populations. Drought-related loss of wetlands greatly affects horned grebes. Oil spills and pesticide accumulation in their aquatic habitats also negatively affect horned grebe populations. Other threats to horned grebes include ingestion of plastics and lead and entanglement in fishing nets.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.140,000-1,100,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.50-1,000 individuals on migration and < c.50 wintering individuals in China and c.100-100,000 breeding pairs and c.50-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats to the species are human disturbance, forestry operations around breeding lakes (e.g. afforestation leading to hydrological changes and resulting in reduced numbers of invertebrate prey), fluctuating water levels, and the stocking of lakes with rainbow trout Salmo gairdneri (which competes with the species for aquatic insects) (del Hoyo et al. 1992). Historical range contractions have also occurred due to acidification and increased humus content of lakes, and the species is vulnerable to hypertrophication (Fjeldsa 2004). It is commonly caught and accidentally drowning in fishing nets (del Hoyo et al. 1992) and is particularly vulnerable to oil spills in the marine environment during the winter (del Hoyo et al. 1992, Ogilvie and Rose 2003, Fjeldsa 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Horned grebes feed on small fish, some of which may be economically important species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Horned grebes have no known affect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Horned grebes feed on small fish, some of which may be economically important species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Horned grebes have no known affect on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Horned grebe

The horned grebe (Podiceps auritus)[2] is a member of the grebe family of water birds. It is also known as the Slavonian grebe. It is an excellent swimmer and diver, and pursues its fish prey underwater. P. auritus is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.

Description[edit]

The horned grebe is a small grebe at 31–38 cm (12–15 in) long with a 46–55 cm (18–22 in) wingspan. Unmistakable in summer, the plumage of both male and female includes a black head with brown puffy earlike tufts along the sides of its face. It shows a deep red neck, scarlet eyes, and a small, straight black bill tipped with white. It rides high in the water.

Breeding[edit]

Eggs

Horned grebes breed in vegetated areas of freshwater lakes across Europe and Asia. It also breeds in remote inland parts of the United States and much of Canada. Most birds migrate in winter to the coast. During this time, this small grebe is mainly white with a sharply defined black cap. During breeding, the male's call is heard as an odd, striking series of loud croaks and chattering notes followed by prolonged shrieks.

Like all grebes, it builds a nest on the water's edge, since its legs are set very far back and it cannot walk well. Usually two eggs are laid, and the striped young are sometimes carried on the adult's back.

In culture[edit]

"The Sclavonian Grebe" in Thomas Bewick's A History of British Birds, Volume 2 "Water Birds". 1847 edition.
Nonbreeding plumage

Folk names of this bird include devil-diver, hell-diver, pink-eyed diver, and water witch. Its name is often abbreviated by British birders to "Slav grebe" or simply "Slav".

In the lore of the Blackfeet, the trickster Old Man tricked several ducks into closing their eyes and dancing while he killed them one by one. However, the smallest duck looked, saw Old Man, and alerted the other ducks. This "duck" was the horned grebe, who became the first to notice trouble.[3]

References[edit]

  1. ^ BirdLife International (2012). "Podiceps auritus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Etymology: Podiceps: Latin for podicis (rump) and pedis (foot), referring to the placement of the legs on its body; auritus: Latin for eared.
  3. ^ Weidensaul, Scott (2007). Of a Feather: A Brief History of American Birding. New York: Harcourt, Inc. p. 8. ISBN 978-0-15-101247-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!