Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Range

Coastal e Siberia and n N America; winters to Japan, s Baja.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Pacific Loon can be found in the tundra regions of Alaska (USA) and northern Canada, on the northern tip of the United Kingdom, across Scandinavia to the far east of Russia. During winter its range expands to include the Pacific coast of Asia down to eastern China and North America down to Baja California (Mexico), much of the northern European coast and areas of the Mediterranean, Adriatic, Black and Caspian Seas1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Pacific Loon is found along the Western Coast of the United States during the fall and winter, and in Northern Canada and Alaska where they migrate for the breeding months of the spring and summer.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: eastern Siberia from Arctic coast south to Anadyrland; Arctic coast of Alaska and Canada east to Baffin Island, south to southern Alaska, southwestern Yukon, northern Manitoba, and northwestern Quebec. WINTERS: south to Japan and along Pacific coast of North America south to Baja California and southern Sonora. In North America, areas of highest winter density include British Columbia around Vancouver Island, Monterey Bay in California, and near Point Whiteshed in Alaska (Root 1988). Casual/uncommon migrant inland in western U.S., very rare on east coast (NGS 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Pacific Loon's head is black which extends down the back of its neck and back where there are some mottled white spots. On its underside the color is white extending from its bill to its belly. Its average length is 66 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 66 cm

Weight: 1659 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Arctica has more white on the flanks at the waterline than does G. PACIFICA (see McCaskie et al. 1990, Roberson 1989, and Schulenberg 1989 for further details).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species breeds on fairy large, deep freshwater lakes and winters on inshore waters along sheltered coasts, as well as occasionally inland. It feeds mostly on fish, but also on aquatic insects, molluscs, crustaceans and some plant matter. Fish are caught under water by means of pursuit-diving. Breeding begins in March in the south of its range, and depends on the timing of spring in the north. Nesting is solitary on heaps of plant matter near the water's edge1.

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Loons reside for the most part along the eastern coast of the Pacific Ocean and Arctic Ocean along Canada's northern boundary. They can also be found in inland waterways and even lakes occurring along their migratory paths. They are sensitive to disturbances, especially those created by humans, and are most likely to occur in remote areas. Their nest are found right along the shoreline and will be abandoned if receding waters cause the nest to be too far from the edge of the water. Recently loons have become a pest on lakes that are commercially stocked with fish.

Aquatic Biomes: lakes and ponds; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1643 specimens in 1 taxon.
Water temperature and chemistry ranges based on 105 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.490 - 16.316
  Nitrate (umol/L): 0.240 - 3.951
  Salinity (PPS): 32.851 - 33.496
  Oxygen (ml/l): 5.685 - 6.169
  Phosphate (umol/l): 0.330 - 0.674
  Silicate (umol/l): 1.436 - 6.162

Graphical representation

Temperature range (°C): 12.490 - 16.316

Nitrate (umol/L): 0.240 - 3.951

Salinity (PPS): 32.851 - 33.496

Oxygen (ml/l): 5.685 - 6.169

Phosphate (umol/l): 0.330 - 0.674

Silicate (umol/l): 1.436 - 6.162
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Nonbreeding: primarily seacoasts, bays and estuaries, less frequently on lakes and rivers (AOU 1983). In winter off central California, generally stays 2-8 km offshore (see Root 1988). In spring in southern California, migrants may be attracted to cool waters near the frontal boundaries of upwelling plumes, where loon prey is attracted by concentrations of zooplankton (Russell and Lehman 1994).

Nests on lakes/ponds in tundra or taiga. Usually nests on largest pond available (0.2-21 ha in one study area); selects ponds with islands or wet grassy areas. Nests on ground in scrape or on mound of material on ground in or very near water. Prefers to nest on island or at end of point extending into water (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Highly migratory (small flocks); some travel 12,000 miles/years (Oberholser 1974); others move only to coastal waters near breeding range. Main migration in California: November-early December, late April-May; in southern California, spring migration peaks sometimes between mid-April and early May (Russell and Lehman 1994). Arrives southeastern Alaska by early May, arctic coast early June (sometimes late May). Peak fall migration in arctic Alaska late August-September (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Pacific Loon feeds mainly on small fish and other aquatic life. Fishing is conducted beneath the surface where they make good use of well-developed air sacs, which allow them to pursue their prey for extended periods.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on fishes as well as crustaceans, mollusks, and aquatic insects; also eats aquatic seeds and some aquatic vegetation. Small shoal fishes often important in winter. Food obtained underwater during dives usually less than 1 minute. In some areas, nesting birds feed in lakes and ponds adjacent to their nest sites; in other areas, they make regular foraging flights to nearshore marine waters (Andres 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Occurs singly, in pairs, or small groups. In winter off California, usually solitary or in pairs. Overall breeding density on arctic coastal plain estimated at about 1 pair per 200 ha; 5 nests observed on 1 pond of 21 ha (Johnsgard 1987). Egg predation by foxes, jaegers, and gulls sometimes is significant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Pacific Loons are monogamous as long as the relationship is producing offspring. Breeding takes place in the spring and summer and is relatively noncompetitive once a mate is found for the males defend territories and mate with the same female each year. Loons are extremely awkward on land and venture out of the water only to nest. Broods usually include a total of two eggs, one of which is laid a few weeks before the second. This first egg also is the first to hatch, and it is brooded while the other egg is incubated. The older offspring assumes the dominant position in the nest and will be the first to be feed throughout its development. During times of inadequate food resources parents commonly continue feeding their older offspring, leading to the death of its younger sibling.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding begins in early May in south, to mid-June in north. Both adults, in turn, incubate usually 2 eggs, 28-29 days. Hatching occurs in second half of July around Beaufort Sea (Johnson and Herter 1989). Young are tended by both parents, first fly at about 2 months, independent by about 3 months. Pair-bond apparently is life-long. Nest density is up to 2.6 per sq km in Alaska (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gavia pacifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGACTATTCTCAACTAACCACAAAGATATCGGCACACTGTACCTTATCTTCGGGGCATGGGCCGGCATAGTCGGAACTGCCCTTAGCCTACTCATCCGTGCAGAGCTCGGACAACCAGGAACCCTCCTAGGAGAC---GACCAAATCTATAACGTAATTGTTACTGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATACCTATTATAATCGGGGGATTTGGAAACTGACTAGTCCCCCTTATAATCGGTGCTCCCGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCGGGAGCAGGTACAGGCTGAACCGTATATCCCCCATTAGCTGGCAATCTCGCCCATGCTGGAGCCTCAGTAGACTTAGCCATTTTCTCCCTCCACCTAGCAGGCGTATCCTCTATCTTAGGGGCAATTAACTTCATCACAACCGCCATTAACATAAAACCTCCAGCCCTCTCACAATATCAAACCCCCCTATTCGTATGATCAGTCCTCATTACAGCTGTCCTGCTCCTACTCTCACTCCCAGTCCTCGCTGCTGGTATTACCATATTACTAACAGACCGAAACCTAAATACTACATTCTTCGACCCAGCCGGAGGAGGAGACCCGGTTCTATACCAACATTTATTCTGATTCTTTGGCCACCCAGAAGTATACATCCTGATTCTACCAGGCTTCGGAATTATCTCACATGTAGTAACATACTATGCAGGTAAGAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTGTCCATTGGATTTCTAGGCTTCATCGTATGAGCCCACCACATGTTTACAGTCGGAATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gavia pacifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Loons are found in low concentrations during the winter months and in higher densities during the breeding months. This loon is combating human pressures well, but populations may decrease in the future. Recent studies are looking into the magnification of chemicals in the loon's body due to pollutants being added to the ecosystem and the loon being near the top of its food chain. The Pacific Loon's range is growing smaller as human development encroaches on its preferred habitats.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4N,N5B : N4N: Apparently Secure - Nonbreeding, N5B: Secure - Breeding

United States

Rounded National Status Rank: N5B,N4N : N5B: Secure - Breeding, N4N: Apparently Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Loons may be considered pests by commercial fishermen, who see them as competitors

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Loons are aesthetically pleasing to observe in the nature and they are well known for their distinctive calls, which commonly occur at night.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific Loon

In Alaska

The Pacific Loon or Pacific Diver (Gavia pacifica), is a medium-sized member of the loon, or diver, family. It may be conspecific with Black-throated Diver/Arctic Loon, which it closely resembles.

It breeds on deep lakes in the tundra region of Alaska and northern Canada as far east as Baffin Island, and in Russia east of the Lena River.

Unlike other loons/divers, this bird may migrate in flocks. It winters at sea, mainly on the Pacific coast, or on large lakes over a much wider range, including China, Japan, North Korea, South Korea, USA and Mexico. It has occurred as a vagrant to Greenland, Hong Kong, Great Britain, Spain, and Finland.[2]

Breeding adults are like a smaller sleeker version of Great Northern Diver/Common Loon. They measure 58–74 cm (23–29 in) in length, 110–128 cm (43–50 in) in wingspan and weigh 1–2.5 kg (2.2–5.5 lb).[3] They have a grey head, black throat, white underparts and chequered black-and-white mantle. Non-breeding plumage is drabber with the chin and foreneck white. Its bill is grey or whitish and dagger-shaped. In all plumages, lack of a white flank patch distinguishes this species from the otherwise very similar Black-throated Diver/Arctic Loon.

This species, like all divers/loons, is a specialist fish-eater, catching its prey underwater. It flies with neck outstretched.

The call is a yodelling high-pitched wailing, as well as harsh growls and barks.

Pacific Loon

Contents

Habitat and range

The Pacific Loon breeds on tundra lakes, and winters in the open ocean or other large bodies of water. It breeds primarily in northern Canada and eastern Siberia, and winters along the Pacific coast of North America.[4]

References

Further reading

The following articles deal with separation of Pacific Diver/Pacific Loon from Black-throated Diver/Arctic Loon:

  • Birch, A. and Lee, C-T, 1997, Field identification of Arctic and Pacific Loons, Birding 29: 106-115.
  • Birch, A and Lee, C-T, 1995, Identification of the Pacific Diver - a potential vagrant to Europe, Birding World 8: 458-466.
  • Harrison, Peter (1988). Seabirds: An Identification Guide. London: Christopher Helm. ISBN 0-7470-1410-8
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Frequently regarded as a subspecies of Arctica, but currently considered a distinct species (AOU 1985, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!