Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Range

Alpine lakes in central Asia; winters to India and Myanmar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anser indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCACAAAGACATTGNCACCCTATACCTCATCTTCGGGGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGAACTCTCCTAGGCGACGACCAAATTTACAATGTAATCGTTACCGCTCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATAATTGGAGGATTCGGCAACTGATTAGTCCCCCTCATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCATTCCTCCTACTGCTAGCCTCATCCACTGTAGAAGCTGGCGCCGGCACAGGCTGAACTGTCTACCCTCCCCTAGCAGGTAACCTCGCCCACGCCGGAGCTTCAGTAGACCTGGCTATCTTCTCACTCCACTTAGCCGGTATCTCCTCCATCCTTGGAGCCATCAACTTTATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTTGTCTGATCCGTACTAATTACCGCCATCCTACTCCTTCTATCACTCCCCGTACTCGCCGCCGGTATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATCCTACCAGGATTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anser indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
  • 1988
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bar-headed Goose

"Eulabeia" redirects here. For the Greek mythological personification, see Eulabeia (mythology)

The Bar-headed Goose (Anser indicus) is a goose which breeds in Central Asia in colonies of thousands near mountain lakes and winters in South Asia, as far south as peninsular India. It lays three to eight eggs at a time in a ground nest.

Contents

Taxonomy [edit]

The Bar-headed Goose has sometimes been separated from Anser, which has no other member indigenous to the Indian region, nor any at all to the Ethiopian, Australian, or Neotropical regions, and placed in the monotypic genus Eulabeia.

Description [edit]

The bird is pale grey and is easily distinguished from any of the other grey geese of the genus Anser by the black bars on its head. It is also much paler than the other geese in this genus. In flight, its call is a typical goose honking. A mid-sized goose, it measures 71–76 cm (28–30 in) in total length and weighs 1.87–3.2 kg (4.1–7.1 lb).

Ecology [edit]

Swimming at Sylvan Heights Waterfowl Park

The summer habitat is high-altitude lakes where the bird grazes on short grass. The species has been reported as migrating south from Tibet, Kazakhstan, Mongolia and Russia before crossing the Himalaya. The bird has come to the attention of medical science in recent years as having been an early victim of the H5N1 virus, HPAI (highly pathogenic avian influenza), at Qinghai. It suffers predation from crows, foxes, ravens, sea eagles, gulls and others. The total population may, however, be increasing, but it is complex to assess population trends, as this species occurs over more than 2,500,000 km2 (970,000 sq mi).[1]

The Bar-headed Goose is one of the world's highest-flying birds,[2] having been heard flying across Mount Makalu – the fifth highest mountain on earth at 8,481 m (27,825 ft) – and apparently seen over Mount Everest – 8,848 m (29,029 ft) – although this is a second-hand report with no verification.[3] This demanding migration has long puzzled physiologists and naturalists: "there must be a good explanation for why the birds fly to the extreme altitudes... particularly since there are passes through the Himalaya at lower altitudes, and which are used by other migrating bird species."[4] In fact, bar-headed geese have never been directly tracked (using GPS or satellite logging technology) flying higher than 6,540 metres (21,460 ft), and it is now believed that they do take the high passes through the mountains. The challenging northward migration from lowland India to breed in the summer on the Tibetan Plateau is undertaken in stages, with the flight across the Himalaya (from sea-level) being undertaken non-stop in as little as seven hours. Surprisingly, despite predictable tail winds that blow up the Himalayas (in the same direction of travel as the geese), bar-headed geese spurn these winds, waiting for them to die down overnight, when they then undertake the greatest rates of climbing flight ever recorded for a bird, and sustain these climbs rates for hours on end, according to research published in 2011.[5]

The 2011 study found the geese peaking at an altitude of around 6,400 m (21,000 ft).[2] In a 2012 study that tagged 91 geese and tracked their migration routes, it was determined that the geese spent 95% of their time below 5,784 m (18,976 ft), choosing to take a longer route through the Himalayas in order to utilize lower-altitude valleys and passes. Only 10 of the tagged geese were ever recorded above this altitude, and only one exceeded 6,500 m (21,300 ft), reaching 6,540 m (21,460 ft) on an overnight flight, when the air was particularly cool (and therefore dense). While it cannot be ruled out that these geese do sometimes reach higher altitudes, it is suspected by the authors of these two studies that tales of the geese flying at 8,000 m (26,000 ft) are apocryphal.[6]

The Bar-headed Goose migrates over the Himalayas to spend the winter in parts of South Asia (from Assam to as far south as Tamil Nadu.[7] The modern winter habitat of the species is cultivated fields, where it feeds on barley, rice and wheat, and may damage crops. Birds from Kyrgyzstan have been noted to stopover in western Tibet and southern Tajikistan for 20 to 30 days before migrating further south. Some birds may show high wintering site fidelity.[8]

They nest mainly on the Tibetan Plateau. Intraspecific brood parasitism is noticed with lower rank females attempting to lay their eggs in the nests of higher ranking females.[9]

The Bar-headed Goose is often kept in captivity, as it is considered beautiful and breeds readily. Records[clarification needed] in Great Britain are frequent, and almost certainly relate to escapes. However, the species has bred on several occasions in recent years and around five pairs were recorded in 2002, the most recent available report of the Rare Birds Breeding Panel. It is possible the species is becoming gradually more established in Great Britain. The bird is sociable and causes no problems for other birds.[citation needed] The feral population is believed to be declining in Great Britain due to over-hunting.[citation needed]

Physiology and morphology [edit]

Head details

The main physiological challenge of bar-headed geese is extracting oxygen from hypoxic air and transporting it to aerobic muscle fibres in order to sustain flight at high altitudes. Flight is very metabolically costly at high-altitudes because birds need to flap harder in thin air to generate lift.[10] Studies have found that bar-headed geese breathe more deeply and efficiently under low oxygen conditions, which serves to increase oxygen uptake from the environment.[11] The haemoglobin of their blood has a higher affinity for oxygen compared to low-altitude geese,[12] which has been attributed to a single amino acid point mutation.[13] This mutation causes a conformational shift in the haemoglobin molecule from the low oxygen affinity form to the high oxygen affinity form.[14] The left-ventricle of the heart, which is responsible for pumping oxygenated blood to the body via systemic circulation, has significantly more capillaries in bar-headed geese compared with lowland birds, maintaining oxygenation of cardiac muscle cells and thereby cardiac output.[15] Compared to lowland birds, mitochondria (the main site of oxygen consumption) in the flight muscle of bar-headed geese are significantly closer to the sarcolemma,[16] decreasing the intracellular diffusion distance of oxygen from the capillaries to the mitochondria.

Bar-headed geese have a slightly larger wing area for their weight than other geese, which is believed to help them fly at high altitudes.[17] While this decreases the power output required for flight in thin air, birds at high-altitude still need to flap harder than lowland birds.[18]

Gallery [edit]

See also [edit]

References [edit]

  1. ^ a b BirdLife International (2012). "Anser indicus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 26 November 2012. 
  2. ^ a b Than, Ker (June 10, 2011). "Highest Flying Bird Found; Can Scale Himalaya: The Bar-headed Goose Can Reach Nearly 21,120 Feet, New Study Shows". National Geographic News. Washington, DC, US: National Geographic Society. Archived from the original on February 15, 2013. Retrieved February 15, 2013. 
  3. ^ Swan, L. W. (1961). "The Ecology of the High Himalayas". Scientific American 205 (4): 68–78. doi:10.1038/scientificamerican1061-68. 
  4. ^ Black, C. P.; Tenney, S. M. (1980). "Oxygen Transport During Progressive Hypoxia in High-altitude and Sea-level Waterfowl". Respiration Physiology 39 (2): 217–239. doi:10.1016/0034-5687(80)90046-8. PMID 7375742. 
  5. ^ Hawkes, L. A.; Balachandran, S.; Batbayar, N.; Butler, P. J.; Frappell, P. B.; Milsom, W. K.; Tseveenmyadag, N.; Newman, S. H.; Scott, G. R. (2011). "The Trans-Himalayan Flights of Bar-headed Geese (Anser indicus)". Proceedings of the National Academy of Sciences 108 (23): 9516. doi:10.1073/pnas.1017295108. 
  6. ^ Hawkes, L. A.; Balachandran, S.; Batbayar, N.; et al (October 2012). "The Paradox of Extreme High-altitude Migration in Bar-headed Geese Anser indicus". Proceedings of the Royal Society: Biology. doi:10.1098/rspb.2012.2114. PMID 23118436. Retrieved 2012-11-18.  Abstract.
  7. ^ Takekawa, J. Y.; Heath, S. R.; Douglas, D. C.; Perry, W. M.; Javed, S.; Newman, S. H.; Suwal, R. N.; Rahmani, A. R.; houdhury, B. C.; et al. (2009). "Geographic Variation in Bar-headed Geese Anser Indicus: Connectivity of Wintering Areas and Breeding Grounds Across a Broad Front". Wildfowl 59: 100–123. 
  8. ^ Koppen, U; Yakovlev, A. P.; Barth, R.; Kaatz, M.; Berthold, P. (2010). "Seasonal Migrations of Four Individual Bar-headed Geese Anser indicus from Kyrgyzstan Followed by Satellite Telemetry". Journal of Ornithology 151 (3): 703–712. doi:10.1007/s10336-010-0492-1. 
  9. ^ Weigmann, C.; Lamprecht, J. (1991). "Intraspecific Nest Parasitism in Bar-headed Geese, Anser indicus". Animal Behaviour 41 (4): 677–688. doi:10.1016/S0003-3472(05)80905-4. 
  10. ^ Altshuler, D.; Dudley, R. (January 6, 2006). "The physiology and biomechanics of avian flight at high altitude". Integrative and Comparative Biology 46 (1): 62–71. doi:10.1093/icb/icj008. PMID 21672723. 
  11. ^ Milsom, William K.; Scott, Graham (2008). "Respiratory adaptations in the high flying bar-headed goose". Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 148 (4): 460. doi:10.1016/j.cbpc.2008.10.047. 
  12. ^ Liu, X.-Z.; Li, S.-L.; Jing, H.; Liang, Y.-H.; Hua, Z.-Q.; Lu, G.-Y. (2001). "Avian haemoglobins and structural basis of high affinity for oxygen: Structure of bar-headed goose aquomet haemoglobin". Acta Crystallographica Section D: Biological Crystallography 57 (6): 775–783. doi:10.1107/S0907444901004243. 
  13. ^ Jessen, T.; Weber, R.E; Fermi, G; Tame, J; and (August 1, 1991). "Adaptation of bird hemoglobins to high altitudes: demonstration of molecular mechanism by protein engineering.". Proceedings of the National Academy of Sciences 88 (51): 6519–22. PMID 1862080. 
  14. ^ Zhang, J.; Hua, Z; Tame, J.R; Zhang, R; Gu, X. (January 26, 1996). Journal of Molecular Biology 255 (3): 484–93. PMID 8568892. 
  15. ^ Scott, G.R.; Schulte, P.M; Egginton, S; Scott, A.L; Richards, J.G; Milsom, W.K. (January 2011). "Molecular evolution of cytochrome C oxidase underlies high-altitude adaptation in the bar-headed goose.". Molecular Biology Evolution 28 (1): 351–63. doi:10.1093/molbev/msq205. PMID 20685719. 
  16. ^ Scott, G.R.; Egginton, S; Richards, J.G; Milsom, W.K. (October 22, 2009). "Evolution of muscle phenotype for extreme high altitude flight in the bar-headed goose.". Proceedings of the Royal Society B: Biological Sciences 276 (1673): 3645–53. PMID 19640884. 
  17. ^ Lee, S.Y.; Scott, G.R.; Milsom, W.K. (2008). "Have wing morphology or flight kinematics evolved for extreme high altitude migration in the bar-headed goose?". Comparative Biochemistry and Physiology - C Toxicology and Pharmacology 148 (4): 324–331. doi:10.1016/j.cbpc.2008.05.009. 
  18. ^ Altshuler, D.L.; Dudley, R. (September 2003). "Kinematics of hovering hummingbird flight along simulated and natural elevational gradients.". Journal of Experimental Biology 206 (18): 3139–47. PMID 12909695. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!