Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Bar-headed geese (Anser indicus) have a breeding range that stretches from Mongolia south through Russia and Western China to Tibet and as far west as Kyrgyzstan. Approximately 25% of the global population of bar-headed geese winter on the southern Tibetan-Qinghai Plateau. Another wintering area for a portion of the population is India and Bangladesh.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Guo-Gang, Z., L. Dong-Ping, H. Yun-Qiu, J. Hong-Xing, D. Ming, Q. Fa-Wen, L. Jun, X. Zhi, L. Feng-Shan. 2011. Migration Routes and Stop-Over Sites Determined with Satellite Tracking of Bar-Headed Geese Anser indicus Breeding at Qinghai Lake, China. Waterbirds, 34(1): 112-116. Accessed August 05, 2012 at http://www.bioone.org/doi/full/10.1675/063.034.0115.
  • Takekawa, J., S. Heath, D. Douglas, W. Perry, Javed Salim, S. Newman. 2009. Geographic variation in Bar-headed Geese Anser indicus: connectivity of wintering areas and breeding grounds across a broad front. Wildfowl, 59: 100-123. Accessed August 05, 2012 at https://www.wwt.org.uk/userfiles/files/11_Takekawa_pp100_123.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Alpine lakes in central Asia; winters to India and Myanmar.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Bar-headed geese have grey bodies, with orange legs and a black and white neck. This species is named for the obvious black U-shaped bars on the back of the white head. They weigh between 2 and 3 kg (4.5 and 6.5 lbs) with a wingspan between 140 and 160 cm (55 and 62 inch), and are between 68 and 78 cm (27 and 30 inch) in length. Bar-headed geese have a basal metabolic rate of 756 cubic centimeters of oxygen per hour.

Range mass: 2.0 to 3.0 kg.

Range length: 68 to 78 cm.

Range wingspan: 140 to 160 cm.

Average basal metabolic rate: 756 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Tammelin, H. 2012. "Bar-headed Goose" (On-line). NatureGate. Accessed August 09, 2012 at http://www.luontoportti.com/suomi/en/tekijat/.
  • Ward, S., C. Bishop, A. Woakes, P. Butler. 2002. Heart rate and the rate of oxygen consumption of flying and walking barnacle geese (Branta leucopsis) and bar-headed geese (Anser indicus). The Journal of Experimental Biology, 205: 3347–3356.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Bar-headed geese can be found at high elevations. They use habitats like mountain grasslands and crop fields from surrounding villages. Bar-headed geese tend to use freshwater marshes, lakes, and streams that are around elevations of 4,000 to 6,000 meters above sea level as stop-over and over-wintering sites. Some geese have even been reported to migrate at altitudes of 9,000 meters when they cross the Himalaya Mountains.

Range elevation: Sea Level to 6,000 m.

Habitat Regions: temperate ; terrestrial ; freshwater

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Wetlands: marsh

Other Habitat Features: agricultural

  • Middleton, B. 1992. Habitat and Food Preferences of Greylag and Barheaded Geese Wintering in the Keoladeo National Park, India. Journal of Tropical Ecology, 8 No.2: 181-193. Accessed August 05, 2012 at http://www.jstor.org/stable/2559700.
  • Scott, G., S. Egginton, J. Richards, W. Milsom. 2009. Evolution of muscle phenotype for extreme high altitude flight in the bar-headed goose. Proc Biol Sci, 276(1673): 3645-3653.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Bar-headed geese generally feed on the highland grasses surrounding their lakes and streams where they nest. During other times of the year they can be found eating on agricultural crops such as corn, wheat, barley, and rice.

Animal Foods: fish; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts

Primary Diet: herbivore (Folivore , Granivore )

  • Akbar, M., R. Khan, S. Mehboob, Z. Nisa. 2005. Wildlife of Border Belt Game Reserve District Narowal, Punjab, Pakistan. Pak. j. life soc. sci., 3(1-2): 13-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

These geese are prey for animals such as red foxes, and golden eagles. Some can also be parasites by using higher ranked females as hosts to raise their offspring. In addition they are also carriers of the H5N1 virus and capable of passing the virus to humans, and other animals as well. They assist in the dispersal of grass seeds they eat throughout the year.

Ecosystem Impact: disperses seeds

  • Cui, P., Y. Hou, a. et.. 2011. Bird Migration and Risk for H5N1 Transsmission into Qinghai Lake, China. Vector Bome Zoonotic Dis., 11(5): 567-576. Accessed August 09, 2012 at http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3096498/?tool=pmcentrez.
  • Weigmann, C., J. Lamprecht. 1991. Intraspecific nest parasitism in bar-headed geese, Anser indicus. Animal Behaviour, 41: 677-688.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From the air the bar-headed geese are prey for sea eagles, golden eagles, crows, and ravens. On the ground the geese are preyed upon by red foxes. Some of the adaptations the geese have developed is the ability to survive at high altitudes. This limits the amount of ground predators that can reach them. They can survive at high altitudes because they have a higher density of capillaries that are spaced closer together this allows them to deliver more oxygen to their muscles, in particular their flight muscles. In addition to their capillaries they also have hemoglobin in their blood that is more efficient at taking in oxygen. Another adaptation is that these geese tend to live in large colonies or smaller family groups which enhances predator detection.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like most geese, bar-headed geese fly in "V"-shaped formations. When the lead bird gets tired they fall to the back of the formation and another goose takes the lead. The formation can vary from a traditional V to other shapes like "J"-shape and the echeleon shape where one arm of the "V"-shape is missing. The benefit of this style of flight is that each individual flies with reduced drag, which in turn saves them energy. They use vocal communications and visual cues to maintain their spacing while flying in these formations. This also assists them in staying in closely related family groups as they move from traditional feeding and breeding areas. Like other waterfowl they can also see in the ultraviolet spectrum of light.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; ultraviolet; tactile ; acoustic ; chemical ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little information is published on the lifespan of bar-headed geese. Like most geese they are long-lived. A close relative, greylag geese, have a lifespan of 20 years in the wild and the oldest one in captivity lived 31 years.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
20 years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits.. Journal of Evolutionary Biology, 22(8): 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bar-headed geese are seasonal breeders. They exhibit a monogamous mating system, where males pair with one single female for several years. During times when the population is biased towards females a polygynous system is adopted where a monogamous pair may be joined by multiple secondary females. These secondary females also breed with the male of the pair. Because they breed in large colonies, females defend their nests from socially lower females that may be using brood parasitism to increase the likely hood of their offspring's survival.

Mating System: monogamous ; polygynous

Bar-headed geese typically breed on an annual basis. This occurs during the spring. Nesting occurs from the last week of April until June. They typically lay 3 to 8 eggs on average. After 28 to 30 days the goslings hatch. There was little information on the birth mass of the goslings. They then fledge by 55 to 60 days, and reach sexual maturity at 3 years of age. Bar-headed geese tend to breed on the Tibetan-Qinghai Plateau. They lay their eggs in ground nests at high elevations in the highland marshes and lakes.

Breeding interval: Bar-headed geese breed annually (once yearly).

Breeding season: Bar-headed geese breed in the last week of April through July.

Range eggs per season: 3 to 8.

Range time to hatching: 28 to 30 days.

Range fledging age: 55 to 60 days.

Range time to independence: 55 to 60 days.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Bar-headed geese use biparental care when raising young. Studies show that male bar-headed geese are more alert and defensive when in the presence of their goslings. These same studies show that the goslings have the added benefit of an increased survival rate from having both parents. Both parents provide their goslings with protection from predators and other geese. In addition to that the parents also protect the goslings' food.

Parental Investment: precocial ; male parental care ; female parental care

  • Friedl, T. 1993. Intraclutch Egg-Mass Variation in Geese: Mechanism for Brood Reduction in Precocial Birds. The Auk, 110(1): 129-132. Accessed August 09, 2012 at http://library.unm.edu/sora/Auk/v110n01/p0129-p0132.pdf.
  • Lamprecht, J. 1987. Female Reproductive Strategies in Bar-headed Geese (Anser indicus): Why Are Geese Monogamous?. Behavioral Ecology and Socialbiology, 21(5): 297-305. Accessed August 06, 2012 at http://www.jstor.org/stable/4600095.
  • Prins, H., S. van Wieren. 2004. Number, population structure and habitat use of bar-headed geese Aniser indicus in Ladakh (India) during the brood-rearing period. Acta Zoologica Sinica, 50(5): 738-744.
  • Schneider, J., J. Lamprecht. 1990. The importance of biparental care in a precoial, monogamous bird, the bar-headed goose (Aniser indicus). Behavioral Ecology and Socialbiology, 27: 415-419. Accessed August 07, 2012 at http://www.jstor.org.ezproxy.uwsp.edu/stable/pdfplus/4600500.pdf.
  • Takekawa, J., S. Heath, D. Douglas, W. Perry, Javed Salim, S. Newman. 2009. Geographic variation in Bar-headed Geese Anser indicus: connectivity of wintering areas and breeding grounds across a broad front. Wildfowl, 59: 100-123. Accessed August 05, 2012 at https://www.wwt.org.uk/userfiles/files/11_Takekawa_pp100_123.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anser indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCACAAAGACATTGNCACCCTATACCTCATCTTCGGGGCATGAGCAGGAATAGTCGGCACCGCACTCAGCCTATTAATCCGCGCAGAACTAGGACAACCAGGAACTCTCCTAGGCGACGACCAAATTTACAATGTAATCGTTACCGCTCACGCCTTTGTAATAATCTTCTTTATAGTCATACCCATCATAATTGGAGGATTCGGCAACTGATTAGTCCCCCTCATAATCGGTGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCATTCCTCCTACTGCTAGCCTCATCCACTGTAGAAGCTGGCGCCGGCACAGGCTGAACTGTCTACCCTCCCCTAGCAGGTAACCTCGCCCACGCCGGAGCTTCAGTAGACCTGGCTATCTTCTCACTCCACTTAGCCGGTATCTCCTCCATCCTTGGAGCCATCAACTTTATCACCACAGCCATCAACATAAAACCCCCCGCACTCTCACAATACCAAACCCCACTATTTGTCTGATCCGTACTAATTACCGCCATCCTACTCCTTCTATCACTCCCCGTACTCGCCGCCGGTATTACAATATTACTAACTGACCGAAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTATATCCTAATCCTACCAGGATTTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anser indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Bar-headed geese are listed on the IUCN Red List as Least Concerned. They have no special status under the US Migratory Bird Act or on the US Federal List because there is no population living in the US. Nor are they protected under the US Endangered Species Act. CITES contains no special status for the species either.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bar-headed geese were one of the first species to show signs of the H5N1 (Bird Flu) virus. In addition to carrying the virus the geese are also pests to the local villagers. Since they feed on the wheat, rice, and other crops around their roosting areas, they can cause damage to farm fields.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These geese benefit humans because of ecotourism to the wildlife areas that they use as refueling stops during their migrations. "The East Calcutta Wetlands in Western Bengal (a stop over site for migrating Bar-headed Geese) has environmental benefits worth 38.54 million dollars"(Bhattacharyya et al., 2008).

Positive Impacts: ecotourism

  • Bhattacharyya, A., S. Sen, P. Roy, A. Mazumdar. 2008. A Critical Study on Status of East Kolkata Wetlands with Special Emphasis on Water Birds as Bio-Indicator. Proceedings of Taal2007: The 12th World Lake Conference, 12: 1561-1570.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bar-headed goose

"Eulabeia" redirects here. For the Greek mythological personification, see Eulabeia (mythology)

The bar-headed goose (Anser indicus) is a goose that breeds in Central Asia in colonies of thousands near mountain lakes and winters in South Asia, as far south as peninsular India. It lays three to eight eggs at a time in a ground nest.

Taxonomy[edit]

The bar-headed goose has sometimes been separated from Anser, which has no other member indigenous to the Indian region, nor any at all to the Ethiopian, Australian, or Neotropical regions, and placed in the monotypic genus Eulabeia.

Description[edit]

The bird is pale grey and is easily distinguished from any of the other grey geese of the genus Anser by the black bars on its head. It is also much paler than the other geese in this genus. In flight, its call is a typical goose honking. A mid-sized goose, it measures 71–76 cm (28–30 in) in total length and weighs 1.87–3.2 kg (4.1–7.1 lb).

Ecology[edit]

Swimming at Sylvan Heights Waterfowl Park

The summer habitat is high-altitude lakes where the bird grazes on short grass. The species has been reported as migrating south from Tibet, Kazakhstan, Mongolia and Russia before crossing the Himalaya. The bird has come to the attention of medical science in recent years as having been an early victim of the H5N1 virus, HPAI (highly pathogenic avian influenza), at Qinghai. It suffers predation from crows, foxes, ravens, sea eagles, gulls and others. The total population may, however, be increasing, but it is complex to assess population trends, as this species occurs over more than 2,500,000 km2 (970,000 sq mi).[1]

The bar-headed goose is one of the world's highest-flying birds,[2] having been heard flying across Mount Makalu – the fifth highest mountain on earth at 8,481 m (27,825 ft) – and apparently seen over Mount Everest – 8,848 m (29,029 ft) – although this is a second-hand report with no verification.[3] This demanding migration has long puzzled physiologists and naturalists: "there must be a good explanation for why the birds fly to the extreme altitudes... particularly since there are passes through the Himalaya at lower altitudes, and which are used by other migrating bird species."[4] In fact, bar-headed geese have never been directly tracked (using GPS or satellite logging technology) flying higher than 6,540 metres (21,460 ft), and it is now believed that they do take the high passes through the mountains. The challenging northward migration from lowland India to breed in the summer on the Tibetan Plateau is undertaken in stages, with the flight across the Himalaya (from sea-level) being undertaken non-stop in as little as seven hours. Surprisingly, despite predictable tail winds that blow up the Himalayas (in the same direction of travel as the geese), bar-headed geese spurn these winds, waiting for them to die down overnight, when they then undertake the greatest rates of climbing flight ever recorded for a bird, and sustain these climbs rates for hours on end, according to research published in 2011.[5]

The 2011 study found the geese peaking at an altitude of around 6,400 m (21,000 ft).[2] In a 2012 study that tagged 91 geese and tracked their migration routes, it was determined that the geese spent 95% of their time below 5,784 m (18,976 ft), choosing to take a longer route through the Himalayas in order to utilize lower-altitude valleys and passes. Only 10 of the tagged geese were ever recorded above this altitude, and only one exceeded 6,500 m (21,300 ft), reaching 7,290 m (23,920 ft). All but one of these high altitude flights were recorded at night, which along with the early morning, is the most common time of day for geese migration. The colder denser air during these times may be equivalent to an altitude hundreds of meters lower. It is suspected by the authors of these two studies that tales of the geese flying at 8,000 m (26,000 ft) are apocryphal.[6]

The bar-headed goose migrates over the Himalayas to spend the winter in parts of South Asia (from Assam to as far south as Tamil Nadu.[7] The modern winter habitat of the species is cultivated fields, where it feeds on barley, rice and wheat, and may damage crops. Birds from Kyrgyzstan have been noted to stopover in western Tibet and southern Tajikistan for 20 to 30 days before migrating further south. Some birds may show high wintering site fidelity.[8]

They nest mainly on the Tibetan Plateau. Intraspecific brood parasitism is noticed with lower rank females attempting to lay their eggs in the nests of higher ranking females.[9]

The bar-headed goose is often kept in captivity, as it is considered beautiful and breeds readily. Records[clarification needed] in Great Britain are frequent, and almost certainly relate to escapes. However, the species has bred on several occasions in recent years and around five pairs were recorded in 2002, the most recent available report of the Rare Birds Breeding Panel. It is possible the species is becoming gradually more established in Great Britain. The bird is sociable and causes no problems for other birds.[citation needed] The feral population is believed to be declining in Great Britain due to over-hunting.[citation needed]

Physiology and morphology[edit]

Head details

The main physiological challenge of bar-headed geese is extracting oxygen from hypoxic air and transporting it to aerobic muscle fibres in order to sustain flight at high altitudes. Flight is very metabolically costly at high-altitudes because birds need to flap harder in thin air to generate lift.[10] Studies have found that bar-headed geese breathe more deeply and efficiently under low oxygen conditions, which serves to increase oxygen uptake from the environment.[11] The haemoglobin of their blood has a higher affinity for oxygen compared to low-altitude geese,[12] which has been attributed to a single amino acid point mutation.[13] This mutation causes a conformational shift in the haemoglobin molecule from the low oxygen affinity form to the high oxygen affinity form.[14] The left-ventricle of the heart, which is responsible for pumping oxygenated blood to the body via systemic circulation, has significantly more capillaries in bar-headed geese compared with lowland birds, maintaining oxygenation of cardiac muscle cells and thereby cardiac output.[15] Compared to lowland birds, mitochondria (the main site of oxygen consumption) in the flight muscle of bar-headed geese are significantly closer to the sarcolemma,[16] decreasing the intracellular diffusion distance of oxygen from the capillaries to the mitochondria.

Bar-headed geese have a slightly larger wing area for their weight than other geese, which is believed to help them fly at high altitudes.[17] While this decreases the power output required for flight in thin air, birds at high-altitude still need to flap harder than lowland birds.[18]

Gallery[edit]

See also[edit]

References[edit]

  1. ^ a b BirdLife International (2012). "Anser indicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Than, Ker (June 10, 2011). "Highest Flying Bird Found; Can Scale Himalaya: The Bar-headed Goose Can Reach Nearly 21,120 Feet, New Study Shows". National Geographic News. Washington, DC, US: National Geographic Society. Archived from the original on February 15, 2013. Retrieved February 15, 2013. 
  3. ^ Swan, L. W. (1961). "The Ecology of the High Himalayas". Scientific American 205 (4): 68–78. doi:10.1038/scientificamerican1061-68. 
  4. ^ Black, C. P.; Tenney, S. M. (1980). "Oxygen Transport During Progressive Hypoxia in High-altitude and Sea-level Waterfowl". Respiration Physiology 39 (2): 217–239. doi:10.1016/0034-5687(80)90046-8. PMID 7375742. 
  5. ^ Hawkes, L. A.; Balachandran, S.; Batbayar, N.; Butler, P. J.; Frappell, P. B.; Milsom, W. K.; Tseveenmyadag, N.; Newman, S. H.; Scott, G. R. (2011). "The Trans-Himalayan Flights of Bar-headed Geese (Anser indicus)". Proceedings of the National Academy of Sciences of the United States of America 108 (23): 9516. doi:10.1073/pnas.1017295108. 
  6. ^ Hawkes, L. A.; Balachandran, S.; Batbayar, N.; et al (October 2012). "The Paradox of Extreme High-altitude Migration in Bar-headed Geese Anser indicus". Proceedings of the Royal Society B 280 (1750): 20122114. doi:10.1098/rspb.2012.2114. PMID 23118436. Retrieved 2012-11-18. Abstract.
  7. ^ Takekawa, J. Y.; Heath, S. R.; Douglas, D. C.; Perry, W. M.; Javed, S.; Newman, S. H.; Suwal, R. N.; Rahmani, A. R.; houdhury, B. C.; et al. (2009). "Geographic Variation in Bar-headed Geese Anser Indicus: Connectivity of Wintering Areas and Breeding Grounds Across a Broad Front". Wildfowl 59: 100–123. 
  8. ^ Koppen, U; Yakovlev, A. P.; Barth, R.; Kaatz, M.; Berthold, P. (2010). "Seasonal Migrations of Four Individual Bar-headed Geese Anser indicus from Kyrgyzstan Followed by Satellite Telemetry". Journal of Ornithology 151 (3): 703–712. doi:10.1007/s10336-010-0492-1. 
  9. ^ Weigmann, C.; Lamprecht, J. (1991). "Intraspecific Nest Parasitism in Bar-headed Geese, Anser indicus". Animal Behaviour 41 (4): 677–688. doi:10.1016/S0003-3472(05)80905-4. 
  10. ^ Altshuler, D.; Dudley, R. (January 6, 2006). "The physiology and biomechanics of avian flight at high altitude". Integrative and Comparative Biology 46 (1): 62–71. doi:10.1093/icb/icj008. PMID 21672723. 
  11. ^ Milsom, William K.; Scott, Graham (2008). "Respiratory adaptations in the high flying bar-headed goose". Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 148 (4): 460. doi:10.1016/j.cbpc.2008.10.047. 
  12. ^ Liu, X.-Z.; Li, S.-L.; Jing, H.; Liang, Y.-H.; Hua, Z.-Q.; Lu, G.-Y. (2001). "Avian haemoglobins and structural basis of high affinity for oxygen: Structure of bar-headed goose aquomet haemoglobin". Acta Crystallographica Section D: Biological Crystallography 57 (6): 775–783. doi:10.1107/S0907444901004243. 
  13. ^ Jessen, T.; Weber, R.E; Fermi, G; Tame, J; and (August 1, 1991). "Adaptation of bird hemoglobins to high altitudes: demonstration of molecular mechanism by protein engineering.". Proceedings of the National Academy of Sciences of the United States of America 88 (51): 6519–22. doi:10.1073/pnas.88.15.6519. PMC 52117. PMID 1862080. Retrieved 20 December 2012. 
  14. ^ Zhang, J.; Hua, Z; Tame, J.R; Zhang, R; Gu, X. (January 26, 1996). Journal of Molecular Biology 255 (3): 484–93. doi:10.1006/jmbi.1996.0040. PMID 8568892. 
  15. ^ Scott, G.R.; Schulte, P.M; Egginton, S; Scott, A.L; Richards, J.G; Milsom, W.K. (January 2011). "Molecular evolution of cytochrome C oxidase underlies high-altitude adaptation in the bar-headed goose.". Molecular Biology Evolution 28 (1): 351–63. doi:10.1093/molbev/msq205. PMID 20685719. 
  16. ^ Scott, G.R.; Egginton, S; Richards, J.G; Milsom, W.K. (October 22, 2009). "Evolution of muscle phenotype for extreme high altitude flight in the bar-headed goose.". Proceedings of the Royal Society B 276 (1673): 3645–53. doi:10.1098/rspb.2009.0947. PMC 2817306. PMID 19640884. Retrieved 20 December 2012. 
  17. ^ Lee, S.Y.; Scott, G.R.; Milsom, W.K. (2008). "Have wing morphology or flight kinematics evolved for extreme high altitude migration in the bar-headed goose?". Comparative Biochemistry and Physiology - C Toxicology and Pharmacology 148 (4): 324–331. doi:10.1016/j.cbpc.2008.05.009. 
  18. ^ Altshuler, D.L.; Dudley, R. (September 2003). "Kinematics of hovering hummingbird flight along simulated and natural elevational gradients.". Journal of Experimental Biology 206 (18): 3139–47. doi:10.1242/jeb.00540. PMID 12909695. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!