Articles on this page are available in 3 other languages: Chinese (Simplified) (7), Dutch (1), Spanish (1) (learn more)

Overview

Brief Summary

Because red-throated divers lie deep in the water, only their dark grey back of their body is visible. With their short webbed feet located close to their tail end, they are terrific swimmers and divers, catching and consuming their prey underwater. Only larger prey are carried to the surface. This bird was used for predicting the weather on the Shetlands: flying inland or short cries meant good weather; flying to sea or long cries predicted wet weather.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gavia stellata

Somewhat smaller (25 inches) and paler than the Common Loon (Gavia immer), the Red-throated Loon in summer is most easily identified by its gray head, dark bill, dark back, and conspicuous red throat patch. Winter Red-throated Loons are dark above and pale on the breast, throat, and head, slightly more so than winter Common Loons. Male and female Red-throated Loons are similar to one another in all seasons. The Red-throated Loon inhabits a large portion of Eurasia (where it is known as the Red-throated Diver) and North America. In the New World, this species breeds along the coasts of Canada and Alaska. Red-throated Loons breeding in North America spend the winter along the Pacific coast from southern Alaska south to Baja California and along the Atlantic Coast from Nova Scotia to northern Florida. In the Old World, this species breeds in Greenland, Iceland, northwestern Britain and Ireland, Scandinavia, and northern Russia, wintering south to the Mediterranean Sea and southern China. In summer, Red-throated Loons breed in lakes and ponds either on the tundra or in evergreen forests. During the winter, Red-throated Loons are found along the coast in near-shore waters and on large bays. On migration, this species may be found on large bodies of freshwater in the interior. Red-throated Loons primarily eat small fish, which they catch by diving. Due to the relative inaccessibility of their breeding grounds, most birdwatchers are more familiar with Red-throated Loons during the winter. At this time of year, Red-throated Loons are most easily observed out at sea through binoculars or spotting scopes, and may be seen floating low in the water, diving below the surface in pursuit of prey, or flying awkwardly close to the tops of the waves. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding in North America occurs on Arctic coasts and islands from Alaska to Ellesmere Island, south along the Pacific coast through the Aleutian Islands to Queen Charlotte and Vancouver islands; inland to central Yukon, southern Mackenzie, northeastern Alberta, northern Saskatchewan, around Hudson Bay, and along the Atlantic coast to southeastern Quebec. In Eurasia, the breeding range extends from Greenland, Iceland, and Arctic islands and coasts south to the British Isles, southern Scandinavia, northern Russia, Lake Baikal, Sakhalin, the Kuril Islands, Kamchatka, and the Commander Islands (AOU 1998). During the nonbreeding season, the range in North America extends from the Aleutians south along the coast to northwestern Mexico; and from southern Newfoundland to northeastern Florida and the Gulf Coast; in Eurasia south to Mediterranean, Black, and Caspian seas, and along the western Pacific coast to China and Taiwan (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; winter range extends from the Scotian Shelf to Northern Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Red-throated Loon is a migratory species which breeds in the Arctic Regions of the northern hemisphere generally breeding north of 50°, and wintering along the Pacific and Atlantic coasts of North America as far south as Florida and California (USA), on the coast of Portugal, in the Mediterranean Sea and Black Sea, and on the Pacific coast of Asia as far south as south-east China1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

N Eurasia and n N Am.; winters to Caspian and Mediterranean.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Holarctic, breeding far into the high Arctic, and winters mainly on the northern coasts of the Atlantic and Pacific. Also in the Great Lakes, and the Black, Caspian, and Mediterranian Seas.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar, spreads south to 30°N in winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The red-throated loon is the smallest, slightest of the divers. It stands at 53-69 cm., and its wingspan ranges from 106-116 cm. During the breeding season, the upper body is a solid dark brown. The head and upper neck is grayish, with a large, glossy colored patch on the foreneck. It is white underneath and the tail is dark. In the winter, the face and foreneck are pure white, and the upper part is dark brownish and finely spotted with white. Males average slightly larger than females, and have a heavier head and bill. Its neck is thick, and the nostrils are narrow and elongated, as an adaptation to diving. The iris is reddish, especially in adults during the breeding season. The body is designed for swimming, with short, strong legs set far back on the body. The legs are perfect for moving through water, although this design makes walking on land difficult. The three front toes are webbed, and these loons have short, well-defined tails. They can vary their buoyancy in order to remain underwater, with the whole body submerged and only the eyes and bill visible above the surface. Adult loons shed their flight feathers simultaneously at the end of the breeding season and are thus unable to fly for several weeks. The body feathers are molted only in early spring and early autumn. (del Hoyo, Elliot, and Sargatal, 1992)

Average mass: 1816 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 64 cm

Weight: 1551 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 61 cm, Wingspan: 110 cm
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Stallcup (1994) for information on identification of North American loons.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Ponds and lakes in coastal and alpine tundra, and coastal flats south of tundra (breeding); primarily bays, seacoasts and estuaries, less frequently on lakes and rivers (nonbreeding) (AOU 1983).

Nests on edges of lakes and ponds (typically small and shallow), usually on ground in shallow scrape or on mound of mud/plant material; or on hummock in shallow water. Nesting ponds average about 0.3-0.4 ha, may lack food source; 1-4 ponds/territory. In the Northwest Territories, most ponds used for nesting were 0.1-1.0 ha in surface area and 0.3-1.0 m deep; emergent vegetation covered an average of 17% of the pond surface area; over half of the ponds had >80% marshy shoreline; 68% of nests were along wet shorelines, 18% were on islands, and 10% were in shallow water offshore; nests tended to be in sites not exposed to wind-driven waves and were an average of 2 m from open water; most nests were platforms built with aquatic vegetative growth from the previous year (Dickson 1994). In the Northwest Territories, nests within 9 km of marine foraging areas had higher reproductive success than did nests farther away (Eberl and Picman 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Behaviour This species is strongly migratory, with inland populations moving south or to the coast after breeding (del Hoyo et al. 1992). The species breeds from May onwards, nesting later further to the north depending on the timing of the thaw (del Hoyo et al. 1992). It usually nests solitarily on smaller waters but may nest in loosely colonial groups on larger waters (e.g. several pairs nesting a few metres apart on the same lake) (Snow and Perrins 1998). On migration large flocks of 200-1,200 individuals may form, with similar concentrations occurring on rich marine fishing grounds during the winter (del Hoyo et al. 1992). The species is most commonly observed singly, in pairs or in small scattered flocks during this season however (Snow and Perrins 1998). Habitat Breeding The species breeds on freshwater pools or lakes in open moorland, blanket bogs (del Hoyo et al. 1992) or open and wet peatland habitats (Campbell 1987). It will nest on pools as small as 10-20 m long or on lakes up to 5 ha in area, showing a preference for those in treeless areas that have well-vegetated margins and low islets or promontories on which to nest (Snow and Perrins 1998). It generally avoids waters with dense floating or emergent vegetation and steep rocks above the water (Snow and Perrins 1998), and if feeding conditions are inadequate in the pool chosen for breeding the species may fly to the coast or to lakes with higher abundances of fish in order to feed (Snow and Perrins 1998). Non-breeding Outside of the breeding season the species frequents inshore waters along sheltered coasts, occasionally occurring inland (del Hoyo et al. 1992) on lakes, pools, reservoirs and rivers (Snow and Perrins 1998). Diet Its diet consists predominantly of fish as well as crustaceans, molluscs, frogs, fish spawn (del Hoyo et al. 1992), aquatic insects, annelid worms (Snow and Perrins 1998) and plant matter (del Hoyo et al. 1992). Breeding site The nest is a small depression (Flint et al. 1984, Snow and Perrins 1998) or a mound of plant matter (del Hoyo et al. 1992, Snow and Perrins 1998) built in shallow water up to 10 m from the shore (Snow and Perrins 1998) or very near the water's edge (Flint et al. 1984, del Hoyo et al. 1992, Snow and Perrins 1998) on islets or small promontories (Flint et al. 1984). Nesting pairs will often re-use the same site in successive years (Snow and Perrins 1998). Management information In Scotland attempts have been made to implement education schemes for fishermen and land-owners to try to reduce disturbance and mortality of the species on breeding lakes (Campbell 1987). The introduction of floating artificial nesting rafts may also be successful in increasing the species's breeding success (Campbell 1987).


Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It breeds mostly on fresh water, typically in fairly open moorland, and may occupy stretches of water of almost any size. It is often found to be nesting by small pools. It winters on inshore waters along sheltered coasts, occasionally inland.

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5021 specimens in 1 taxon.
Water temperature and chemistry ranges based on 483 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.625 - 24.704
  Nitrate (umol/L): 0.440 - 12.040
  Salinity (PPS): 5.715 - 35.960
  Oxygen (ml/l): 4.690 - 8.325
  Phosphate (umol/l): 0.092 - 0.740
  Silicate (umol/l): 1.195 - 16.169

Graphical representation

Temperature range (°C): 0.625 - 24.704

Nitrate (umol/L): 0.440 - 12.040

Salinity (PPS): 5.715 - 35.960

Oxygen (ml/l): 4.690 - 8.325

Phosphate (umol/l): 0.092 - 0.740

Silicate (umol/l): 1.195 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Winter: Coastal bays and estuaries Summer: Tundra lakes
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in nesting areas around Beaufort Sea usually in early June (Johnson and Herter 1989). Common migrant off U.S. west coast April-June. Returns to U.S. Atlantic coast mainly in October, off California shores by September-October (Terres 1980). Large numbers may pass through the Great Lakes region in October.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migrate singly or in small groups to coastal areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet mainly fishes; also eats shrimps, snails, aquatic insects and some aquatic plants. When feeding young, often leaves nesting area to obtain fishes from larger lake or marine waters (Reimchen and Douglas 1984). Forages in shallow water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Red-throated loons prefer to forage in marine waters and never forage in their nesting pond, unlike other loons.

The red-throated loon obtains most of its food underwater, in dives that have been recorded at 2-9 meters, and average 1 minute. Prey is located visually, so these loons favor clear waters for foraging, and they do not fish at night. The prey consists of small or medium sized fish, including cod, herring, sprat, sculpins, and occasionally crustaceans, mollusks, frogs, fish spawn and insects. Food is usually swallowed before the loon surfaces. Their esophagus is relatively elastic, but a few have suffocated after swallowing too large a fish. When they find a suitable prey species in abundance, they will fully exploit it. (del Hoyo, Elliot and Sargatal, 1992)

Animal Foods: amphibians; fish; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Consists mostly of fish, also includes shrimp, crabs, snails, mussels, aquatic insects, leeches, frogs, and possibly plant material.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Gavia stellata is prey of:
Stercorarius
Larus hyperboreus
Alopex lagopus

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Gavia stellata preys on:
Animalia
Diptera
Entomostraca
Rotifera
Tardigrada
Nematoda
Oligochaeta
Actinopterygii
Mollusca
Crustacea
Insecta
Amphibia

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Alaska: statewide estimate 10,000 individuals; Canada: 12,000 individuals (surveyed areas only); Russian estimate: 71,000 individuals. (AK Loon and Grebe Working Group Meeting 2002). Estimates in West Palearctic: 2,000 pairs in Finland; circa 1,200-1,500 pairs in Scotland; 1,000 pairs in Iceland; 1,000 pairs in Norway; 10,000 in British waters (Hoyo et al. 1992).

Based on Christmas Bird Counts in North America, areas of highest winter density are eastern North Carolina, the Delaware Bay area, and between Point Arena and Point Reyes on the west coast (Root 1988). Relative abundance highest in North Carolina (246.38 birds per 100 survey hours; Sauer et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Somewhat gregarious when not breeding (Oberholser 1974). Gulls, jaegers, and/or arctic fox may cause significant loss of eggs and young in some areas (Johnsgard 1987).

Defends nesting territories of variable size. Sometimes an single pond is defended (e.g. 1.1 ha in Shetland Islands, Furness 1983), sometimes multiple ponds (Tuktoyaktuk Peninsula, NWT, Dickson 1993), sometimes several pairs share a larger lake (e.g. 5 pairs on a 76-hectare lake on Bathurst Island, Barr et al. 2000). Home range larger than breeding territory; individuals fly up to 14-20 kilometers away from nest site to forage (summarized by Barr et al. 2000). Merrie (1978) suggested that each breeding pair requires 2.5 square kilometers of foraging waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Activity may extend into twilight when adults feeding young (Reimchen and Douglas 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
23.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.7 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Nesting begins late May in south, late June or early July in far north; eggs are laid from early May to mid-July in British Columbia (Douglas and Reimchen 1988). Both sexes (mainly female) incubate 1-2 (usually 2) eggs 24-31 days. Young are tended by both parents, fly at about 8 weeks. First breeds probably at 2-3 years (Johnsgard 1987). Nest density in Alaska and Canada ranges up to 1.65 per sq km (Johnson and Herter 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-throated loons breed on freshwater lakes of the subarctic and boreal zones, with a strong preference for undisturbed sites. They readily settle on stretches of still water ranging in size from small pools to large, deep lakes, and sometimes even nest on sheltered coasts.

Loons are monogamous, forming long-term pair bonds. Pairs established from the previous season probably remain together throughout the winter, and start nesting early on after a minimal amount of display. Even newly formed pairs have simple courtship displays. Copulation takes place on dry land and is repeated frequently. It may begin on their day of arrival at the nest and continue until all eggs have been laid. The male selects the nest site.

Since loons have difficulty in walking, the site is always close to water. The nest is simply a heap of plant matter. Several pairs may build nests semi-colonially, especially when there are few tracts of suitable water within reach of their feeding areas. Thus they are tolerant of other pairs close by and only defend the area immediately surrounding the nest. However, if they are not breeding colonially, they may aggressively defend up to several hectares, including several non-nesting ponds.

Breeding starts in May in the south of the range, and in the north, timing depends on when spring thaw occurs. 1-3 eggs may be laid, but there are almost always 2. Incubation is 27 days and is performed by both partners, with the female spending more time on the nest than the male. Incubation starts when the first egg is laid. The resulting differences in age and size of the chicks means that when food is scarce, the older, larger chick gets more, and the youngest frequently starves to death within its first few days.

The chicks have dark brown down, and are paler below. By 2-3 weeks, they spend most of the time swimming, though they still rely on their parents for food until they are fully grown. Fledgling takes place at around 7 weeks. They are sexually mature at 2-3 years, and are known to have lived 23 years in the wild.

Nest failures due to predation are probably much more important than those due to human disturbance, because their range in North America, at least, does not overlap much with where humans live.

Range eggs per season: 1 to 3.

Average time to hatching: 27 days.

Average time to independence: 7 weeks.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average time to hatching: 28 days.

Average eggs per season: 2.

  • Eberl, C., J. Picman. 1993. Effect of nest-site location on reproductive success of red-throated loons (Gavia stellata). Auk, 110: 436-444.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest sites are locates at small lakes, and territories are defended by both partners. Nest is built by both partners on shore or in shallows. It is reused year to year. 2 eggs incubated by both sexes for 24-29 days. Both parents care for the young. May mate for life.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gavia stellata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gavia stellata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAACCGATGATTATTCTCAACTAACCACAAAGATATTGGCACACTATACCTAATTTTCGGTGCATGGGCTGGCATGGTCGGAACCGCCCTTAGCCTACTCATCCGCGCAGAACTCGGACAACCCGGGACCCTCCTAGGAGACGACCAAATCTATAACGTAATCGTCACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTCATACCCATTATAATCGGAGGATTTGGAAACTGACTAGTCCCACTTATAATCGGTGCCCCCGACATAGCATTCCCACGCATGAATAATATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAGGCAGGAGCAGGCACAGGCTGAACCGTATACCCCCCATTAGCCGGCAACCTCGCTCACGCTGGTGCCTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCTATTCTAGGGGCAATTAACTTTATCACAACCGCTATCAACATAAAACCACCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTCCTCATTACAGCTGTCCTACTCCTGCTCTCACTCCCAGTCCTCGCTGCTGGCATTACCATACTACTAACGGACCGAAACCTAAACACTACATTCTTTGACCCAGCCGGAGGAGGCGACCCAGTCCTATACCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTATACATCCTAATCCTGCCAGGCTTCGGAATTATCTCACATGTAGTAACCTACTATGCAGGCAAAAAAGAACCATTCGGCTACATAGGAATAGTATGAGCCATACTATCCATTGGATTCCTAGGCTTCATCGTATGAGCTCACCACATATTTACAGTCGGGATAGACGTAGACACCCGAGCATATTTCACCTCAGCTACCATAATCATCGCCATTCCAACAGGCATTAAAGTCTTCAGCTGACTAGCCACGCTGCATGGAGGAACTATCAAATGAGAGCCTCCAATGCTATGAGCACTAGGCTTTATCTTCCTCTTCACTATTGGCGGCCTAACAGGAATCGTCCTAGCAAACTCCTCACTAGACATCGCCCTACACGACACATACTACGTAGTTGCCCACTTCCACTATGTTCTCTCAATAGGAGCTGTCTTCGCCATCCTAGCAGGGTTTACCCACTGATTCCCACTATTCACCGGATACACCCTACACCCCACATGGGCTAAAGCTCACTTCGGAGTCATATTCACAGGTGTAAATCTAACCTTCTTCCCACAGCACTTCCTAGGTCTAGCTGGCATACCACGACGATACTCCGACTACCCGGACGCCTACACCCTATGAAACACTATATCCTCTATCGGCTCACTAATTTCAATAACAGCTGTCATTATATTAATATTTATCATCTGAGAGGCCTTCGCATCAAAACGGAAGGTCCTACAACCAGAACTAACCGCCACTAACATCGAATGAATCCACGGCTGCCCGCCCCCATACCACACCTTCGAAGAACCAGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B,N4N : N5B: Secure - Breeding, N4N: Apparently Secure - Nonbreeding

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Not globally threatened; still numerous though may be declining locally (Hoyo et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-throated loons are fairly sensitive to human disturbance and will desert the breeding lake if there is too much human activity. Direct human disturbance causes most breeding failures. The red-throated loon is also affected in places by changes in water level. It may suffer seriously from acidification of breeding waters and heavy metal pollution. It is highly vulnerable to oil spills, especially near rich fishing grounds where large congregations of birds may form in winter. Diver skins are sometimes used commercially.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No official conservation status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Limited trend data are available; however, at least local declines are evident. Surveys during the Alaska-Yukon Waterfowl Breeding Population Survey, 1971-1993, showed a 53 percent decline (Groves et al. 1996). Christmas Bird Count data indicate a non-significant survey-wide decline (-1.4 percent annual change; n = 376), 1959-1988 (Sauer et al. 1996). Survey methods may not be adequate, however, to monitor birds such as this species. Data from Europe suggest a large local decline in southwest Sweden; number of breeding sites has been reduced by 50 percent during the last 40-50 years (Eriksson 1994). In the Shetland Islands, abundance declined by one-third since 1983. In the Orkneys, population are apparently stable (Gibbons et al. 1997).

Global Long Term Trend: Relatively stable to decline of 50%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.200,000-590,000 individuals (Wetlands International 2006), while national population estimates include:
Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: PREDATION: Predation is major cause of nesting failure (Eberl and Picman 1993). Predators include arctic fox, wolf, glaucous gull, jaegers, snowy owl, and probably other carnivores and raptors.

FLOODING: Flooding of nests and desiccation of ponds leading to stranding, abandonment, or predation may be minor factors of nesting failure (Eberl and Picman 1993).

CONTAMINATION: Given the fish diet, this species may be susceptible to mercury contamination in areas with acidified lakes. Eggs in Sweden, for example, revealed extremely high mercury levels (6.2-14.2 parts per million, dry weight). Residues of chlorinated hydrocarbons and heavy metals also found in tissue samples of birds found dead in Germany, 1980 to 1984 (Heidmann et al. 1988). Red-throated loon also may suffer from decline in food (fish) abundance due to lake acidification in some areas (Eriksson 1994).

HUMAN DISTURBANCE: Substantial numbers may drown as a result of entanglement in fishing nets in winter range (see Johnsgard 1987). As many as 73 percent of nests suffered from human-related disturbance on Igloolik Island, Northwest Territories (Forbes et al. 1992). Red-throated loons are sensitive to human intrusion and may abandon disturbed breeding lakes (Forbes et al. 1992, Hoyo et al. 1992).

Additional hazards include lake eutrophication, water level fluctuations (McIntyre 1994), and oil spills, especially near foraging areas. At least 201 birds found oiled in coastal Britain in 1970s (Hoyo et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
When breeding the species is threatened by water level fluctuations (Campbell 1987, del Hoyo et al. 1992), acidification of breeding waters (Campbell 1987, del Hoyo et al. 1992), heavy metal pollution (del Hoyo et al. 1992) and the afforestation of peatland or moorland habitats (Campbell 1987). It is also sensitive to human disturbance from recreational activities (del Hoyo et al. 1992) and shoreline development (e.g. construction work near breeding lakes) (Meek et al. 1993) and will desert sites if there is too much human activity (del Hoyo et al. 1992). During the winter the species is highly vulnerable to coastal oil spills, especially in areas where large concentrations form (e.g. on rich fishing grounds) (del Hoyo et al. 1992), and is highly sensitive to disturbance from coastal wind farms (wind turbines) during this season (Garthe and Huppop 2004). The species suffers mortality at sea and on large lakes due to entanglement and drowning in inshore fishing nets (del Hoyo et al. 1992) and is susceptible to avian influenza so may be threatened by future outbreaks of the virus (Melville and Shortridge 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas or in area that provide effective protection due to their remoteness.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Red-throated diver skins are sometimes used to make ceremonial dresses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-throated loon

The red-throated loon or red-throated diver (Gavia stellata) is a migratory aquatic bird found in the northern hemisphere. It breeds primarily in Arctic regions, and winters in northern coastal waters. It is the most widely distributed member of the loon or diver family. Ranging from 55–67 centimetres (22–26 in) in length, the red-throated loon is the smallest and lightest of the world's loons. In winter, it is a nondescript bird, greyish above fading to white below. During the breeding season, it acquires the distinctive reddish throat patch which is the basis for its common name. Fish form the bulk of its diet, though amphibians, invertebrates and plant material are sometimes eaten as well. A monogamous species, the red-throated loon forms long-term pair bonds. Both members of the pair help to build the nest, incubate the eggs (generally two per clutch) and feed the hatched young.

The red-throated loon has a large global population and a significant global range, though some populations are declining. Oil spills, habitat degradation, pollution and fishing nets are among the major threats this species faces. Natural predators—including various gull species, and both red and Arctic foxes, will take eggs and young. The species is protected by a number of international treaties.

Taxonomy and etymology[edit]

First described by Danish naturalist Erik Pontoppidan in 1763, the red-throated loon is a monotypic species, with no distinctive subspecies despite its large Holarctic range.[2] Pontoppidan initially placed the species in the now-defunct genus Colymbus, which contained grebes as well as loons. By 1788, however, German naturalist Johann Reinhold Forster realized that grebes and loons were different enough to warrant separate genera, and moved the red-throated loon (along with all other loon species) to its present genus.[3] Its relationship to the four other loons is complex; although all belong to the same genus, it differs more than any of the others in terms of morphology, behaviour, ecology and breeding biology,[2] and may be the basal lineage of the genus.[4] It is thought to have evolved in the Palearctic, and then to have expanded into the Nearctic.[2]

The genus name Gavia comes from the Latin for "sea mew", as used by ancient Roman naturalist Pliny the Elder.[5] The specific epithet stellata is Latin for "set with stars" or "starry",[6] and refers to the bird's speckled back in its non-breeding plumage.[5] "Diver" refers to the family's underwater method of hunting for prey, while "red-throated" is a straightforward reference to the bird's most distinctive breeding plumage feature. The word "loon" is thought to have derived from the Swedish lom, the Old Norse or Icelandic lómr, or the Old Dutch loen, all of which mean "lame" or "clumsy", and is a probable reference to the difficulty that all loons have in moving about on land.[7]

Description[edit]

A grey and white bird swims in water.
An adult in non-breeding plumage shows the speckled back which gives the bird its specific name.

The red-throated loon is the smallest and lightest of the world's loon species, ranging from 53 to 69 cm (21 to 27 in) in length[nb 1][9] with a 91–120 cm (36–47 in) wingspan,[9][10] and weighing 1–2.7 kg (2.2–6.0 lb).[9] Like all loons, it is long-bodied and short-necked, with its legs set far back on its body.[11] The sexes are similar in appearance, although males tend to be slightly larger and heavier than females.[2] In breeding plumage, the adult has a dark grey head and neck (with narrow black and white stripes on the back of the neck), a triangular red throat patch, white underparts and a dark grey-brown mantle.[12] It is the only loon with an all-dark back in breeding plumage.[13] The non-breeding plumage is drabber with the chin, foreneck and much of the face white, the top of the head and back of the neck grey, and considerable white speckling on the dark mantle.[12]

Its bill is thin, straight and sharp, and the bird often holds it at an uptilted angle.[12] Though the colour of the bill changes from black in summer to pale grey in winter, the timing of the colour change does not necessarily correspond to that of the bird's overall plumage change. The nostrils are narrow slits located near the base of the bill,[11] and the iris is reddish.[14] One of the bird's North American folk names is pegging-awl loon, a reference to its sharply pointed bill, which resembles a sailmaker's awl (a tool also known as a "pegging awl" in New England).[15]

Like the other members of its genus, the red-throated loon is well-adapted to its aquatic environment: its dense bones help it to submerge, its legs—in their set-back position—provide excellent propulsion and its body is long and streamlined. Even its sharply pointed bill may help its underwater streamlining. Its feet are large, its front three toes are fully webbed, and its tarsus is flattened, which reduces drag and allows the leg to move easily through the water.[16]

Adult in breeding plumage in Iceland
Dark grey fuzzy-looking chick floats on water.
Very young birds are covered with dark brown or grey down feathers.

When it first emerges from its egg, the young red-throated loon is covered with fine soft down feathers. Primarily dark brown to dark grey above, it is slightly paler on the sides of its head and neck, as well as on its throat, chest, and flanks, with a pale grey lower breast and belly. Within weeks, this first down is replaced by a second, paler set of down feathers, which are in turn replaced by developing juvenile feathers.[14] The juvenile's plumage is similar to that of the adult, though with a few distinguishing features. It has a darker forehead and neck, with heavy speckling on the sides of the neck and the throat. Its back is browner and less speckled, and its underparts are tinged with brown. Its eyes are reddish-brown, and its beak is a pale grey. Though some young birds hold this plumage until mid-winter, many quickly become virtually indistinguishable from adults, except for their paler bills.[12]

diagram of silhouette of red-throated loon in flight
In flight, the hunchbacked profile of the red-throated loon is distinctive.

In flight, the red-throated loon has a distinctive profile; its small feet do not project far past the end of its body, its head and neck droop below the horizontal (giving the flying bird a distinctly hunchbacked shape) and its thin wings are angled back. It has a quicker, deeper wingbeat than do other loons.[17]

Voice[edit]

The adult red-throated loon has a number of vocalisations, which are used in different circumstances. In flight, when passing conspecifics or circling its own pond, it gives a series of rapid yet rhythmic goose-like cackles - kaa-kaa-kaa or kak-kak-kak, at roughly five calls per second. Its warning call, if disturbed by humans or onshore predators, is a short croaking bark. A low-pitched moaning call, used primarily as a contact call between mates and between parents and young, but also during copulation, is made with the bill closed. The species also has a short wailing call - aarOOao…aarOOao…, which descends slightly in pitch and lasts about a second; due to strong harmonics surrounding the primary pitch, this meowing call is more musical than its other calls. Another call — a harsh, pulsed cooing that rises and falls in pitch, and is typically repeated up to 10 times in a row—is used in territorial encounters and pair-bonding, and by parent birds encouraging their young to move on land between bodies of water.[18] Known as the "long call", it is often given in duet, which is unusual among the loons;[19] the female's contribution is longer and softer than her mate's.[18]

Young have a shrill closed-bill call, which they use in begging and to contact their parents. They also have a long call used in response to (and similar to that of) the long call of adults.[18]

Similar species[edit]

At medium to close range, an adult red-throated loon in either breeding or non-breeding plumage is usually easily recognised. However, in certain light conditions, at certain times in its moulting cycle or at greater distances, it may be mistaken for another species—most commonly the black-throated loon, but also occasionally the great crested grebe. It shows more white on the head and neck than does the black-throated loon, and—provided it is not sitting low in the water—tends to show more white on the flanks as well. If it is sitting lower in the water, so that the white on the flanks is reduced to a patch on the rear flank (thus resembling the pattern of the black-throated loon), that patch tends to be less clearly defined than the comparative patch on the black-throated.[20]

Habitat and distribution[edit]

aerial view of tundra, with numerous small lakes dotting the ground
The red-throated loon breeds primarily in coastal tundra, often on very small lakes.

The red-throated loon breeds primarily in the Arctic regions of northern Eurasia and North America (generally north of 50°N latitude), and winters in northern coastal waters,[21] sometimes in groups of considerable size. More than 4,400 spend the winter in a loose concentration on the eastern part of the German Bight, for example.[22] Unlike other loons, it regularly uses very small freshwater lakes as breeding sites.

In North America, it winters regularly along both coasts, ranging as far south as the Baja California Peninsula and the Gulf of California in north-western Mexico; it has been recorded as a vagrant in the interior Mexican state of Hidalgo.[23] Some of its folk names in north-eastern North America—including cape race, cape brace, cape drake and cape racer, as well as corruptions such as scapegrace—originated from its abundance around Cape Race, Newfoundland.[24] In Europe, it breeds in Iceland, northern Scotland, north-western Ireland (a few pairs only), Scandinavia and northern Russia, and winters along the coast as far south as parts of Spain; it also regularly occurs along major inland waterways, including the Mediterranean, Aegean and Black Seas, as well as large rivers, lakes and reservoirs.[25] It has occurred as a vagrant as far south as Morocco, Tunisia and the Gambia.[1] In Asia, it breeds in the northern stretches of Siberia, and winters along the Pacific coast as far south as China, Japan and Taiwan. It has occurred as a vagrant in Mongolia.[1]

Behaviour[edit]

Adult loon in breeding plumage, reared up on the water with its wings spread.
Among the loons, the red-throated loon is exceptional in its ability to take off from very small bodies of water.

Because its feet are located so far back on its body, the red-throated loon is quite clumsy walking on land; however, it can use its feet to shove itself forward on its breast.[17] Young use this method of covering ground when moving from their breeding pools to larger bodies of water, including rivers and the sea.[26] It is the only species of loon able to take off directly from land.[27] If frightened, it may submerge until only its head or bill shows above the surface of the water.[28]

The red-throated loon is a diurnal migrant, which travels singly or in loose groups, often high above the water.[17] In eastern North America (and possibly elsewhere), it tends to migrate near the coast rather than farther offshore;[29] Siberian populations travel for hundreds of miles over land en route to their southern European wintering grounds.[30] It is a strong flier, and has been clocked at speeds between 75 and 78 kilometres per hour (47 and 48 mph).[31] Like all members of its family, the red-throated loon goes through a simultaneous wing moult, losing all its flight feathers at once and becoming flightless for a period of three to four weeks. However, unlike other loons—which undergo this moult in late winter—the red-throated loon loses its ability to fly sometime between late summer and late autumn.[32]

Food and feeding[edit]

Two small fuzzy blackish chicks—one swallowing a silver fish—float on water beside a larger bird with a black back and grey neck.
Once they are 3–4 days old, the young are fed fish—which can be quite large compared to the size of the chick.

Like all members of its family, the red-throated loon is primarily a fish-eater, though it sometimes feeds on molluscs, crustaceans, frogs, aquatic invertebrates, insects, fish spawn or even plant material.[21] It seizes rather than spears its prey, which is generally captured underwater.[33] Though it normally dives and swims using only its feet for propulsion, it may use its wings as well if it needs to turn or accelerate quickly.[34] Pursuit dives range from 2–9 m (6.6–29.5 ft) in depth, with an average underwater time of about a minute.[21] Its fish diet increases the red-throated loon's vulnerability to persistent organic pollutants and heavy metals, both of which bioaccumulate, thus potentially causing greater problems for long-lived species (such as the loon) at or near the top of the food chain.[35] Its main diet has also led to several of the loon's British folk names, including "sprat borer" and "spratoon".[36]

For the first few days after hatching, young red-throated loons are fed aquatic insects and small crustaceans by both parents. After 3–4 days, the parents switch to fish small enough for the young birds to swallow whole. By four weeks of age, the young can eat the same food—of the same size—as their parents do.[37] Young birds may be fed for some time after fledging; adults have been seen feeding fish to juveniles at sea and on inland lakes in the United Kingdom, hundreds of kilometres from any breeding areas.[38][39]

Breeding and survival[edit]

Small fuzzy black chick floats beside a larger bird on calm water with a muddy bank and tall grass in the background
Chicks are competent swimmers, able to accompany their parents soon after hatching.

The red-throated loon is a monogamous species which forms long-term pair bonds. Both sexes build the nest, which is a shallow scrape (or occasionally a platform of mud and vegetation) lined with vegetation and sometimes a few feathers, and placed within a half-metre (18 in) of the edge of a small pond. The female lays two eggs (though clutches of one and three have also been recorded); they are incubated for 24–29 days, primarily by the female. The eggs, which are greenish or olive-brownish spotted with black, measure 75 mm × 46 mm (3.0 in × 1.8 in) and have a mass of 83 g (2.9 oz), of which 8% is shell.[33][40] Incubation is begun as soon as the first egg is laid, so they hatch asynchronously. If a clutch is lost (to predation or flooding, for example) before the young hatch, the red-throated loon usually lays a second clutch, generally in a new nest.[41] The young birds are precocial upon hatching: downy and mobile with open eyes. Both parents feed them small aquatic invertebrates initially, then small fish for 38–48 days. Parents will perform distraction displays to lure predators away from the nest and young.[33] Ornithologists disagree as to whether adults carry young on their backs while swimming with some maintaining that they do[33] and others the opposite.[9]

In the wild, the oldest known red-throated loon lived for more than two decades;[21] it was found, oiled and dead, on a beach in Sweden 23 years and 7 months after it had been ringed (banded).[42]

Conservation status and threats[edit]

Although the red-throated loon is not a globally threatened species, as it has a large population and a significant range, there are populations which appear to be declining. Numbers counted in U.S. Fish and Wildlife Service surveys in Alaska show a 53% population decline between 1971 and 1993, for example,[43] and counts have dropped in continental Europe as well.[44] In Scotland, on the other hand, the population increased by some 16% between 1994 and 2006, according to surveys done by the Royal Society for the Protection of Birds and Scottish Natural Heritage.[44] In 2002, Wetlands International estimated a global population of 490,000 to 1,500,000 individuals; global population trends have not been quantified.[1]

The red-throated loon is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies;[45] in the Americas, it is protected by the Migratory Bird Treaty Act of 1918.[46] Oil spills, habitat degradation, and fishing nets are among the main threats this species faces.[9] Because it tends to migrate close to shore—generally within 20 kilometres (12 mi) of land—it may be detrimentally affected by the construction of near-shore wind farms;[47] studies indicate a high level of avoidance of wind farm areas, though deaths due to direct strikes with the turbines appear to be uncommon.[48] High levels of mercury in the environment have led to reproductive failures in some areas, including parts of Sweden.[49] Studies in Sweden have also shown that they may be adversely impacted by the acidification of lakes, as the fish on which they prey are susceptible to low pH.[50] On the breeding grounds, Arctic and red foxes are major predators of eggs,[51] while great skuas, Arctic skuas and various species of Larus gulls (including great black-backed gulls and glaucous gulls)[52][53] are predators of both eggs and young.[54]

The species is known to serve as host for at least 51 species of parasites, most of which are roundworms (nematodes), flatworms (digeneans) and tapeworms (cestodes) carried internally; a single species of louse is its only known external parasite.[55] It is also known to sometimes carry significant populations of diatoms (microscopic phytoplankton) on its contour feathers.[56] The red-throated loon is susceptible to avian influenza[57] and Type E botulism,[58] and is regularly killed by the ingestion of neurotoxins produced by "red tide" algal blooms.[59] During a 2007 bloom, large numbers of the birds also died of hypothermia, after their plumages became matted by a protein byproduct of the algae, which reduced the insulating properties of their feathers.[60]

In human culture[edit]

Greyish bird with white speckles on its back and a sharply pointed grey bill floats on water
Juveniles have fewer speckles on their backs and darker necks than adults do.

Used as a food source since prehistoric times,[61][62] the red-throated loon is still hunted by indigenous peoples in some parts of the world today.[63] Eggs as well as birds are taken, sometimes in significant numbers; during one study on northern Canada's Igloolik Island, 73% of all red-throated loon eggs laid within the 10 km2 (3.9 mi2) study site over two breeding seasons were collected by indigenous inhabitants of the island.[64] In some parts of Russia, red-throated loon skins were traditionally used to make caps and various clothing decorations, including collars.[65] The species was also central to the creation mythologies of indigenous groups throughout the Holarctic.[66] According to the myth—which varies only slightly between versions, despite the sometimes-vast distances that separated the groups who believed it—the loon was asked by a great shaman to bring up earth from the bottom of the sea. That earth was then used to build the world's dry land.[66][67]

As recently as the 1800s, the behaviour of the red-throated loon was used to forecast the weather; according to the conventional wisdom of the time, birds flying inland or giving short cries predicted good weather, while those flying out to sea or giving long, wailing cries predicted rain.[40][44] In the Orkney and Shetland islands of Scotland, the species is still known as the "rain goose" in deference to its supposed weather-predicting capabilities.[44] The people of the Faroe Islands believed that if the red-throated loon miaowed like a cat, then rain was imminent, while a call of gaa-gaa-gaa or turkatrae-turkatrae predicted fine weather.[68]

Bhutan, Japan and the Union of the Comoros have issued stamps featuring the red-throated loon.[69]

Notes[edit]

  1. ^ By convention, length is measured from the tip of the bill to the tip of the tail on a dead bird (or skin) laid on its back.[8]

References[edit]

  1. ^ a b c d BirdLife International (2012). "Gavia stellata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d Carboneras 1992, p. 162
  3. ^ Allen, J. A. (July 1897). "The Proper Generic Name of the Loons". The Auk 14 (3): 312–313. doi:10.2307/4068646. JSTOR 4068646. 
  4. ^ Boertmann, D. (1990). "Phylogeny of the divers, family Gaviidae (Aves)". Steenstrupia 16: 21–36. 
  5. ^ a b Johnsgard, Paul A. (1987). Diving Birds of North America. University of Nevada–Lincoln. ISBN 0-8032-2566-0. 
  6. ^ Simpson, Donald Penistan (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd. p. 883. ISBN 0-304-52257-0. 
  7. ^ Carboneras 1992, p. 169.
  8. ^ Cramp 1997, p. 3
  9. ^ a b c d e "All About Birds: Red-throated Loon Life History". Cornell Lab of Ornithology. Retrieved 20 October 2011. 
  10. ^ Svensson, Lars; Grant, Peter (1999). Collins Bird Guide. London: HarperCollins. pp. 12–13. ISBN 0-00-219728-6. 
  11. ^ a b Cramp 1977, p. 42.
  12. ^ a b c d Cramp 1977, p. 43.
  13. ^ Carboneras 1992, p. 163.
  14. ^ a b Cramp 1977, p. 49.
  15. ^ Cassidy, Frederic Gomes; Hall, Joan Houston (2002). Dictionary of American Regional English: Volume IV, P–Sk. Cambridge, Massachusetts: Harvard University Press. p. 84. ISBN 0-674-00884-7. 
  16. ^ Sibley, David; Elphick, Chris; Dunning, Jr., John B., eds. (2001). The Sibley Guide to Bird Life & Behaviour. London: Christopher Helm. pp. 124–25. ISBN 0-7136-6250-6. 
  17. ^ a b c Sibley, David (2000). The Sibley Guide to Birds. New York: Alfred A. Knopf. p. 23. ISBN 0-679-45122-6. 
  18. ^ a b c Cramp 1977, p. 48.
  19. ^ Carboneras 1992, p. 164.
  20. ^ Appleby, R. H.; Madge, Steve; Mullarney, Killian (August 1986). "Identification of divers in immature and winter plumages". British Birds 79 (8): 365–91. 
  21. ^ a b c d Carboneras 1992, p. 171.
  22. ^ von Nordheim, Henning; Boedeker, Dieter; Krause, Jochen (2006). Progress in Marine Conservation in Europe: Natura 2000 Sites in German Offshore Waters. Berlin: Springer. p. 85. ISBN 978-3-540-33291-6. 
  23. ^ Howell, Steve N. G.; Sophie Webb (1995). A Guide to the Birds of Mexico and Northern Central America. Oxford University Press. p. 92. ISBN 0-19-854012-4. 
  24. ^ Cassidy, Frederic Gomes; Hall, Joan Houston (1985). Dictionary of American Regional English: Volume1, A–C. Harvard University Press. p. 539. ISBN 0-674-20511-1. 
  25. ^ Cramp 1977, p. 45.
  26. ^ Haviland, Maud D. (March 1915). "On the Method of Progression on Land of a Young Red-throated Diver". British Birds 8 (10): 241–43. 
  27. ^ Mead-Waldo, E. G. B. (November 1922). "Habits of the Red-throated Diver". British Birds 16 (6): 172–73. 
  28. ^ Cramp 1977, p. 44.
  29. ^ Powers, Kevin D.; Cherry, Jeffrey (1983). "Loon migrations off the coast of the northeastern United States". Wilson Bulletin 95 (1): 125–32. 
  30. ^ Carboneras 1992, p. 168.
  31. ^ Davis, Rolph A. (January 1971). "Flight speed of Arctic and Red-throated Loons". The Auk 88 (1): 169. doi:10.2307/4083974. JSTOR 4083974. 
  32. ^ Wolfenden, Glen E. (1967). "Selection for a Delayed Simultaneous Wing Molt in Loons (Gaviidae)". The Wilson Bulletin 79 (4): 416–20. 
  33. ^ a b c d Ehrlich, Paul R.; Dobkin, David S.; Wheye, Darryl; Pimm, Stuart L. (1994). The Birdwatcher's Handbook. Oxford, UK: Oxford University Press. p. 2. ISBN 0-19-858407-5. 
  34. ^ Townsend, Charles W. (July 1909). "The Use of the Wings and Feet by Diving Birds" (PDF). The Auk 26 (3): 234–48. doi:10.2307/4070795. JSTOR 4070795. 
  35. ^ Dickson, D. Lynne; Gilchrist, H. Grant (2002). "Status of Marine Birds of the Southeastern Beaufort Sea" (PDF). Arctic 55 (supp. 1): 46–58. 
  36. ^ Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London, UK: Chatto & Windus. p. 3. ISBN 0-7011-6907-9. 
  37. ^ Cramp 1977, p. 46
  38. ^ Hart, Alan S.; Jardine, David C. and Colin Hewitt (June 1998). "Red-throated Diver feeding young in October". British Birds 91 (6): 231. 
  39. ^ Barber, S. C. (June 2002). "Red-throated Diver feeding young in November". British Birds 95 (6): 313. 
  40. ^ a b "Red-throated Diver". British Trust for Ornithology. Retrieved 27 June 2008. 
  41. ^ Schamel, Douglas; Tracy, Diane M. (Summer 1985). "Replacement clutches in the Red-throated Loon" (PDF). Journal of Field Ornithology 56 (3): 282–283. 
  42. ^ Staav, Roland; Fransson, Thor (2008). "European Longevity Records". EURING: The European Union for Bird Ringing. Retrieved 14 July 2009. 
  43. ^ Groves, Deborah J.; Conant, Bruce; King, Rodney J.; Hodges, John I.; King, James G. (1996). "Status and trends of loon populations summering in Alaska, 1971–1993". The Condor 98 (2): 189–95. doi:10.2307/1369136. 
  44. ^ a b c d "Rise in divers mystifies experts". BBC News. 7 September 2007. Retrieved 7 September 2007. 
  45. ^ "Waterbird species to which the Agreement applies". Agreement on the Conservation of African-Eurasian Migratory Waterbirds. Retrieved 29 June 2008. 
  46. ^ "Birds Protected by the Migratory Bird Treaty Act". US Fish and Wildlife Service. Retrieved 29 June 2008. 
  47. ^ Stienen, Eric W.M.; Waeyenberge, Van; Kuijken, Eckhart; Seys, Jan (2007). "Trapped Within the Corridor of the Southern North Sea: The Potential Impact of Offshore Wind Farms on Seabirds" (PDF). In de Lucas, Manuela; Janss, Guyonne F.E.; Ferrer, Miguel. Birds and Wind Farms: Risk Assessment and Mitigation. London: Quercus. pp. 71–80. 
  48. ^ Halley, D.J.; Hopshaug, P. "Breeding and overland flight of red-throated divers Gavia stellata at Smøla, Norway, in relation to the Smøla wind farm" (PDF). Norwegian Institute of Nature Research. Retrieved 26 July 2009. 
  49. ^ Eriksson, M.O.G.; Johansson, I.; Ahlgren, C.G. (1992). "Levels of mercury in eggs of red-throated diver Gavia stellata and black-throated diver G. arctica in southwest Sweden". Ornis Svecica 2 (1): 29–36. 
  50. ^ Eriksson, Mats O. G (1994). "Susceptibility to freshwater acidification by two species of loon: Red-throated Loon (Gavia stellata) and Arctic Loon (Gavia arctica) in southwest Sweden". Hydrobiologia. 279–280 (1): 439–444. doi:10.1007/BF00027875. 
  51. ^ Schamel, Douglas; Tracy, Diane (Summer 1985). "Replacement Clutches in the Red-throated Loon". Journal of Field Ornithology 56 (3): 282–83. 
  52. ^ Serle, W. (January 1936). "Mortality amongst Red-throated Divers". British Birds 29 (1): 81–82. 
  53. ^ Eberl, Christine; Picman, Jaroslav (July–September 1993). "Effect of Nest-site Location on Reproductive Success of Red-throated Loons (Gavia stellata)". The Auk 110 (3): 436–444. doi:10.2307/4088408. JSTOR 4088408. 
  54. ^ Booth, C. J. (January 1978). "Breeding success of Red-throated Divers". British Birds 71 (1): 44. 
  55. ^ Storer, Robert W. (2002). The Metazoan Parasite Fauna of Loons (Aves: Gaviiformes), Its Relationship to the Birds' Evolutionary History and Biology, and a Comparison with the Parasite Fauna of Grebes. Museum of Zoology, University of Michigan. p. 37. ISSN 0076-8405. 
  56. ^ Croll, Donald A.; Holmes, Robert W. (October 1982). "A Note on the Occurrence of Diatoms on the Feathers of Diving Seabirds". Auk 99: 765–66. 
  57. ^ "Red-throated Loon – BirdLife Species Factsheet". BirdLife International. Retrieved 14 July 2009. 
  58. ^ Leighton, F. A. (2007). "Type E Botulism in Birds". Canadian Cooperative Wildlife Health Centre. Retrieved 14 July 2009. 
  59. ^ "Quarterly Wildlife Mortality Report". USGS. 2007. Retrieved 14 July 2009. 
  60. ^ Jessup, David A.; Miller, Melissa A.; Ryan, John P. (23 February 2009). "Mass Stranding of Marine Birds Caused by a Surfactant-Producing Red Tide". In Bennett, Peter M. PLoS ONE 4 (2): e4550. doi:10.1371/journal.pone.0004550. PMC 2641015. PMID 19234604. 
  61. ^ Gordon, Bryan C.; Savage, Howard (1974). "Whirl Lake: A Stratified Indian Site Near the Mackenzie Delta". Arctic 27 (3): 175–88. doi:10.14430/arctic2872. 
  62. ^ Tagliacozzo, Antonio; Gala, Monica (November 2002). "Exploitation of Anseriformes at two Upper Palaeolithic sites in Southern Italy: Grotta Romanelli (Lecce, Apulia) and Grotta del Santuario della Madonna a Praia a Mare (Cosenza, Calabria)". Acta zoologica cracoviensia 45 (special issue): 117–31. 
  63. ^ Bird, Louis; Brown, Jennifer S.H. (2005). Telling Our Stories: Omushkego Legends and Histories from Hudson Bay. Broadview Press. ISBN 1-55111-580-8. 
  64. ^ Forbes, Graham; Robertson, Kelly; Ogilvie, Carey; Seddon, Laura (September 1992). "Breeding Densities, Biogeography, and Nest Predation of Birds on Igloolik Island, NWT". Arctic (Peterborough, Ontario) 45 (3): 295–303. doi:10.14430/arctic1404. 
  65. ^ "Red-throated Loon". Birds of North America Online. Cornell Laboratory of Ornithology and the American Ornithologists' Union. Retrieved 27 March 2008.  (Registration required)
  66. ^ a b Köngäs, Elli Kaija (Spring 1960). "The Earth-Diver (Th. A 812)". Ethnohistory 7 (2): 151–80. doi:10.2307/480754. JSTOR 480754.  (Registration required)
  67. ^ Lutwack, Leonard (1994). Birds in Literature. University Press of Florida. p. 82. ISBN 0-8130-1254-6. 
  68. ^ Armstrong, Edward A. (1970) [1958]. The Folklore of Birds. New York, NY: Dover Publications. pp. 62–63. ISBN 0-486-22145-8. 
  69. ^ Scharning, Kjell. "Stamps showing Red-throated Loon Gavia stellata". Theme Birds on Stamps. Retrieved 13 February 2009. 

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This is a clearly distinct taxon at the species level.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!