Overview

Brief Summary

The native range of the Zebra Dove (Geopelia striata) extends from southern Burma through Malaysia to Sumatra and Java. It has been widely introduced elsewhere, however, and in some regions it is uncertain whether it is native or introduced (e.g., in  Borneo, the Philippines, Bali, and Lombok). Apparently feral populations are well established in Thailand, Borneo, Sulawesi, the Moluccas, Tahiti, the Hawaiian Islands, St. Helena, Madagascar, and the Seychelles.

These slender, long-tailed doves are found in a range of open habitats with some bushes or trees, including dry woodland, scrubland, agricultural areas, gardens, and cities. Zebra Doves are generally restricted to lowlands, but occur up to 900 m on Sumatra.  Their diet consists mainly of small seeds, with a small quantity of insects taken. They feed on the ground in pairs or small groups.

Zebra Doves are common throughout much of their range (very common on Sumatra). Most information on their biology and ecology has been gathered from introduced populations. They have sometimes been treated as conspecific (i.e., members of the same species) as the Peaceful Dove (G. placida) and the Barred Dove (G. maugei), but these three taxa (each of which has a distinct song), are now generally recognized as three distinct species.

Zebra Doves are popular cage and aviary birds, although they are not kept as widely as the related Diamond Dove.

(Baptista et al. 1997 and references therein)

  • Baptista, L.F., P.W. Trail, and H.M. Horblit. 1997. Zebra Dove (Geopelia striata). P. 157 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 4. Sandgrouse to Cuckoos. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: RESIDENT from Malay Peninsula and Phillipines south to East Indies. Introduced (1922, Oahu) and established in Hawaii; now on all main islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Myanmar to Malaysia, Sumatra and Java.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open country with trees and shrubby growth, parks, gardens, and cultivated areas, especially near human habitation (AOU 1983). Ground-dweller of drier lowland habitats (Pratt et al. 1987). Pineapple and cane plantations, cut forest. Nests in trees, on buildings, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Density of up to 300 per sq km has been recorded in some areas of Hawaii (Oahu, Molokai) (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Hawaii: breeds throughout year; clutch size is 2; young stay in nest 14-16 days, attended by parent for about 1 week after fledging (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Geopelia striata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAATCTTCGGCGCATGAGCCGGCATAATTGGCACTGCACTTAGCCTGCTTATCCGCGCAGAACTTGGACAACCCGGCACCCTCCTAGGAGACGATCAAATCTACAATGTAATTGTAACCGCCCATGCTTTTGTAATAATCTTCTTCATAGTTATGCCAATCATGATTGGGGGTTTCGGAAACTGACTAGTACCCCTCATAATCGGCGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCTTACCCCCATCATTCCTCCTCCTACTAGCCTCCTCCACAGTCGAGGCCGGTGCAGGCACAGGATGAACAGTATATCCCCCACTAGCCGGCAACCTAGCCCATGCTGGAGCCTCTGTAGACCTAGCCATCTTCTCCCTCCACCTTGCAGGGGTATCCTCCATCCTAGGGGCTATTAACTTTATTACAACCGCTATCAACATAAAACCACCAGCCCTATCGCAATACCAAACCCCCCTATTCGTATGATCAGTCCTCATCACTGCTGTCCTCCTCCTCCTTTCCCTGCCAGTCCTTGCTGCTGGCATCACTATGCTCCTTACAGACCGAAACCTGAACACTACATTCTTCGACCCCGCAGGTGGTGGTGACCCAGTGCTATACCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTCTATATTTTAATCCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Geopelia striata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as usually common over most of its range, although scarce in Bali and Java and uncommon in the Philippines and Borneo (Gibbs et al. 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Zebra dove

The zebra dove (Geopelia striata) also known as barred ground dove, is a bird of the dove family Columbidae, native to South-east Asia. They are small birds with a long tail. They are predominantly brownish-grey in color with black-and-white barring. They are known for their pleasant soft, staccato cooing calls.

Taxonomy[edit]

The zebra dove is closely related to the peaceful dove of Australia and New Guinea and the barred dove of eastern Indonesia. These two were classified as subspecies of the zebra dove until recently and the names peaceful dove and barred dove were often applied to the whole species.

Habitat and range[edit]

The native range of the species extends from Southern Thailand, Tenasserim, Peninsular Malaysia and Singapore to the Indonesian islands of Sumatra and Java. It may also be native to Borneo, Bali, Lombok, Sumbawa, and the Philippine islands.

The zebra dove is popular in captivity and many populations have appeared outside its native range due to birds escaping or being deliberately released. It can now be found in central Thailand, Laos, Borneo, Sulawesi, Hawaii (introduced in 1922), Tahiti (1950), New Caledonia, the Seychelles, the Chagos Archipelago (1960), Mauritius (before 1768), Réunion and Saint Helena.

It inhabits scrub, farmland and open country in lowland areas and is commonly seen in parks and gardens. Trapping for the cagebird industry has led to them becoming rare in parts of Indonesia but in most parts of its range it is common. Zebra doves are among the most abundant birds in some places such as Hawaii and the Seychelles.

Description[edit]

Zebra dove from Mindanao, Philippines. They are known as kurokutok in reference to their soft cooing calls

The birds are small and slender with a long, narrow tail. The upperparts are brownish-grey with black-and-white barring. The underparts are pinkish with black bars on the sides of the neck, breast and belly. The face is blue-grey with bare blue skin around the eyes. There are white tips to the tail feathers. Juveniles are duller and paler than the adults. Zebra doves are 20-23 centimetres in length with a wingspan of 24–26 cm.

Their call is a series of soft, staccato cooing notes. In Thailand and Indonesia, the birds are popular as pets because of their calls and cooing competitions are held to find the bird with the best voice. In Indonesia this bird is called perkutut. In the Philippines they are known as batobatong katigbe ("pebbled katigbe") and kurokutok, onomatopoeic to their calls.[2] They are also known as tukmo in Filipino, a name also given to the spotted dove (Streptopelia chinensis) and other wild doves.

Feeding[edit]

The zebra dove feeds on small grass and weed seeds. They will also eat insects and other small invertebrates. They prefer to forage on bare ground, short grass or on roads, scurrying about with rodent-like movement. Unlike other doves, they forage alone, or in pairs. Their coloration camouflages them wonderfully against the ground. In Hawaii and the Seychelles they come to hotels, restaurants, and even people's houses to feed on crumbs and pieces of bread around outdoor tables.

Reproduction[edit]

In its native range the breeding season is from September to June. The males perform a courtship display where they bow and coo while raising and spreading the tail. The nest is a simple platform of leaves and grass blades. It is built in a bush or tree or sometimes on the ground. One or two white eggs are laid and are incubated by both parents for 13 to 18 days. The young leave the nest within two weeks and can fly well after three weeks.[2]

References[edit]

  1. ^ BirdLife International (2012). "Geopelia striata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Robert Kennedy (2000). A Guide to the Birds of the Philippines. Oxford University Press. pp. 149–150. ISBN 9780198546689. 
  • H. Douglas Pratt, Philip L. Bruner & Delwyn. Berrett (1987), A Field Guide to the Birds of Hawaii and the Tropical Pacific, Princeton University Press
  • Craig Robson (2002), A Field Guide to the Birds of South-East Asia, New Holland Publishers (UK) Ltd.
  • Adrian Skerrett, Ian Bullock & Tony Disley (2001), Birds of Seychelles, Christopher Helm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Australian G. placida and Wallacean G. maugeus may be conspecific with G. striata (Sibley and Monroe, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!