Overview

Brief Summary

The Downy Woodpecker (Picoides pubescens) is the smallest woodpecker in North America. It is common across most of North America north of Mexico except for the Southwest, with a range extending from Alaska and most of Canada south to the Gulf Coast. Downy Woodpeckers winter throughout most of the breeding range. They are found in deciduous and mixed deciduous-coniferous woodland, riparian woodland, second growth, parks, orchards, and suburbs. Downy woodpeckers are common visitors to bird feeders.

In its range, the Downy Woodpecker closely resembles the Hairy woodpecker (Picoides villosus), but the Downy is much smaller, with a bill that is noticeably proportionately smaller relative to the head (i.e., the bill has a more "stubby" appearance), and the outer tail feathers have black barring that is lacking on the Hairy's tail (these outer feathers instead being entirely white on the Hairy Woodpecker). In both species, the male has a red hindcrown spot that is not present in the female. Hairy and Downy Woodpeckers are often found together, but the Hairy requires larger trees and is usually less common, especially in the eastern portion of its range, and less frequent in suburban settings and parks.

Downy Woodpeckers feed mainly on a wide variety of insects.They also eat seeds and berries and will take suet at bird feeders. When feeding on trees, Downy Woodpeckers tend to do more tapping and excavating in winter and more gleaning of insects from surfaces in summer. Confer and Paicos (1985) reported on a study of the impact of Downy Woodpeckers feeding on gall-inducing insects on Canada Goldenrod (Solidago canadensis) on the ecology of galls.

In fall and winter, the male and female maintain separate feeding areas, with pairs forming by late winter. The male and female take turns drumming loudly on dead limbs in their separate territories, with the male gradually approaching the female.

The nest site is a cavity excavated by both sexes. in a dead limb or tree, usually around 4 to 9 m above the ground (but ranging from 2 to 18 m). The cavity entrance is often surrounded by fungus or lichen, which helps to camouflage the site. The 4 or 5 (sometimes 3 or 6) white eggs are incubated by both sexes for around 12 days. Both parents bring billfulls of insects to feed the nestlings. Young leave the nest around 20 to 25 days after hatching, but may follow parents for several weeks after that. Over most of the range, Downy Woodpeckers produce just one brood per year.

Although these woodpeckers are permanent residents over much of their range, the northernmost populations may move significantly southward in winter. Some birds in the mountains of the West may move down into valleys (as well as short distances to the south) in winter.

(Confer and Paicos 1985; Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Confer, J.L. and P. Paicos. 1985. Downy Woodpecker predation at goldenrod galls. Journal of Field Ornithology 56:56-64.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Downy woodpeckers are found throughout North America, from southeastern Alaska east to Newfoundland, extending south to southern California and Florida. The majority of downy woodpeckers throughout the geographic range are year-round residents. Some populations are locally migratory, especially those along the Atlantic coast.

Biogeographic Regions: nearctic (Native )

  • Jackson, J., H. Ouellet. 2002. Downy woodpecker (Picoides pubescens). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 613. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Downy woodpeckers are native to the Nearctic Region. They are found throughout North America, from southeastern Alaska east to Newfoundland, and south to southern California and Florida. Most downy woodpeckers stay in the same area year-round.

Biogeographic Regions: nearctic (Native )

  • Jackson, J., H. Ouellet. 2002. Downy woodpecker (Picoides_pubescens). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 613. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: western and central Alaska to northern Saskatchewan and Newfoundland, south to southern California, central Texas, Gulf Coast, and southern Florida. NON-BREEDING: throughout breeding range, but more northern populations are mostly migratory, occurring irregularly southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Downy woodpeckers are smallest woodpeckers in North America. They are 14.5 to 17 cm long and weigh 21 to 28 g. They are mostly black-and-white. Their back is black with white down the center and their wings are black with white spots. Their head is black with a white stripe above and below each eye, and their tail is black with white outer feathers. Their chest and belly are white to grayish.

Downy woodpeckers have whitish tufts at the base of their thick, black bills. Males and females are look the same, except that males have a small red patch at the back of their neck. Young males usually have a red patch on the forehead instead of their neck. Young females do not have any red at all.

Downy woodpeckers are easily confused with hairy woodpeckers (Picoides_villosus). Picoides villosus look very similar to downys, but they are larger. Downy woodpeckers also have a shorter, stubbier bill (shorter than the length of their head) than Picoides villosus. Downy woodpeckers have much quieter calls that hairy woodpeckers, and usually forage on smaller plants.

There are eight subspecies of downy woodpeckers.

Range mass: 21 to 28 g.

Range length: 14.5 to 17 cm.

Range wingspan: 83 to 105 mm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike; male more colorful

Average basal metabolic rate: 0.383 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Downy woodpeckers are smallest woodpeckers native to North America. They are 14.5 to 17 cm long and weigh 21 to 28 g. They are largely black-and-white; their back is black with white down the center and their wings are black with white spots. The head is black with a white stripe above and below each eye. The tail is black with outer portions of white barred with black. The chest and belly are white to grayish.

Downy woodpeckers have whitish nasal tufts at the base of a thick, black, chisel-shaped bill. Males and females are similar in appearance, but the males have a small red patch on the nape of the neck. Juvenile males usually have a red patch on the forehead and lack red on the nape of the neck. Juvenile females look similar to juvenile males, but lack any red on the forehead or nape.

Downy woodpeckers are commonly confused with hairy woodpeckers (Picoides villosus), which have similar plumage, but are distinctly larger. Downy woodpeckers also have a shorter, stubbier bill (shorter than the length of their head) than hairy woodpeckers. The two species can also be distinguished behaviorally; downy woodpeckers give much less powerful vocalizations and tend to forage on smaller substrates than hairy woodpeckers.

There are eight recognized subspecies of downy woodpeckers. These subspecies are differentiated by geographic range and plumage variation.

Range mass: 21 to 28 g.

Range length: 14.5 to 17 cm.

Range wingspan: 83 to 105 mm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike; male more colorful

Average basal metabolic rate: 0.383 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 17 cm

Weight: 27 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

In the northern part of their range, downy woodpeckers prefer open, deciduous forests and woodlands. This includes young, mixed forests of oak, hickory, beech, maple and hemlock. They are less common in conifer-dominated forests unless the forest has deciduous in the understory. Downy woodpeckers are also common in orchards, parks and in suburbs that have a lot of trees. In the south, downy woodpeckers prefer riparian woods or moist, aspen-willow stands. They are also found in the southern Rocky Mountains.

Range elevation: 2744 (high) m.

Habitat Regions: temperate

Terrestrial Biomes: forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the northern part of their range, downy woodpeckers favor open deciduous forests and woodlands. This includes mixed, secondary-growth forests of oak-hickory or beech-maple-hemlock. They are less common in conifer-dominated forests unless there is a deciduous understory. Downy woodpeckers are also common in cultivated areas such as orchards, and are sometimes found in urban and suburban settings. In the south, they frequent riparian woods or moist, aspen-willow stands. They are also found in the southern Rocky Mountains.

Range elevation: 2744 (high) m.

Habitat Regions: temperate

Terrestrial Biomes: forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Deciduous and mixed woodland, second growth, parks, orchards, swamps, and riparian woodland. Nests mostly in hole dug by both sexes in dead stub of tree, also in live tree (especially dead part), fenceposts; 1-15 m above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Northernmost breeding populations move southward for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Downy woodpeckers are omnivorous. Their primary foods include insects and other arthropods, fruits, seeds, sap and some cambium tissue. Coleoptera, Curculionidae, Formicidae, Hemiptera, Homoptera and Lepidoptera are among the insects eaten. They also consume Homoptera and Araneae. Downy woodpeckers will also eat suet from backyard feeders.

Downy woodpeckers glean insects from the surfaces of trees, shrubs and large weeds, probe into crevices and excavate shallow holes into wood to find food. Males and females within a population often differ in their foraging habits. For example, in one study in Illinois, males spent more time excavating than females, and females probed bark surfaces more than males.

Downy woodpeckers drink water by scooping it up with their bill. They drink from water that collects on horizontal limb surfaces, in epiphytes, puddles, streams, ponds and bird baths.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit; sap or other plant fluids

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Downy woodpeckers are omnivorous. Their primary foods include insects and other arthropods, fruits, seeds, sap and some cambium tissue. Beetles, weevils, ants, bugs, plant lice and caterpillars are among the insects eaten. They also consume scale insects and spiders. Downy woodpeckers will also eat suet from backyard feeders.

Downy woodpeckers glean insects from the surfaces of trees, shrubs and large weeds, probe into crevices and excavate shallow holes into wood to find food. Males and females within a population often differ in their foraging habits. For example, in one study in Illinois, males spent more time excavating than females, and females probed bark surfaces more than males.

Downy woodpeckers drink water by scooping it up with their bill. They drink from water that collects on horizontal limb surfaces, in epiphytes, puddles, streams, ponds and bird baths.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit; sap or other plant fluids

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly insects, including adults, larvae, pupae, and eggs, obtained from bark of trees; also eats berries and nuts (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Downy woodpeckers affect the populations of the insects they prey upon and the plants they eat. They also provide valuable food for their predators. They are host to several species of body parasites, including Ornithomyia, Fannia canicularis and Protocalliphora.

Abandoned downy woodpecker nest cavities may be used by other cavity-nesting species.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • Ornithomyia
  • Fannia canicularis
  • Protocalliphora

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult downy woodpeckers are preyed upon by several species of Falconiformes. To hide themselves from predators, downy woodpeckers flatten themselves against the surface of the tree bark and remain motionless. Downy woodpeckers may also dodge a hawk by darting behind a tree branch, or winding their way around the branch to avoid the hawk. In urban areas, downy woodpecker predators include Rattus and Felis silvestris. Eggs and nestlings are vulnerable to climbing predators such as Squamata and Sciuridae, as well as other woodpeckers, including Melanerpes carolinus and Picoides villosus. By nesting in cavities, downy woodpeckers avoid predation of their eggs and young by animals that cannot get to these cavities.

Known Predators:

  • northern goshawks (Accipiter_gentilis)
  • peregrine falcons (Falco_peregrinus)
  • sharp-shinned hawks (Accipiter_striatus)
  • Cooper's hawks (Accipiter_cooperii)
  • snakes (Serpentes)
  • squirrels (Sciuridae)
  • rats (Rattus)
  • domestic cats (Felis_silvestris)
  • red-bellied woodpeckers (Melanerpes_carolinus)
  • hairy woodpeckers (Picoides_villosus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Downy woodpeckers affect the populations of the insects they prey upon and the plants they eat. They also provide valuable food for their predators. They are host to several species of body parasites, including hippoboscid flies, muscid flies and blowflies.

Abandoned downy woodpecker nest cavities may be used by other cavity-nesting species.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • hippoboscid flies
  • muscid flies
  • blowflies

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult downy woodpeckers are preyed upon by several species of birds of prey. To hide themselves from predators, downy woodpeckers flatten themselves against the surface of the tree bark and remain motionless. Downy woodpeckers may also dodge a hawk by darting behind a tree branch, or winding their way around the branch to avoid the hawk. In urban areas, downy woodpecker predators include rats and domestic cats. Eggs and nestlings are vulnerable to climbing predators such as snakes and squirrels, as well as other woodpeckers, including red-bellied woodpeckers and hairy woodpeckers. By nesting in cavities, downy woodpeckers avoid predation of their eggs and young by animals that cannot get to these cavities.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Picoides pubescens (downy woodpecker) preys on:
Saperda
Dicera
Diptera
Lepidoptera
Coleoptera

Based on studies in:
Canada: Manitoba (Forest)
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Picoides pubescens (downy woodpecker) is prey of:
Strix varia

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Downy woodpeckers use calls and body signals to communicate. They produce a variety of sounds, including "pik", rattle, scolding, "wad", "chirp", squeak, screech, and distress calls. The "pik" call introduces the rattle call, and these are used during aggressive interactions. Short calls, the "wad" and "chirp", are uttered by young birds. A longer note call, the squeak, is also uttered by young downy woodpeckers. The screech and distress calls are used to signal alarm.

Drumming is a common non-vocal sound that downy woodpeckers use to communicate. This sound is used most often in late winter and spring> It is used to establish and defend a territory, to attract a mate, and to communicate between mates.

Downy woodpeckers also use body postures to communicate. Bill pointing and waving, wing flicking, crest raising, wing spreading, tail spreading, head turning and head swinging are some of the body postures that downy woodpeckers use to communicate.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Downy woodpeckers use vocalizations and body signals to communicate. They produce a variety of sounds, including "pik", rattle, scolding, "wad", "chirp", squeak, screech, and distress calls. The "pik" call introduces the rattle call, and these are used during aggressive interactions. Short calls, the "wad" and "chirp", are uttered by young birds. A longer note call, the squeak, is also uttered by young downy woodpeckers. The screech and distress calls are used to signal alarm.

Drumming is a common non-vocal sound used by downy woodpeckers to communicate. This sound is heard in most frequently in late winter and spring, and is used to establish and defend a territory, to attract a mate and to communicate between mates.

Downy woodpeckers also use body postures to communicate. Postures exhibited by downy woodpeckers often include some combination of bill pointing and waving, wing flicking, crest raising, wing spreading, tail spreading, head turning and head swinging.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding of young

Feeding of young birds by their parents can often be mistaken as 'mate feeding,' as the young Downy Woodpecker can grow to be quite large (even larger than the parent bird) and still be fed by the parent. The young woodpecker is easily mistaken for an adult.

Public Domain

 

Supplier: Michael Dunkle

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

One wild downy woodpecker lived to be 11 years and 11 months old. Most downy woodpeckers probably do not live this long.

Range lifespan

Status: wild:
11.9 (high) years.

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

One wild downy woodpecker lived to be 11 years and 11 months old. Most downy woodpeckers probably do not live this long.

Range lifespan

Status: wild:
11.9 (high) years.

Average lifespan

Status: wild:
143 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Downy woodpeckers are monogamous. Breeding pairs usually begin forming in late winter and early spring (January to March). Pairs usually stay together for the length of a summer, and may mate together for more than one year.

Mating System: monogamous

The male and female excavate a nest cavity together. The nest cavity is usually located in a tree limb. When the nest is complete, the female lays 3 to 8 eggs (average 4.8). She lays one egg each day. Both parents incubate the eggs. The male incubates at night and the adults take turns during the day. The eggs all hatch on the same day after 12 days of incubation.

This nestlings are altricial (helpless) when they hatch, but they develop very quickly. The parents brood them constantly for the first 4 days after hatching. Both parents also feed the chicks. The chicks leave the nest after 18 to 21 days. The parents continue to take care of the fledglings for at least three weeks. They feed them, lead them to food sources and warn them of potential predators. Most young downy woodpeckers are able to breed the next year.

Breeding interval: Downy woodpeckers breed once per year.

Breeding season: Downy woodpeckers begin breeding in late winter (January through March)

Range eggs per season: 3 to 8.

Average eggs per season: 4.8.

Range time to hatching: 12 (high) days.

Range fledging age: 18 to 21 days.

Range time to independence: 3 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both parents incubate the eggs, keep the nest clean, feed the young and protect them from predators. The young remain with the parents for up to three weeks after fledging.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Jackson, J., H. Ouellet. 2002. Downy woodpecker (Picoides_pubescens). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 613. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Downy woodpeckers are monogamous. Breeding pairs usually begin forming in late winter and early spring (January to March). Once a breeding pair forms, they forage together until incubation begins. This may be a form of mate guarding. Breeding pairs usually stay together for the length of a summer, and may mate together for more than one breeding season.

Mating System: monogamous

The male and female excavate a nest cavity together, usually in a dead limb of a living or dead tree. Excavation takes 7 to 20 days, and is usually begun about two weeks before egg-laying. The female lays 3 to 8 eggs (average 4.8) at a rate of 1 per day. Both parents incubate the eggs; the male incubates at night and the adults share incubation during the day. The eggs hatch synchronously after 12 days. This nestlings are altricial at hatching, but develop very quickly. They are brooded nearly constantly for the first 4 days after hatching, and are fed by both parents. The chicks leave the nest 18 to 21 days after hatching. The parents continue to care for the fledglings for at least three weeks, feeding them, leading them to food sources and warning them of potential predators. Most young downy woodpeckers are able to breed the next season.

Downy woodpeckers occasionally have female "helpers" at the nest. These helpers are not usually offspring of the breeding pair.

Breeding interval: Downy woodpeckers breed once per year.

Breeding season: Downy woodpeckers begin breeding in late winter (January through March)

Range eggs per season: 3 to 8.

Average eggs per season: 4.8.

Range time to hatching: 12 (high) days.

Range fledging age: 18 to 21 days.

Range time to independence: 3 (low) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

Both parents incubate the eggs, keep the nest clean, feed the young and protect them from predators. The young remain with the parents for up to three weeks after fledging.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Jackson, J., H. Ouellet. 2002. Downy woodpecker (Picoides pubescens). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 613. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size 3-7 (usually 4-5). Incubation about 12 days, by both sexes. Young leaves nest at 20-22 days, then dependent on parents for food for 3 more weeks. Possibly 2 broods per year in south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Picoides pubescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCCACCAACCACAAAGACATTGGCACCTTATTTCTTATCTTCGGAGCATGAGCTGGCATAATCGGCACAGCCCTTAGCCTCCTCATCCGGGCGGAACTAGGCCAACCCGGTACCCTCCTCGGCGAC---GACCAAATCTATAACGTCATCGTTACTGCCCATGCATTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTCGGAAATTGACTTGTACCCCTCATAATCGGAGCCCCCGATATAGCATTTCCACGGATGAACAACATAAGCTTCTGACTCCTCCCTCCGTCATTCCTTCTCCTCTTAGCCTCTTCCACAGTAGAAGCAGGAGCCGGAACAGGATGAACCGTTTACCCACCCCTTGCCGGCAACTTAGCCCATGCAGGGGCCTCAGTGGACTTAGCCATCTTCTCACTCCATTTAGCAGGTATCTCATCGATCCTAGGAGCAATCAACTTCATTACAACAGCCATTAACATGAAACCTCCAGCCATTTCACAGTATCAAACCCCCCTATTCGTCTGATCTGTCCTTATCACCGCTGTCCTTTTACTCCTATCCCTCCCTGTACTCGCCGCTGGCATTACAATACTCCTCACAGATCGCAACCTAAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCTATCCTCTACCAACACCTCTTCTGATTCTTCGGCCACCCTGAAGTCTACATTTTAATTCTTCCAGGATTCGGCATCATCTCACACGTAGTAGCGTACTATGCCGGTAAAAAAGAACCATTTGGCTATATAGGTATAGNATGAGCCATACTTTCCATCGGATTCCTCGGCTTCATCGTATGGGCCCACCACATGTTCACTGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Picoides pubescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Downy woodpecker populations seem to be stable and/or increasing in some areas. There are an estimated 13,000,000 downy woodpeckers worldwide. This species is protected under the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Downy woodpecker populations seem to be stable and/or increasing in some areas. There are an estimated 13,000,000 downy woodpeckers worldwide. This species is protected under the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of downy woodpeckers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Downy woodpeckers eat wood-boring beetle larvae and other insects that humans consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of downy woodpeckers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Downy woodpeckers eat wood-boring beetle larvae and other insects that humans consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Downy Woodpecker

The Downy Woodpecker (Picoides pubescens) is a species of woodpecker, the smallest in North America.

Contents

Description

The female lacks the red patch on the back of the head.

Adult Downy Woodpeckers are the smallest of North America's woodpeckers but there are many smaller species elsewhere, especially the piculets. The total length of the species ranges from 14 to 18 cm (5.5 to 7.1 in) and the wingspan from 25 to 31 cm (9.8 to 12 in). Body mass ranges from 20 to 33 g (0.71 to 1.2 oz). Standard measurements are as follows: the wing chord is 8.5–10 cm (3.3–3.9 in), the tail is 4–6 cm (1.6–2.4 in), the bill is 1–1.8 cm (0.39–0.71 in) and the tarsus is 1.1–1.7 cm (0.43–0.67 in).[2][3][4] The Downy Woodpecker is mainly black on the upperparts and wings, with a white back, throat and belly and white spotting on the wings. There is a white bar above the eye and one below. They have a black tail with white outer feathers barred with black. Adult males have a red patch on the back of the head whereas juvenile birds display a red cap.

The Downy Woodpecker is virtually identical in plumage pattern to the much larger Hairy Woodpecker, but it can be distinguished from the Hairy by the presence of black spots on its white tail feathers and the length of its bill. The Downy Woodpecker's bill is shorter than its head, whereas the Hairy Woodpecker's bill is approximately equal to head length.

The Downy Woodpecker gives a number of vocalizations, including a short pik call. Like other woodpeckers, it also produces a drumming sound with its beak as it pecks into trees. Compared to other North American species its drums are slow.[5]

Taxonomy

Despite their close resemblance, Downy and Hairy Woodpeckers are not very closely related, and they are likely to be separated in different genera;[6][7] the outward similarity is a spectacular example of convergent evolution. Why they evolved this way cannot be explained with confidence; it may be relevant that the species exploit rather different-sized foodstuffs and do not compete very much ecologically.

Ecology and behavior

Their breeding habitat is forested areas, mainly deciduous, across most of North America to Central America. They nest in a tree cavity excavated by the nesting pair in a dead tree or limb.

These birds are mostly permanent residents. Northern birds may migrate further south; birds in mountainous areas may move to lower elevations. Downy Woodpeckers roost in tree cavities in the winter.

Downy Woodpeckers forage on trees, picking the bark surface in summer and digging deeper in winter. They mainly eat insects, also seeds and berries. In winter, especially, Downy Woodpeckers can often be found in suburban backyards with trees and will feed on suet at birdfeeders.

Gallery

References

  1. ^ BirdLife International (2012). "Picoides pubescens". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Woodpeckers: An Identification Guide to the Woodpeckers of the World by Hans Winkler, David A. Christie & David Nurney. Houghton Mifflin (1995), ISBN 978-0-395-72043-1
  3. ^ Downy woodpecker Species Account
  4. ^ Downy Woodpecker, Life History, All About Birds - Cornell Lab of Ornithology
  5. ^ Sibley, David Allen (2000). The Sibley Guide to Birds. New York: Alfred A. Knopf. p. 312. ISBN 978-0-679-45122-8. 
  6. ^ Moore, Andrea; Weibel, Amy C.; Agius (2006). "Mitochondrial DNA phylogeny of the woodpecker genus Veniliornis (Picidae, Picinae) and related genera implies convergent evolution of plumage patterns" (PDF). Biol. J. Linn. Soc. 87: 611–624. 
  7. ^ Weibel, Amy C.; Moore, William S. (2005). "Plumage convergence in Picoides woodpeckers based on a molecular phylogeny, with emphasis on convergence in downy and hairy woodpeckers". Condor 107 (4): 797–809. doi:10.1650/7858.1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Throughout North America, exhibits little mtDNA polymorphism and a shallow phylogeographic structure (Ball and Avise 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!