Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Sphyrapicus varius

A medium-sized (8-9 inches) woodpecker, the male Yellow-bellied Sapsucker is most easily identified by its black-and-white barred back, buff breast, and red forehead and throat. Female Yellow-bellied Sapsuckers are similar to males, but have a white throat. In flight, this species may be separated from other small, dark-headed woodpeckers in its range by its conspicuous white wing patches. The Yellow-bellied Sapsucker breeds across south-central Canada and the northeastern United States. Isolated breeding populations exist at higher elevations in the Appalachian Mountains as far south as North Carolina. This species migrates south for the winter, when it may be found from the Mid-Atlantic region and the southeast south through the West Indies, Mexico, and Central America. Yellow-bellied Sapsuckers breed in a number of northern mixed evergreen-deciduous forest types. In winter, this species may be found in a variety of temperate and tropical woodland habitats. Yellow-bellied Sapsuckers may eat fruits, berries, and insects at certain times of the year, but this species is best known for its preference for tree sap collected from holes drilled in tree trunks. In appropriate habitat, Yellow-bellied Sapsuckers may be observed climbing up tree trunks while foraging (or drilling) for food. Good birdwatchers are quick to notice trees with grids of small holes ringing the trunks, as these are likely sapsucker feeding sites. Yellow-bellied Sapsuckers are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

N America (Yukon, Canada, US); winters se US to Panama.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of Sphyrapicus varius is North and Middle America. It is common to see this bird wintering in the southern United States, Central America, and the West Indies. Some birds stay within the transition zones, but most of them winter in the southern United States, Central America, and the West Indies.

(Bent 1992, Winkler et al. 1995)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: extreme eastern Alaska, southwestern Yukon, southwestern Mackenzie, northwestern and central Saskatchewan, central Manitoba, north-central Ontario, southern Quebec (including Anticosti Island), southern Labrador, and central Newfoundland south to northeastern British Columbia, central Alberta, central and southeastern Saskatchewan, eastern North Dakota, eastern South Dakota, Iowa, northeastern Missouri, central Illinois, northwestern Indiana, northern Ohio, western Pennsylvania, northwestern Connecticut, western Massachusetts, and New Hampshire; locally in Appalachian Mountains south to eastern Tennessee and western North Carolina (AOU 1983). WINTERS: Missouri, Illinois, Indiana, Ohio Valley, and New Jersey (rarely farther north) south through Texas, southeastern U.S., Middle America (except northwestern Mexico north of Sinaloa and west of Coahuila), Bahamas, and Antilles (south to Dominica, but rare east of Hispaniola and Netherlands Antilles). Casual or accidental in south-coastal Alaska, California, Arizona, New Mexico, Colorado, Wyoming, Bermuda, and Greenland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The male has a red forecrown on a black and white head and a red throat. Sexual dimorphism between the adults is easily observed as the female has a white chin compared to the red in the male. The back is blackish, with a white rump, and a large white wing patch. The underparts are yellowish and are paler in females. Juvenile woodpeckers retain a brown plumage until late in the winter when it begins to take on the colors of its sex.

(Short 1982)

Range mass: 43 to 55 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 22 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Sphyrapicus varius
Catalog Number: USNM 457935
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Male; Adult
Preparation: Skin: Whole
Collector(s): A. Ganier
Year Collected: 1946
Locality: Unicoi Mountains, Stratton Gap, Monroe, Tennessee, United States, North America
Elevation (m): 1326
  • Type: Ganier. October 22, 1954. Migrant. 25 (3): 40, pl.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They live in northern deciduous and mixed coniferous forests in summer. During winter they live in forests and various semi-open habitats.

(Winkler et al. 1995)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Deciduous or mixed deciduous-coniferous forest; in migration and winter also in a variety of forest and open woodland habitats, parks, orchards (AOU 1983). Nest hole is bored by both sexes; usually located 3-14 m above ground. Generally excavates a new hole each year. See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Withdraws southward from most of breeding range in winter. Females tend to winter farther south than do males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The main food source is insects. The most common are beetles, ants, moths and dragonflies. When insects are not abundant, sap is an important food source. Sphyapicus varius gets its sap from poplar, willow, birch, maple, hickory, pine, spruce and fir trees. Other sources of food taken from October to February include berries and fruits.

(Bent 1992, Winkler et al. 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Drills holes in coniferous and deciduous trees and laps up sap and insects with tongue. Eats ants, wasps, mayflies, moths, spruce budworms, and beetles, etc. (Terres 1980). Also feeds on fruit, aspen buds, and suet.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily a solitary species, but loose groups may be seen during migration (Oberholser 1974).

Presence of sapsuckers influences the structure of local bird communities (e.g., through cavity excavation), and sapwells made by these birds enhance local insect abundance and diversity (Rissler et al. 1995, Wilson Bull. 107:746-752).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The breeding call for these birds sound like a kwee-urk. This same call is also a territorial call.

"Quirks" are used to strengthen the pairbond between two birds of the opposite sex. This is a scratching on the tree and usually happens along with head bobbing.

Week, week; wurp, wurp noises are exchanged between pairs and/or with their juveniles when they meet.

When in the presence of a predator the birds give a repeated shrill. When they are just mildly excited, they have been known to give a mewing c-waan noise.

Communication Channels: visual ; acoustic

  • Kilham, L. 1983. Life History Studies of Woodpeckers of Eastern North America. Cambridge, Massachusetts: Club Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
81 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In late April and May nests are excavated in live birch and poplar trees 2-20 meters above ground. Both sexes participate in the excavation. At the site of excavation, courtship flights are executed between the pair; a "winnowing" sound is made during these flights. Other than ritual flights there is ritual tapping to strengthen pair bonds, this occurs when the male taps on the tree and the female responds with a similar tap. Copulation results in four to seven egg being laid. Incubation duties are shared by both adults and lasts for 12-13 days.. The male, however, spends more time on the eggs, especially at night.

 Young fledge within 25-29 days of hatching. The adults must feed their chicks nine times per hour to help them develop properly. To help in sanitation, the adults mix sawdust with the droppings and carry them out of the nest.

(Short 1982, Kilham 1983)

Average time to hatching: 13 days.

Average eggs per season: 5.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually is 5-6, sometimes 4-7. Incubation, by both sexes, lasts 12-13 days. Nestlings are altricial. Young birds leave the nest-hole 25-29 days after hatching (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrapicus varius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTTTCCACTAACCACAAAGACATTGGCACCCTATACCTTATCTTCGGCGCATGAGCCGGTATAATCGGCACAGCCCTCAGCCTCCTCATTCGTGCTGAACTAGGCCAGCCCGGTACTCTCCTTGGTGAC---GACCAAATCTACAATGTAATTGTCACTGCTCATGCATTCGTAATAATCTTCTTCATAGTTATACCNNTCATAATTGGAGGGTTCGGAAACTGACTAGTACCCCTCATGATTGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCATCATTTCTTCTTCTTCTAGCCTCCTCAACAGTAGAAGCAGGGGCTGGAACAGGCTGAACTGTCTACCCACCTCTCGCTGGTAACCTAGCCCACGCAGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCAGGCATTTCGTCCATCTTAGGGGCGATTAACTTCATCACAACAGCCATCAACATAAAACCACCAGCTATTTCACAATACCAAACCCCCCTATTTGTCTGATCAGTCCTCATCACCGCCGTCCTACTACTCCTATCTCTACCAGTTCTAGCTGCAGGGATCACAATACTCCTTACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCTGGCGGAGGCGACCCAATCCTTTACCAACATCTTTTCTGATTCTTTGGCCACCCCGAAGTCTACATCCTAATTCTTCCAGGATTCGGCATCATCTCCCACGTAGTAACGTACTACACTAGCAAAAAAGAACCCTTCGGTTACATAGGCATAGTATGAGCCATACTCTCCATTGGGTTCCTAGGCTTTATCGTATGAGCCCACCACATATTCACCGTAGGAATAGACGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrapicus varius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-bellied sapsuckers are widespread and abundant, with no need for special conservation measures to protect their populations. They are protected by the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Breeding Bird Survey data indicate a significant population decrease averaging 3.4% per year in North America between 1966 and 1989 (Droege and Sauer 1990) and a nonsignificant decline averaging 1.0% per year, 1966-1993 (Peterjohn et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

They mainly eat insects that could otherwise damage agriculture.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-bellied Sapsucker

The Yellow-bellied Sapsucker (Sphyrapicus varius) is a medium-sized woodpecker found in North America, Central America and the Caribbean.

Contents

Taxonomy [edit]

The Yellow-bellied Sapsucker is one of four species in the genus Sphyrapicus.[2] First described by Carl Linnaeus in 1766, it is monotypic across its sizable range.[3]

Description [edit]

The Yellow-bellied Sapsucker is a mid-sized woodpecker, measuring 18–22 cm (7.1–8.7 in) in length, 34–40 cm (13–16 in) in wingspan and weighing from 40–63 g (1.4–2.2 oz).[4][5] Adults are black on the back and wings with white bars; they have a black head with white lines down the side and a red forehead and crown, a yellow breast and upper belly, a white lower belly and rump and a black tail with a white central bar. Adult males have a red throat; females have a white throat.

Vocalization [edit]

They drum and give a cat-like call in spring to declare ownership of territory.

Similar species [edit]

The red-naped sapsucker is distinguished by having a red nape (back of the head). The hairy woodpecker has no red on the crown (front of the head) or throat and has blacker back. The downy woodpecker has same markings as the hairy woodpecker but is significantly smaller.

Distribution and habitat [edit]

The breeding habitat of the Yellow-bellied Sapsucker is forested areas across Canada, eastern Alaska and the northeastern United States. They prefer young, mainly deciduous forests. There is also a disjunct population found in high elevations of the Appalachian Mountains in Virginia, Tennessee, and North Carolina.

Ecology and behavior [edit]

Diet [edit]

Like other sapsuckers, these birds drill holes in trees and eat the sap and insects drawn to it. They may also pick insects from tree trunks or catch them in flight. They also eat fruit and berries.

Reproduction [edit]

Yellow-bellied Sapsuckers nest in a large cavity excavated in a deciduous tree, often choosing one weakened by disease; the same site may be used for several years. Both the male and the female work in making the nest, where five or seven white eggs are well concealed. Both birds share in hatching.[6]

They will mate with the same partner from year to year, as long as both birds survive. They sometimes hybridize with red-naped sapsuckers or red-breasted sapsuckers where their breeding ranges overlap.

Wintering and migration [edit]

These birds migrate to the southeastern United States, West Indies and Central America, leaving their summer range. This species has occurred as a very rare vagrant to Ireland and Great Britain.

Conservation [edit]

In the United States, Yellow-bellied Sapsuckers are listed and protected under the Migratory Bird Treaty Act.[7] Taking, killing, or possessing this species is illegal without a permit.

Relationship with humans [edit]

Damage to trees [edit]

Because Yellow-bellied Sapsuckers feed on up to two hundred fifty species of living trees and woody plants,[7] they are sometimes considered to be a pest.[8] The birds can cause serious damage to trees, and intensive feeding has been documented as a source of tree mortality.[9] Sapsucker feeding can kill a tree by girdling,[7] which occurs when a ring of bark around the trunk is severely injured. Certain tree species are particularly susceptible to dying after being damaged by Yellow-bellied Sapsuckers. For example, a USDA forest study that examined trees injured by Yellow-bellied Sapsuckers noted a mortality of 67 percent for Gray Birch (Betula populifolia), 51 percent for Paper Birch (Betula papyrifera), and 40 percent for Red Maple (Acer rubrum).[9] In other tree species, injuries inflicted by Yellow-bellied Sapsuckers can result in significantly less mortality. The USDA study noted that only 3 percent of Red Spruce (Picea rubens) and 1 percent of Hemlock (Tsuga canadensis) that were injured by sapsuckers succumbed to their wounds.[9]

In orchards, the USDA recommends allowing Yellow-bellied Sapsuckers to feed upon their preferred tree(s), suggesting the birds will focus their attention on these and spare the rest of the orchard from serious damage. Non-lethal deterrents can also be applied to trees to ward off the birds, including burlap wraps and bird tanglefoot (a type of sticky repellent).[7] In commercial aspen plantations, Yellow-bellied Sapsuckers can be drawn to a stand by individual trees infested by the fungus Fomes igniarius. Infested trees are prone to heartwood decay, which provides prime habitat for sapsuckers to carve nesting holes. Therefore, infested trees should be eliminated to prevent colonization of commercial aspen stands by sapsuckers.[7]

References [edit]

  1. ^ BirdLife International (2012). "Sphyrapicus varius". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ "ITIS Report: Sphyrapicus". Integrated Taxonomic Information System. Retrieved 30 April 2013. 
  3. ^ "ITIS Report: Sphyrapicus varius". Integrated Taxonomic Information System. Retrieved 30 April 2013. 
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ [1] (2011).
  6. ^ Wikisource-logo.svg Beach, Chandler B., ed. (1914). "Sap-Sucker". The New Student's Reference Work. Chicago: F. E. Compton and Co. 
  7. ^ a b c d e "How to Identify and Control Sapsucker Injury on Tress". North Central Forest Experiment Station, St. Paul, MN: USDA. Retrieved 30 January 2013. 
  8. ^ TATE, J. 1973. Methods and annual sequence of foraging by the sapsucker. Auk 90:840-856.
  9. ^ a b c Rushmore, Francis (1969). Sapsucker: Damage Varies with Tree Species and Seasons. Forest Service Research Paper NE-136. Northeastern Forest Experiment Station, Upper Darby, PA: USDA. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: S. NUCHALIS formerly was included in this species (Johnson and Zink 1983, Johnson and Johnson 1985). Constitutes a superspecies with S. NUCHALIS and Ruber (AOU 1998). See Cicero and Johnson (1995) for information on phylogenetic relationships among sapsuckers, based on mtDNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!