Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Andrena hippotes in Illinois

Andrena hippotes Robertson: Andrenidae (Andreninae), Hymenoptera
(observations are from Robertson, Krombein et al., and Graenicher)

Anacardiaceae: Rhus glabra [unsp] (Kr); Apiaceae: Angelica atropurpurea (Kr), Daucus carota (Kr), Pastinaca sativa sn (Rb, Kr), Zizia aurea (Kr); Asteraceae: Antennaria neglecta [unsp] (Gr), Taraxacum officinale (Kr); Brassicaceae: Barbarea vulgaris (Kr), Dentaria laciniata (Kr), Thlaspi arvense (Kr); Caprifoliaceae: Viburnum dentatum (Kr), Viburnum opulus (Kr), Viburnum prunifolium sn cp (Rb); Cornaceae: Cornus obliqua sn (Rb), Cornus racemosa sn (Rb); Fabaceae: Amorpha canescens (Kr), Cercis canadensis (Kr), Melilotus alba (Kr), Melilotus officinalis (Kr); Hippocastanaceae: Aesculus glabra np (Kr); Lauraceae: Sassafras albidum sn (Rb); Liliaceae: Camassia scilloides (Kr); Ranunculaceae: Caltha palustris (Kr), Ranunculus abortivus (Kr); Rhamnaceae: Ceanothus herbaceus (Kr); Rosaceae: Amelanchier arborea sn (Rb), Argentina anserina (Kr), Crataegus intricata sn (Rb), Crataegus mollis sn (Rb), Malus pumila (Kr), Physocarpus opulifolius (Kr), Prunus americana sn cp fq (Rb, Kr), Prunus serotina sn (Rb, Kr), Prunus virginiana (Kr), Rosa carolina cp (Kr), Rubus flagellaris (Rb); Rutaceae: Ptelea trifoliata sn cp fq (Rb, Kr), Zanthoxylum americanum [pist sn] (Rb); Salicaceae: Salix amygdaloides [stam sn cp fq] [pist sn fq] (Rb), Salix humilis [stam sn] (Rb), Salix interior [stam sn cp fq] (Rb), Salix nigra [stam sn cp] (Rb), Salix rigida [stam sn fq] (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena hippotes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATGAGCAGGTATAATAGGAGCCTCACTAAGATTCATTATTCGAATAGAATTGAGAAATCCAGGTAGATGAATCAATAACGACCAAATCTATAATTCAATTGTAACCTCTCACGCTTTCATTATAATTTTCTTCATAGTAATACCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATGGCTTTCCCGCGAATAAACAATATAAGTTTCTGACTACTCCCTCCATCAATTTTAATTATTTTATTTAGAATAATTTTAAATTCAGGGTCAGGTACAGGATGAACAGTATATCCCCCTTTATCATCATACTCCTATCATCCATCCTCATCAGTTGATTTAACAATCTTTTCATTACACATTGCAGGAGTATCATCAATCATAGGAGCAATTAATTTTATTGTAACAATTCTTAGAATAAAAAATATTTCACTAAACTATGATCAACTCCCACTATTCCCATGATCAGTATTTATTACCACAATTCTATTATTAATTTCTCTACCAGTTTTAGCTGGAGCCATCACAATATTACTATCAGACCGTAATTTAAATTCATCATTCTTTGATCCAATAGGAGGAGGAGATCCTATTCTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrena hippotes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!