Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Empidonax minimus

An extremely small (5 ¼ inches) flycatcher resembling several related species in the genus Empidonax, the Least Flycatcher may best be separated from its relatives not by appearance, but by its ‘che-BEK’ song. Physical field marks include a green-gray body, white eye ring, pale breast, thin bill, and white wing bars. Male and female Least Flycatchers are similar to one another in all seasons. The Least Flycatcher breeds across much of Canada and northern portions of the United States. Smaller populations occur south of this species main range at higher elevations in the Appalachian Mountains. Least Flycatchers spend the winter in south Florida, Mexico, and Central America, although identifying this species’ in much of its winter range is difficult due to its similarity to other related species. Least Flycatchers breed in open forests with deciduous trees or a mixture of deciduous and evergreen trees. This species may be found in similar habitats on migration. In its winter range, the Least Flycatcher inhabits topical forest edges and thickets. This species primarily eats insects. In northern forests in summer, Least Flycatchers are most likely to be seen darting through the canopy while gleaning insects from leaves or while catching prey in mid-air. Even when active, however, the Least Flycatcher is a difficult bird to identify. Learning this species’ song is crucial to separating it from its relatives, and silent birds are frequently impossible to identify in areas with multiple Empidonax species. Least Flycatchers are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southern Yukon to northern Saskatchewan and New Brunswick, south to southern British Columbia, northeastern Wyoming, eastern Nebraska, southern Missouri, south-central Indiana, Pennsylvania, and New Jersey, and to southern Appalachians. WINTERS: northern Mexico regularly to Nicaragua, rarely to Costa Rica, casually to central Panama (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Canada and US; winters n Mexico to Panama.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 10 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Empidonax minimus
Catalog Number: USNM 102737
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: Female; Adult
Preparation: Skin: Whole
Collector(s): J. Benedict & T. Lee
Year Collected: 1885
Locality: Cozumel Island, Quintana Roo, Mexico, North America
  • Type: Ridgway. February 26, 1885. Proc. Biol. Soc. Washington. 3: 23.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open woodland and brushy areas, forest borders, thinned woodland, tall second growth. In maple forests in Quebec, occurred where trees were the tallest, sugar maple was in nearly pure stand, and subcanopy was sparse (Darveau 1992).

Nests in poplar woodland, deciduous scrub, forest edge, parks, old orchards, roadside shade trees, and gardens; in crotch or on limb of tree (often deciduous) or shrub, often 3-6 m above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates north through U.S. to nesting areas April-June (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects obtained by flycatching and hover-gleaning from perch under forest canopy or from fence post, wire, or other perch; also eats spiders, seeds, small fruits (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Empidonax minimus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Empidonax minimus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In maple forests in Quebec, density averaged 1.7 pairs/ha (Darveau et al. 1992). In New Hampshire, least flycatchers locally excluded ASY (after second year) American redstarts from the best patches of habitat within a heterogeneous array of such patches (Sherry and Holmes 1988). In winter, solitary and sedentary, both sexes territorial (Stiles and Skutch 1989, Rappole and Warner 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size is 2-6 (usually 4). Incubation lasts 14-16 days, by female (which male may feed). Young leave nest at 13-16 days, tended by both parents for up to 20 days after leaving nest.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Empidonax minimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATNTAATTTTTGGCGCNNGAGCCGGTATGATTGGTACCGCTTTAAGCCTCNTTATTCGAGCAGAACTCGGACAGCCAGGAACTCTCCTAGGAGATGATCAAATTTACAACGTAATCGTCACTGCTCATGCTTTCGTAATGATCTTCTTTATAGTTATGCCCATCATAATTGGGGGATTCGGTAACTGATTAGTCCCCCTGATAATTGGTGCCCCTGACATAGCATTTCCCCGTATAAATAATATAAGCTTCTGACTTTTACCCCCATCATTCCTCCTCCTCTTAGCNTCCTCCACAGTCGAAGCTGGNGCAGGAACAGGATGAACTGTTTATCCTCCATTAGCCGGTAACCTAGCACATGCCGGAGCTTCAGTAGACTTAGCCATTTTCTCTCTACACCTGGCAGGGGTCTCTTCTATCCTAGGAGCTATTAACTTCATTACTACCGCGATTAATATAAAACCACCCGCCCTATCACAATATCAAACCCCTCTATTTGTTTGATCTGTCTTAATTACCGCAGTTCTCCTCCTTCTCTCCCTACCAGTCCTTGCAGCCGGTATCACTATACTACTAACAGACCGTAACCTCAACACTACATTTTTCGACCCCGCAGGAGGTGGAGATCCCGTACTATATCAACATCTCTTCTGATTCTTTGGCCATCNAGAGGTCTATATTCTCATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Empidonax minimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Populations evidently are relatively stable over much of the large range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Local declines were noted (e.g., in the western Great Lakes region), but populations were stable or increasing in other areas (Ehrlich et al. 1992). Breeding Bird Survey data indicate a significant population decline in eastern North America, 1966-1988, and a significant increase in western North America, 1966-1988 and 1978-1988 (Sauer and Droege 1992). Overall, in North America, BBS data indicate a nonsignificant average annual decrease of 0.4% for the period 1966-1989 (Droege and Sauer 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: In Quebec, a moderate level of sugar maple decline (loss of foliage) did not affect nesting success, but birds may be negatively affected in more subtle ways (thermal strees of nestlings, more feeding and brooding required of parents) (Darveau et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Least flycatcher

The least flycatcher (Empidonax minimus), (also called chebec, or chebecker, after the sound it makes), is a small insect-eating bird. It is the smallest Empidonax flycatcher in eastern North America.

Description[edit]

The least flycatcher is between 5 and 5 34 inches (13 and 15 cm) long, with a 7 12 to 8 12 in (19 to 22 cm) spread.[2] It typically weighs around 11 grams (0.39 oz).[3] Adults have greyish-olive upperparts, darker on the wings and tail, with whitish underparts; they have a conspicuous white eye ring, white wing bars, a small, short bill and a short tail. The breast is washed with grey and the sides of the belly with yellow. It is similar in appearance to the larger eastern wood pewee.[4]

Distribution and habitat[edit]

Their breeding habitat is open deciduous or mixed woods across Canada and the northern United States. They make a cup nest on a fork in a small tree.

These birds migrate to Mexico and Central America.

Behaviour[edit]

They wait on an open perch low or in the middle of a tree and fly out to catch insects in flight (hawking), also sometimes picking insects from foliage while hovering (gleaning). They sometimes eat berries.[5]

The song is a dry che-bec. The call is a sharp whit.

References[edit]

  1. ^ BirdLife International (2012). "Empidonax minimus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Forbush, Edward Howe; May, John Bichard (1955). A Natural History of American Birds of Eastern and Central North America. Bramhall Books. pp. 318–319. ISBN 978-1-258-21691-7. 
  3. ^ McGillivray, William Bruce; Semenchuk, Glen Peter (1998). Federation of Alberta Naturalists Field Guide to Alberta Birds. Nature Alberta. p. 181. ISBN 978-0-9696134-2-8. Retrieved 14 December 2013. 
  4. ^ "Least Flycatcher". Nova Scotia Museum. Archived from the original on 26 September 2012. Retrieved 15 December 2013. 
  5. ^ "Least Flycatcher". All About Birds. Cornell Lab of Ornithology. Retrieved 15 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Least Flycatcher

Front view, Ottawa

The Least Flycatcher (Empidonax minimus), (also called chebec, or chebecker, after the sound it makes), is a small insect-eating bird. It is the smallest Empidonax flycatcher in eastern North America.

Description[edit]

The Least Flycatcher is between 5 and 5 34 inches (13 and 15 cm) long, with a 7 12 to 8 12 in (19 to 22 cm) spread.[2] It typically weighs around 11 grams (0.39 oz).[3] Adults have greyish-olive upperparts, darker on the wings and tail, with whitish underparts; they have a conspicuous white eye ring, white wing bars, a small, short bill and a short tail. The breast is washed with grey and the sides of the belly with yellow. It is similar in appearance to the larger Eastern Wood Pewee.[4]

Distribution and habitat[edit]

Their breeding habitat is open deciduous or mixed woods across Canada and the northern United States. They make a cup nest on a fork in a small tree.

These birds migrate to Mexico and Central America.

Behaviour[edit]

They wait on an open perch low or in the middle of a tree and fly out to catch insects in flight-(hawking), also sometimes picking insects from foliage while hovering (gleaning). They sometimes eat berries.[5]

The song is a dry che-bec. The call is a sharp whit.

References[edit]

  1. ^ BirdLife International (2012). "Empidonax minimus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Forbush, Edward Howe; May, John Bichard (1955). A Natural History of American Birds of Eastern and Central North America. Bramhall Books. pp. 318–319. ISBN 978-1-258-21691-7. 
  3. ^ McGillivray, William Bruce; Semenchuk, Glen Peter (1998). Federation of Alberta Naturalists Field Guide to Alberta Birds. Nature Alberta. p. 181. ISBN 978-0-9696134-2-8. Retrieved 14 December 2013. 
  4. ^ "Least Flycatcher". Nova Scotia Museum. Archived from the original on 26 September 2012. Retrieved 15 December 2013. 
  5. ^ "Least Flycatcher". All About Birds. Cornell Lab of Ornithology. Retrieved 15 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Banks and Browning (1995) rejected the use of the name E. PUSILLUS for this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!