Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Biology

This species is wary, although not shy (1), and a high perch is normally occupied whilst singing (1). The female builds the nest, which consists of a cup of grasses and moss with a lining of hair or very fine grasses (6). Between 2 to 6 eggs are laid per clutch, and incubation takes 12 to 14 days (8). In winter, yellowhammers form flocks, often in mixed species groups with other seed-eating birds (11). They feed mainly on cereals and large grass seeds as well as the seeds of docks and other plants, which they typically pick from the ground (5). They may also perch on cereal stems to obtain grains during autumn (5). Towards the evening, flocks fly to roost in scrubby or marshy areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The yellowhammer is one of the brightest coloured of our native birds (3). It is a fairly large bunting, with a long tail, white outer tail feathers, a rust-coloured rump and yellowish plumage. In summer, males develop striking breeding colours; the head and underparts become bright yellow, with olive green or red-brown flecks to the breast (1). Females and juveniles are generally duller in colour, with grey or black streaks on the breast and sides (1). The song of the yellowhammer consists of rapidly repeated notes, and has earned the species the local names of 'a little-bit-of-bread-and- no-cheese' in parts of England, and 'may-the-Devil-take-you' in Scotland; both of which are imitative of the song (3). Yet more local names including 'scribbler' and 'writing lark' refer to the eggs, which are usually covered in dark squiggly lines resembling scrawled handwriting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Widespread and common throughout much of Europe, the yellowhammer is a resident species in the UK (present throughout the year), and has a more restricted distribution in Scotland than the rest of the British Isles (4). Some of the Scandinavian population migrate in small numbers to the British Isles during winter (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.632 - 10.632
  Nitrate (umol/L): 12.829 - 12.829
  Salinity (PPS): 32.748 - 32.748
  Oxygen (ml/l): 6.507 - 6.507
  Phosphate (umol/l): 0.734 - 0.734
  Silicate (umol/l): 8.436 - 8.436
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seems to prefer farmland, particularly bushy areas, as well as the edges of woodlands, wooded pasture, and heaths (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Emberiza citrinella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCACAAAGACATTGGCACTCTATACCTGATTTTCGGTGCATGAGCCGGAATGGTAGGTACCGCCTTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTGGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATACCAATNATGATCGGAGGGTTCGGAAACTGACTCGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGGATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTCCTGCTACTACTAGCATCTTCTACTGTAGAAGCNGGCGTAGGAACAGGCTGAACAGTGTACCCCCCACTAGCCGGAAACCTAGCCCATGCCGGAGCTTCGGTCGACCTCGCAATCTTCTCCCTTCACCTAGCCGGTATCTCTTCAATCCTGGGGGCAATCAACTTCATCACTACAGCAATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCTCTATTCGTCTGATCAGTCTTAATTACCGCAGTCCTCCTGCTCCTGTCCCTCCCAGTCCTTGCCGCCGGCATTACAATACTACTCACGGACCGTAACCTTAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCCGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCTTAATTCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Emberiza citrinella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981. Listed under Appendix II of the Berne Convention and classified as a species of conservation concern by the UK Biodiversity Action Plan, although not a priority species (2). Included in the Birds of Conservation Concern Red List (high conservation concern) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 18000000-31000000 breeding pairs, equating to 54000000-93000000 individuals (BirdLife International 2004). Europe forms 50-74% of the global range, so a very preliminary estimate of the global population size is 73000000-186000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Like other species of bunting, this species, although still fairly common, has suffered following the widespread intensification of agriculture, including the large-scale removal of hedgerows and scrubland, and changes in land-use, reducing the availability of seeds in winter (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The yellowhammer receives general protection under the Wildlife and Countryside Act of 1981. Section 1 of this act prohibits the intentional killing, injuring or taking of any wild bird as well as the taking, damaging or destroying of the nest (whilst being built or in use) or eggs. It also forbids possession of wild birds (dead or alive) or their eggs (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellowhammer

This article is about the Eurasian bird. For other uses, see Yellowhammer (disambiguation).
A heavily streaked brown back.
Female

The Yellowhammer (Emberiza citrinella) is a passerine bird in the bunting family Emberizidae. It is common in all sorts of open areas with some scrub or trees and form small flocks in winter.

The Yellowhammer is a robust 15.5–17 cm long bird, with a thick seed-eater's bill. The male has a bright yellow head, yellow underparts, and a heavily streaked brown back. The female is much duller, and more streaked below. The familiar, if somewhat monotonous, song of the cock is often described as A little bit of bread and no cheese.

Its natural diet consists of insects when feeding young, and otherwise seeds. The nest is on the ground. 3-6 eggs are laid, which show the hair-like markings characteristic of those of buntings.

Beethoven admitted he got the idea for the first four notes of his 5th symphony from the yellowhammer's call. The bird prefaces the last, lower, note with 5 or more notes - instead of Beethoven's three - and occasionally sings the last note higher than the others.

Contents

Range [edit]

It breeds across Europe and much of Asia. In parts of Europe it is in serious decline; in the UK the species fell by 54% between 1970 and 2003. In Europe and Asia most birds are resident, but some far northern birds migrate south in winter.

Habitat [edit]

It is most commonly found on lowland arable and mixed farmland, probably due to the greater availability of seeds. It nests in hedges, patches of scrub, and ditches, especially if these have a wide grass margin next to them, and a cereal crop next to the margin. Hedges of up to two metres tall are preferred, and they will not nest until it is in full leaf, building the nest next to the hedge if it is built before this. In winter, the flocks feed at good seed sites, such as newly-sown fields and over-wintered stubbles.

The Yellowhammer was introduced to New Zealand in 1862 and is now common and widespread there.

Diet [edit]

Seeds of:[citation needed]

Invertebrates - mainly, but not exclusively - taken through the breeding season:

They are more able to feed on the slower-moving invertebrates.

References [edit]

  • RSPB A management guide to birds of lowland farmland
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!