Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Agapostemon virescens in Illinois

Agapostemon virescens Fabricius: Halictidae (Halictinae), Hymenoptera
(observations are by Robertson, Graenicher, Reed, Moure & Hurd, Evans, Clinebell, Daly, Grundel et al., Tuell et al.)

Acanthaceae: Justicia americana sn (Rb), Ruellia humilis cp np (Rb); Alismataceae: Sagittaria latifolia [stam sn] [pist sn] (Rb); Anacardiaceae: Rhus glabra [stam sn cp] [pist sn] (Rb); Apiaceae: Cicuta maculata sn (Rb), Zizia aurea sn (Rb); Asteraceae: Achillea millefolium (Re), Arctium lappa sn cp (Gr), Aster sp. (Gnd), Aster drummondii sn (Gr), Aster ericoides (Re), Aster laevis sn cp (Gr, Tll), Aster lanceolatus sn cp (Gr, Re), Aster lateriflorus sn cp (Rb, Gr), Aster nova-angliae sn (Gr, Tll), Aster ontarionis (Re), Aster oolentangiensis (Re), Aster pilosus sn cp fq (Rb), Aster turbinellus sn (Rb), Bidens aristosa sn cp (Rb), Cirsium altissimum sn (Rb), Cirsium arvense sn cp (Gr, Re), Cirsium discolor (MH), Cirsium vulgare sn cp (Rb, Gr), Coreopsis palmata (MH), Echinacea pallida sn (Rb, Cl), Echinacea purpurea sn cp (Rb, Cl), Erigeron philadelphicus sn cp (Rb, Gr), Eupatorium perfoliatum (Tll), Eupatorium serotinum sn fq (Rb), Helenium autumnale sn (Rb, Gr), Helianthus annuus sn fq (Rb), Helianthus grosseserratus sn (Rb), Helianthus mollis sn (Rb), Helianthus pauciflorus (Re), Helianthus strumosus sn cp (Gr, Tll), Heliopsis helianthoides sn cp (Rb, Re), Krigia biflora sn cp (Rb), Liatris aspera (Re, Gnd, Tl), Liatris pycnostachya sn cp fq (Rb, Cl), Oligoneuron rigidum (Ev), Pyrrhopappus carolinianus cp (MH, Da), Ratibida pinnata (Re), Rudbeckia hirta sn cp (Rb, Ev, Re), Silphium laciniatum sn cp (Rb), Silphium perfoliatum sn cp fq (Rb, Tll), Solidago sp. (Gnd), Solidago nemoralis (Ev), Solidago riddellii fq (Tll), Verbesina helianthoides sn (Rb), Vernonia fasciculata sn (Rb), Vernonia missurica fq (Tll); Campanulaceae: Lobelia siphilitica np (Tll), Lobelia spicata sn (Rb); Caprifoliaceae: Symphoricarpos albus sn (Gr), Symphoricarpos occidentalis sn (MH, Gr); Commelinaceae: Tradescantia virginiensis cp (Rb); Convolvulaceae: Calystegia sepium sn (Rb), Ipomoea purpurea sn (Rb); Cornaceae: Cornus obliqua sn cp (Rb), Cornus racemosa sn cp (Rb); Dipsacaceae: Dipsacus fullonum sn (Rb); Ebenaceae: Diospyros virginiana [stam sn cp np] [pist sn np] (Rb); Fabaceae: Dalea purpurea sn cp fq (Rb, Re), Melilotus alba sn (Rb), Trifolium hybridum (Gnd), Trifolium repens sn cp (Rb); Geraniaceae: Geranium maculatum sn (Rb); Hypericaceae: Hypericum sphaerocarpum cp (Rb); Lamiaceae: Agastache nepetoides (Tll), Blephilia ciliata sn cp fq (Rb), Blephilia hirsuta sn (Rb), Monarda fistulosa (Re, Cl), Nepeta cataria sn (Rb), Pycnanthemum pilosum sn fq (Rb), Stachys palustris sn (Rb), Teucrium canadense sn (Rb); Liliaceae: Camassia scilloides sn (Rb); Lythraceae: Lythrum alatum sn (Rb); Malvaceae: Malva neglecta sn cp fq (Rb); Nyctaginaceae: Mirabilis nyctaginea (Re); Nymphaeaceae: Nymphaea tuberosa cp fq (Rb); Onagraceae: Oenothera biennis cp (Rb), Oenothera pilosella cp fq np (Rb); Oxalidaceae: Oxalis violacea sn (Rb); Rhamnacae: Ceanothus americanus (MH); Rosaceae: Rosa blanda cp (Re), Rosa carolina cp (Rb), Rosa setigera cp fq (Rb, Tll), Rubus allegheniensis sn (Rb), Rubus flagellaris sn cp (Rb); Rubiaceae: Cephalanthus occidentalis sn (Rb, Tll), Houstonia longifolia (Ev); Rutaceae: Ptelea trifoliata sn (Rb); Scrophulariaceae: Linaria vulgaris sn np (Rb), Penstemon digitalis cp np (Rb), Penstemon grandiflorus cp np (Re), Scrophularia marilandica sn (Rb), Verbascum thapsus cp (Rb), Veronicastrum virginicum sn (Rb); Verbenaceae: Phyla lanceolata sn (Rb), Verbena stricta sn fq (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agapostemon virescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTATATGATCTGGAATAATTGGTTCATCAATAAGAATATTAATTCGTATAGAATTAAGAATTCCTGGAAGATGAATTTCAAATGATCAATTATTTAATACTATTGTAACTTCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTTTTATAATTGGAGGATTCGGAAATTGACTTATCCCATTAATAATTGGAGCTCCAGATATGGCCTTTCCACGAATAAATAACATAAGATTTTGACTTTTAGTCCCATCATTATTTTTATTACTATTAAGAAGAATATTAATATCAGGATCTGGGACAGGTTGAACAATTTACCCCCCATTATCATCCATCATTTACCATAATTCTAGATCTGTTGATTTAACAATTTTTTCTTTACACATTGCTGGAATTTCATCTATTATAGGAGCAATTAATTTTATTGTATCAATTGTAATAATAAAAAATATTTCCTTAAAATTTGATCAAATCCCCTTATTTCCATGATCAGTCAAAATTACTGCTATTCTTCTCCTCCTATCTCTTCCAGTATTAGCTGGTGCAATTACTATATTACTAACTGATCGAAATATAAATACCTCATTTTTTGACCCCTCTGGAGGNGGAGACCCAATTCTATACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agapostemon virescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!