Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Andrena forbesii in Illinois

Andrena forbesii Robertson: Andrenidae (Andreninae), Hymenoptera
(observations are from Robertson, Graenicher, Krombein et al., and Schemske et al.)

Aceraceae: Acer negundo cp (Kr); Anacardiaceae: Rhus aromatica [pist sn fq] (Rb), Toxicodendron radicans [unsp] (Kr); Apiaceae: Erigenia bulbosa sn (Rb), Heracleum maximum (Rb), Pastinaca sativa (Kr), Polytaenia nuttalli (Rb), Zizia aurea (Rb, Kr); Asteraceae: Antennaria neglecta [unsp] (Gr), Antennaria plantaginifolia [pist sn] (Rb), Taraxacum officinale (Kr); Brassicaceae: Alliaria petiolata (Kr), Barbarea vulgaris (Kr), Capsella bursa-pastoris sn (Rb), Cardamine bulbosa (Kr), Dentaria laciniata (Kr), Thlaspi arvense (Kr); Caprifoliaceae: Symphoricarpos occidentalis sn (Gr), Viburnum dentatum sn cp (Rb), Viburnum opulus (Kr), Viburnum prunifolium sn cp (Rb); Caryophyllaceae: Stellaria media sn (Rb); Cornaceae: Cornus florida (Kr), Cornus racemosa sn (Rb); Crassulaceae: Sedum ternatum (Kr); Euphorbiaceae: Euphorbia commutata (Kr); Fabaceae: Cercis canadensis (Kr), Melilotus alba (Kr), Melilotus officinalis (Kr); Grossulariaceae: Ribes missouriense (Kr); Lauraceae: Sassafras albidum sn (Rb); Liliaceae: Erythronium albidum (Shm), Erythronium americanum (Kr); Malvaceae: Callirhoe digitata (Kr); Portulacaceae: Claytonia virginica sn cp fq (Rb, Shm); Ranunculaceae: Enemion biternatum cp/exp (Rb, Shm), Ranunculus abortivus (Kr); Rhamnaceae: Ceanothus herbaceus (Kr), Rhamnus lanceolata (Kr); Rosaceae: Amelanchier arborea sn fq (Rb), Amelanchier laevis (Kr), Aronia melanocarpa (Kr), Aruncus dioicus [unsp] (Kr), Crataegus crus-galli sn cp (Rb), Crataegus mollis sn cp (Rb), Fragaria virginiana (Rb, Kr), Malus pumila (Kr), Physocarpus opulifolius (Kr), Prunus americana sn (Rb), Prunus serotina sn cp (Rb, Kr), Prunus virginiana (Kr), Rubus allegheniensis (Rb), Rubus flagellaris (Rb), Spiraea alba (Kr); Rutaceae: Ptelea trifoliata sn (Rb), Zanthoxylum americanum [stam sn fq] [pist sn fq] (Rb); Salicaceae: Populus deltoides cp (Kr), Salix amygdaloides [stam sn cp fq] [pist sn fq] (Rb), Salix discolor [unsp sn] (Kr, Gr), Salix humilis [pist sn fq] [stam sn fq] (Rb), Salix nigra [stam sn] (Rb), Salix rigida [stam sn fq] [pist sn fq] (Rb); Smilacaceae: Smilax tamnoides hispida sn (Gr)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena forbesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATACTATACTTCATCTTCGCAATATGAGCAGGAATAATAGGAGCCTCATTAAGATTCATTATTCGAATAGAATTAAGAAATCCAGGCAGATGAATTAATAATGATCAAATCTATAACTCAATCGTAACCTCTCACGCTTTCATTATAATTTTTTTCATAGTAATACCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATGGCTTTCCCGCGAATAAACAATATAAGTTTCTGACTACTCCCTCCATCAATTTTAATTATTTTATTTAGAATAACTATAAATTCAGGATCAGGTACAGGATGAACAGTATATCCACCCTTATCATCATACTCTTATCATCCATCCTCATCAGTTGATTTAACAATTTTTTCACTACATATTGCAGGAGTATCATCAATCATAGGGGCAATTAATTTTATTGTAACAATTCTTAGTATAAAAAATGTTTCATTAAATTATGATCAACTTCCACTATTCCCATGATCAGTATTTATTACCACAATCCTATTATTAATCTCTCTACCAGTTTTAGCTGGAGCCATCACAATATTACTATCAGACCGTAATTTGAATTCATCATTCTTTGACCCAATAGGAGGAGGTGATCCAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrena forbesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!