Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Ceratina calcarata in Illinois

Ceratina calcarata Robertson: Anthophoridae (Ceratinini), Hymenoptera
(observations are from Robertson, Mitchell, Wyatt & Hellwig, Stoutamire, and Motten; only the flower visitations of male bees were reported by Robertson, probably because the female bee of this species is virtually indistinguishable from the female bee of Ceratina dupla)

Anacardiaceae: Rhus aromatica [pist sn] (Rb), Rhus glabra [pist sn] (Rb); Apiaceae: Erigenia bulbosa sn (Rb), Osmorhiza longistylis sn (Rb), Perideridia americana sn (Rb), Taenidia integerrima sn (Rb); Asteraceae: Antennaria plantaginifolia [stam sn] [pist sn] (Rb), Arnoglossum muhlenbergii sn (Rb), Aster lateriflorus sn (Rb), Aster pilosus sn fq (Rb), Erigeron philadelphicus sn fq (Rb), Erigeron strigosus sn (Rb), Rudbeckia laciniata sn (Rb); Brassicaceae: Arabis laevigata sn (Rb), Arabis shortii sn (Rb), Cardamine bulbosa sn (Rb), Lepidium virginicum sn fq (Rb); Fabaceae: Cercis canadensis sn (Rb); Hydrophyllaceae: Ellisia nyctelea sn fq (Rb); Lamiaceae: Blephilia hirsuta sn (Rb); Liliaceae: Camassia scilloides sn (Rb), Smilacina stellata sn (Rb); Orchidaceae: Cypripedium pubescens exp (Rb, Stm); Oxalidaceae: Oxalis violaceae sn fq (Rb); Papaveraceae: Sanguinaria canadensis exp (Rb); Polemoniaceae: Polemonium reptans sn (Rb); Portulacaceae: Claytonia virginica sn (Rb, Mtt); Ranunculaceae: Anemonella thalictroides (Mtt), Enemion biternatum cp/exp (Rb), Hepatica acutiloba cp/exp (Rb), Ranunculus fascicularis sn (Rb), Ranunculus septentrionalis sn (Rb); Rosaceae: Aruncus dioicus [pist sn] (Rb), Fragaria virginiana (Mch), Geum vernum sn (Rb), Porteranthus stipulatus sn (Rb), Potentilla simplex sn (Rb), Prunus serotina sn (Rb); Rubiaceae: Houstonia caerulea (WH); Rutaceae: Zanthoxylum americanum [pist sn] (Rb); Salicaceae: Salix amygdaloides [stam sn] (Rb), Salix interior [stam sn] (Rb), Salix nigra [stam sn] (Rb), Salix rigida [pist sn fq] (Rb); Scrophulariaceae: Collinsia verna sn (Rb); Thymelaeaceae: Dirca palustris sn (Rb); Valerianaceae: Valerianella radiata sn (Rb); Verbenaceae: Verbena stricta sn (Rb); Violaceae: Viola striata sn np (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ceratina calcarata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 105
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ceratina calcarata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATATTATATTTGCTATATGATCAGGTATAATCGGAGCATCAATAAGATTAATTATTCGAATAGAATTAAGAACCCCAGGAAATTGAATTAATAATGATCAAATTTATAACTCATTAGTTACTGCTCATGCCTTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGATTTGGAAATTGATTAATCCCTCTAATATTAGGATCACCAGATATATCTTTTCCTCGTTTAAATAATATTAGTTTTTGATTATTACCCCCATCATTACTACTATTATTATTAAGAAATTTATTTTCAATAAGACCAGGAACAGGATGAACTGTTTATCCACCTTTATCATCATATTTATTTCACCCATCCCCATCAGTAGATTTAGCTATTTTTTCCTTACATATATCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATAGTTACTATTATAATAATAAAAAATATTTCATTAAATTATGACTCTATTCCATTATTTTCATGAGCAGTATTTATTACAGCAATTTTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTATTTGATCGAAATTTAAATACATCCTTTTTTGATCCTATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!