Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

Flowering Plants Visited by Ceratina calcarata in Illinois

Ceratina calcarata Robertson: Anthophoridae (Ceratinini), Hymenoptera
(observations are from Robertson, Mitchell, Wyatt & Hellwig, Stoutamire, Motten, Steury et al., Smith et al., Grundel et al.; only the flower visitations of male bees were reported by Robertson, probably because the female bee of this species is virtually indistinguishable from the female bee of Ceratina dupla)

Amaryllidaceae: Hypoxis hirsuta cp (Gnd); Anacardiaceae: Rhus aromatica [pist sn] (Rb), Rhus copallina [unsp] (Gnd), Rhus glabra [pist sn] (Rb); Apiaceae: Erigenia bulbosa sn (Rb), Osmorhiza longistylis sn (Rb), Perideridia americana sn (Rb), Taenidia integerrima sn (Rb); Asteraceae: Antennaria plantaginifolia [stam sn] [pist sn] (Rb), Arnoglossum muhlenbergii sn (Rb), Aster spp. (Gnd), Aster dumosus (Gnd), Aster lateriflorus sn (Rb), Aster patens (SDO), Aster pilosus sn fq (Rb), Chrysopsis sp. (Smh), Coreopsis palmata (Gnd), Coreopsis tripteris (Gnd), Erigeron sp. (Smh), Erigeron annuus (SDO, Gnd), Erigeron philadelphicus sn fq (Rb, Smh), Erigeron strigosus sn (Rb, Gnd), Eupatorium hyssopifolium (SDO), Helenium sp. (Smh), Helianthus annuus (Gnd), Helianthus divaricatus fq (Gnd), Hieracium scabrum (Gnd), Ionactis linariifolius (SDO), Liatris aspera (Gnd), Liatris spicata (SDO), Rudbeckia hirsta (Gnd), Rudbeckia laciniata sn (Rb), Senecio anonymus (Smh), Senecio aureus (Gnd), Solidago spp. fq (Gnd), Solidago nemoralis (SDO), Solidago simplex racemosa (SDO), Taraxacum officinale (Gnd), Vernonia gigantea (Gnd); Brassicaceae: Arabis laevigata sn (Rb), Arabis lyrata (Gnd), Arabis shortii sn (Rb), Cardamine bulbosa sn (Rb), Lepidium virginicum sn fq (Rb); Euphorbiaceae: Euphorbia corollata (SDO); Fabaceae: Cercis canadensis sn (Rb); Hydrophyllaceae: Ellisia nyctelea sn fq (Rb); Lamiaceae: Blephilia hirsuta sn (Rb); Liliaceae: Camassia scilloides sn (Rb), Narcissus sp. (Smh), Smilacina stellata sn (Rb); Onagraceae: Oenothera biennis (Gnd); Orchidaceae: Cypripedium pubescens exp (Rb, Stm); Oxalidaceae: Oxalis sp. (Smh), Oxalis violaceae sn fq (Rb); Papaveraceae: Sanguinaria canadensis exp (Rb); Polemoniaceae: Polemonium reptans sn (Rb); Portulacaceae: Claytonia virginica sn (Rb, Mtt); Ranunculaceae: Anemonella thalictroides (Mtt), Enemion biternatum cp/exp (Rb), Hepatica acutiloba cp/exp (Rb), Ranunculus bulbosus (SDO), Ranunculus fascicularis sn (Rb), Ranunculus septentrionalis sn (Rb); Rosaceae: Aruncus dioicus [pist sn] (Rb), Fragaria virginiana (Mch, Gnd), Geum vernum sn (Rb), Porteranthus stipulatus sn (Rb), Potentilla simplex sn (Rb), Prunus serotina sn (Rb), Pyrus calleryana (SDO), Rosa sp. cp (Smh), Rosa multiflora cp (Smh), Rubus allegheniensis (Gnd), Rubus hispidus (Gnd); Rubiaceae: Hedyotis nigricans (Smh), Houstonia caerulea (WH); Rutaceae: Zanthoxylum americanum [pist sn] (Rb); Salicaceae: Salix sp. [unsp] (Gnd), Salix amygdaloides [stam sn] (Rb), Salix interior [stam sn] (Rb), Salix nigra [stam sn] (Rb), Salix rigida [pist sn fq] (Rb); Scrophulariaceae: Agalinis purpurea (SDO), Collinsia verna sn (Rb); Thymelaeaceae: Dirca palustris sn (Rb); Valerianaceae: Valerianella radiata sn (Rb); Verbenaceae: Verbena stricta sn (Rb); Violaceae: Viola striata sn np (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ceratina calcarata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATATTATATTTGCTATATGATCAGGTATAATCGGAGCATCAATAAGATTAATTATTCGAATAGAATTAAGAACCCCAGGAAATTGAATTAATAATGATCAAATTTATAACTCATTAGTTACTGCTCATGCCTTTTTAATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGATTTGGAAATTGATTAATCCCTCTAATATTAGGATCACCAGATATATCTTTTCCTCGTTTAAATAATATTAGTTTTTGATTATTACCCCCATCATTACTACTATTATTATTAAGAAATTTATTTTCAATAAGACCAGGAACAGGATGAACTGTTTATCCACCTTTATCATCATATTTATTTCACCCATCCCCATCAGTAGATTTAGCTATTTTTTCCTTACATATATCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATAGTTACTATTATAATAATAAAAAATATTTCATTAAATTATGACTCTATTCCATTATTTTCATGAGCAGTATTTATTACAGCAATTTTATTACTTTTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTATTTGATCGAAATTTAAATACATCCTTTTTTGATCCTATAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ceratina calcarata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 105
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!