Articles on this page are available in 2 other languages: Chinese (Simplified) (8), Dutch (1) (learn more)

Overview

Brief Summary

There is no other bird that can fly as well as the common swift. It even flies while sleeping. Common swifts make a high screeching sound and catch insects in flight. Although they have many resemblances to swallows, they are not related. In totally natural situations, they build their nests on rocks. However, due to a lack of rocky mountains in this country, they are contented with buildings, nesting mostly under the eaves. Therefore, it is no wonder that common swifts only breed in cities and villages with old buildings. Renovations and new buildings usually offer few nesting opportunities for common swifts.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Common swifts, Apus apus, can be found in almost any region from western Europe to eastern Asia and from northern Scandanavia and northern Siberia to North Africa, Himalayas, and central China. Apus apus can be found throughout this range during the breeding season and, following migration, spends the winter months in Southern Africa, from Zaire and Tanzania south to Zimbabwe and Mozambique.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Bannerman, D. 1955. Order Apodiformes, Sub-Order Apodes, Family Apodidae, Genus Apus. Pp. 1-12 in The Birds of the British Isles, Vol. IV, 1 Edition. Edinburgh: Oliver and Boyd Ltd..
  • 1985. Common swift (Apus apus). Pp. 657-670 in D Snow, ed. The Birds of the Western Palearctic: Birds of Europe, the Middle East, and North Africa. New York: Oxford University Press..
  • 2003. Swifts. Pp. 421-425, 429-430 in M Hutchins, ed. Grzimek’s Animal Life Encyclopedia, Second Edition, Vol. 9. New York: The Gale Group, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common swifts are 16-17 cm in length with a wingspan of 42-48 cm, depending upon the age of the individual. Common swifts are black-brown in color with the exception of a white to cream colored chin and throat (located directly underneath the beak). In addition, the topside of the flight feathers is a paler brown-black color in comparison to the rest of the body. Apus apus can also be distinguished by its moderately forked tail feathers, its narrow, sickle-shaped wings, as well as its shrill, screaming call.  Apus apus is frequently mistaken for a swallow or a hummingbird. Apus apus is larger and has very a different wing shape and flight pattern than do hummingbirds or swallows. All members of the family Apodidae possess a unique morphological characteristic, a lateral “grasping foot” in which toes one and two are opposed by toes three and four. This allows the common swift to occupy areas such as walls of rock, chimneys, and other vertical surfaces that would be difficult for other types of birds to inhabit. Apus apus is a sexually monomorphic species, meaning that the males and females look alike. There has been no seasonal or geographical variation reported in the appearance. However, it is possible to distinguish juveniles from adults in the slight difference in richness and uniformity of their coloration, as it is common for juveniles to be blacker in color, as well as to have a pale forehead, white-fringed feathers, and a starker white patch under the beak. This distinction is best observed at close range.

Average length: 16-17 cm.

Range wingspan: 42 to 48 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 44.9 g.

Average basal metabolic rate: 0.4372 W.

  • Johnson, L. 1992. Birds of Europe with North Africa and the Middle East. London: A & C Black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The majority of the breeding habitat of A. apus is located in temperate zones, where there are suitable trees for nesting and sufficient open spaces in which to fly to gather food. The habitat of Apus apus during the months following migration into Africa, however, is tropical. Common swifts have been observed breeding from sea level to several thousand meters in elevation. Apus apus prefers areas with trees, or buildings with open spaces, and is able to use vertical surfaces such as rock walls and chimneys for nesting due to a unique physical adaptation possessed by all swifts (Apodidae).

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban

  • Bruun, B., H. Delin, L. Svensson. 1992. Birds of Britain and Europe. London: Hamlyn Publishing Group Limited.
  • Terres, J. 1980. Swift Family. Pp. 868-870 in The Audubon Society Encyclopedia of North American Birds. New York: Alfred A Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 52 specimens in 2 taxa.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.891 - 11.597
  Nitrate (umol/L): 1.206 - 12.040
  Salinity (PPS): 6.607 - 35.137
  Oxygen (ml/l): 6.271 - 8.052
  Phosphate (umol/l): 0.284 - 0.653
  Silicate (umol/l): 1.816 - 10.887

Graphical representation

Temperature range (°C): 8.891 - 11.597

Nitrate (umol/L): 1.206 - 12.040

Salinity (PPS): 6.607 - 35.137

Oxygen (ml/l): 6.271 - 8.052

Phosphate (umol/l): 0.284 - 0.653

Silicate (umol/l): 1.816 - 10.887
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common swifts are insectivorous, feeding solely on aerial insects and spiders that it gathers in its mouth as it glides through the air. The insects are gathered together inside the throat through the use of a product from the salivary glands, to form a food-ball or bolus. Apus apus is commonly attracted to swarms of insects, as it aides in the ease of collecting sufficient food. It has been estimated that there are an average of 300 insects per bolus, and that each nest of young may receive 3000 food-balls per day. These numbers may vary based upon the abundance of prey. Among some of the most commonly consumed insects are aphids (Hemiptera), wasps, bees, and ants (Hymenoptera), beetles (Coleoptera), and flies (Diptera).

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / guest
puparium of Crataerina pallida is a guest in nest of Apus apus
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
adult of Oeciacus hirundinis sucks the blood of nestling of Apus apus
Other: minor host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

As a predator, A. apus contributes to the control of the insect population.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Most notable among the anti-predator adaptations of A. apus is its aerial mastery, allowing these birds to avoid most of their natural predators, including Eurasian hobbies (Falco subbuteo), sparrowhawks (Accipiter nisus), and buzzards (Buteo buteo), by taking to the air. In addition, the choice of nesting sites on vertical surfaces such as rock walls and chimneys makes it difficult for common swifts to be preyed upon because of the level of difficulty associated with accessing the nest area. The plain coloration of Apus apus also is advantageous for predator evasion as it makes them difficult to see when they are not in the air.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication between Apus apus occurs almost exclusively through the use of different vocalizations, or calls, and by changes in body language. The types of calls used by A. apus are largely dependent upon its age. There are different calls used by the adults than by the young. The most common call during flight, a long, shrill ‘sreee’, is used in innumerable contexts by adults. Also among the vocalizations of the adults are those given during allopreening (nest-call), those following defeat in a fight (piping-call), as well as those preceding copulation (pre-copulatory call). The most common call used by young is the food-call, used to beg for food from a parent upon its return.

Communication Channels: visual ; tactile ; acoustic

  • Svensson, L., P. Grant. 1999. Birds of Europe. Princeton: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Apus apus is typically long-lived. A common swift banded in Sweden was re-trapped at the age of 17. The annual survival rate for the adults is 65-83%.

Range lifespan

Status: wild:
21 (high) years.

Average lifespan

Status: captivity:
21.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Apus apus usually first breeds at two years of age, but the age of the first breeding can vary based upon the availability of nesting sites. The common swift is a monogamous species, meaning that it typically has one partner in a lifetime, and that the bond between the pair is maintained from year to year. The male A. apus typically chooses the nest site. Upon the arrival of the female shortly thereafter (usually within a period of days), the nesting site is protected by the pair. The nest is typically composed of grass, leaves, hay, straw, and flower petals (among other things). The nesting site usually includes the nest itself and the areas directly surrounding the nest. Courtship, some copulation, and the rearing of the chicks all occur at this site.  Colonies of A. apus typically include 30-40 nest sites, reflecting the gregarious nature of the common swift mating system. Apus apus is more likely to fight to defend a nesting site than it is to defend a mate. Males attract their female partners through attainment of a good nesting site prior to their meeting. Upon their first meeting it is not unusual for the initial responses of the potential mates, both male and female, to be hostile. If interested and unpaired, the female will enter the nest site tentatively, thereby inviting her potential partner to stroke her chin with its bill. If this encounter is successful, the female may also invite her potential partner to allopreen. Allopreening is the process by which birds smooth or clean each others feathers with their beak or bill. This mutual action begins the pair-bonding process.

Mating System: monogamous

Common swifts typically breed from late April to early May through mid-September when the young are fledged. One of the most unique characteristics of A. apus is its ability to mate while in flight, although they also can mate while perched. Mating occurs every few days following the arrival of suitable weather, until a few days after the young have fledged. Following a successful copulation, anywhere from one to four white eggs may be laid, however a clutch size of two is most common. Eggs must then be dutifully incubated for 19-20 days while the embryos develop. Both parents participate in the incubation of the clutch. After the young hatch, it can take an additional 27-45 days before fledging occurs.

Breeding interval: Apus apus breeds once yearly.

Breeding season: Common swifts breed from late April to early May through mid-September

Average eggs per season: 2.

Range time to hatching: 19 to 20 days.

Range fledging age: 27 to 45 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents take turns incubating the clutch following fertilization and prior to hatching. For the duration of the first week following hatching, the clutch is typically brooded all day long. During the second week, the young are brooded for approximately half of the day. For the remainder of the time, until the clutch is fledged, they are rarely brooded during the day, but are almost always covered at night. Both parents participate equally in all aspects of the raising of the young. In the event that unusually bad weather persists or food sources become scarce during the time shortly after the hatching of the young, the young possess the ability to become semi-torpid, a hibernation-like state, thereby reducing the energy demands of their rapidly growing bodies. This adaptation allows young A. apus to survive with little food for 10-15 days. During the time from hatching until fledging, the young are fed almost exclusively in the nest. The young are fed food-balls consisting of insects gathered by the parents during flight and held together with a salivary gland product, creating the food bolus. While the young are smaller, they will share a food bolus among them. However, once young are larger they become able to swallow an entire food bolus on their own.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Bannerman, D. 1955. Order Apodiformes, Sub-Order Apodes, Family Apodidae, Genus Apus. Pp. 1-12 in The Birds of the British Isles, Vol. IV, 1 Edition. Edinburgh: Oliver and Boyd Ltd..
  • Johnson, L. 1992. Birds of Europe with North Africa and the Middle East. London: A & C Black.
  • 2001. Common Swift (Apus apus). C Elphick, J Dunning, D Sibley, eds. National Audubon Society Sibley Guide to Bird Life and Behavior. New York: Alfred a Knopf, Inc..
  • 2003. Swifts. Pp. 421-425, 429-430 in M Hutchins, ed. Grzimek’s Animal Life Encyclopedia, Second Edition, Vol. 9. New York: The Gale Group, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Senses help avoid storms: swifts
 

Swifts can avoid electrical storms by sensing atmospheric ionization prior to a storm's arrival.

     
  "By sensing atmospheric ionization, the swift can detect an electrical storm before it arrives and elude danger by flying at right angles to its path, returning only once the storm has ended." (Shuker 2001:65)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Change increases aerodynamic performance: common swift
 

Wings of gliding birds increase aerodynamic performance by continuously changing shape and size.

   
  "Gliding birds continually change the shape and size of their wings, presumably to exploit the profound effect of wing morphology on aerodynamic performance. That birds should adjust wing sweep to suit glide speed has been predicted qualitatively by analytical glide models, which extrapolated the wing's performance envelope from aerodynamic theory. Here we describe the aerodynamic and structural performance of actual swift wings, as measured in a wind tunnel, and on this basis build a semi-empirical glide model. By measuring inside and outside swifts' behavioural envelope, we show that choosing the most suitable sweep can halve sink speed or triple turning rate. Extended wings are superior for slow glides and turns; swept wings are superior for fast glides and turns. This superiority is due to better aerodynamic performance—with the exception of fast turns. Swept wings are less effective at generating lift while turning at high speeds, but can bear the extreme loads. Finally, our glide model predicts that cost-effective gliding occurs at speeds of 8–10 m s-1, whereas agility-related figures of merit peak at 15–25 m s-1. In fact, swifts spend the night ('roost') in flight at 8–10 m s-1 (ref. 11), thus our model can explain this choice for a resting behaviour. Morphing not only adjusts birds' wing performance to the task at hand, but could also control the flight of future aircraft." (Lentink et al. 2007: 1082)
  Learn more about this functional adaptation.
  • Lentink, D.; Muller, U. K.; Stamhuis, E. J.; de Kat, R.; van Gestel, W.; Veldhuis, L. L. M.; Henningsson, P.; Hedenstrom, A.; Videler, J. J.; van Leeuwen, J. L. 2007. How swifts control their glide performance with morphing wings. Nature. 446(7139): 1082-1085.
  • Henningsson, P.; Spedding, G.R.; Hedenström, A. 2008. Vortex wake and flight kinematics of a swift in cruising flight in a wind tunnel. J. Exp. Biol. 211: 717-730.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apus apus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Apus apus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACAAACCACAAAGACATTGGCACCCTATACCTAATCTTTGGAGCATGAGCCGGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGAGCAGAACTTGGGCAACCAGGAACTCTCCTAGGAGAT---GACCAAATCTACAACGTCATTGTAACTGCTCACGCTTTCGTCATAATCTTCTTCATAGTCATGCCTATCATAATCGGAGGATTTGGAAACTGACTAGTACCCCTCATAATCGGTGCACCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGATTACTTCCTCCATCATTCCTACTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGCAGGAACAGGCTGAACCGTATACCCTCCCCTAGCAGGTAACTTAGCTCACGCAGGAGCATCAGTAGACCTCGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCCATCCTAGGTGCAATTAACTTCATCACCACCGCTATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACACCCCTATTCGTATGATCCGTCCTCATCACCGCCGTCCTACTACTCCTCTCCCTCCCCGTTCTTGCCGCCGGCATTACTATACTCTTAACTGACCGCAACCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTTGGCCACCCGGAGGTCTACATCCTAATCCTACCCGGCTTCGGAATCATCTCACATGTAGTAGCATACTACGCGGGTAAAAAAGAACCATTCGGCTACATAGGCATAGTATGAGCCATGTTATCAATCGGATTCCTAGGCTTCATCGTATGAGCCCACCACATATTTACCGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Apus apus is neither threatened nor endangered.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 6,900,000-17,000,000 breeding pairs, equating to 20,700,000-51,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 40,000,000-200,000,000 individuals, although further validation of this estimate is needed. National population sizes have been estimated at c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in China and c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Common swifts have no notable negative impacts upon humans, with the exception of the occasional nuisance of having them nest in the eaves and open spaces in the rooftops of many cities and villages across Europe.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Besides the fact that the common swift frequently nests in close association with humans, A. apus has no significant economical impact on humans. Apus apus may offer a slight benefit to humans by consuming pest insects such as mosquitos. However, it is unlikely that A. apus itself would have a significant impact on these pest populations. In some places common swifts are encouraged to nest in manmade structures so that the young can be harvested for food, however, this practice is not very common. Also the nests of some swifts are used by indigenous peoples of Asia as the key ingredient in bird’s nest soup.

Positive Impacts: food ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Swift

The Common Swift (Apus apus) is a medium-sized bird, superficially similar to the Barn Swallow or House Martin but somewhat larger. It is, however, completely unrelated to those passerine species, since swifts are in the separate order Apodiformes. The resemblances between the groups are due to convergent evolution reflecting similar life styles. Swifts' nearest relatives are thought to be the New World hummingbirds and the Southeast Asian treeswifts.

Their scientific name comes from the Ancient Greek words α "without", and πούς, "feet". ἄπους, apous, meaning "without feet". These birds have very short legs which they use only for clinging to vertical surfaces (hence the German name Mauersegler, literally meaning "wall-glider"). They never settle voluntarily on the ground, where they would be vulnerable to accidents and predation.

Taxonomy[edit]

The Common Swift was one of the many species described by Linnaeus in his Systema naturae in 1758. The predecessor of the Central European subspecies which lived during the last ice age has been described as Apus apus palapus.

Description[edit]

Common Swifts are 16–17 cm long with a wingspan of 38–40 cm[2] and entirely blackish-brown except for a small white or pale grey patch on their chins which is not visible from a distance. They have a short forked tail and very long swept-back wings that resemble a crescent or a boomerang.

Their call is a loud scream in two different tone pitches, the higher of which issues from the female. They often form 'screaming parties' during summer evenings, when 10-20 swifts will gather in flight around their nesting area, calling out and being answered by nesting swifts. Larger "screaming parties" are formed at higher altitudes, especially late in the breeding season. The purpose of these parties is uncertain, but may include ascending to sleep on the wing, while still breeding adults tend to spend the night in the nest.[citation needed]

Behavior[edit]

Young bird, not yet able to fly

Swifts may nest in former woodpecker tree burrows found in ancient forests, such as some 600 reported nesting in the Bialowieska forest of North Eastern Poland, or the small colony found in a combination of woodpecker holes and tree nestboxes on the RSPB's reserve at the Caledonian Forest in Abernethy, Scotland. While tree holes together with cliffs may have comprised their historic nesting resource, the almost complete removal of ancient forest from their nesting range has resulted in adaption to man-made sites. Swifts build their nests of air-borne material caught in flight, bonded with their saliva, in suitable buildings hollows, such as under tiles, in gaps beneath window sills, and most typically under eaves and within gables.

Swifts form pairs that may couple for years, and often return to the same nesting site and partner year after year, repairing degradation suffered in their 40 week migratory absence. Insects such as clothes moths, carpet and larder beetles may consume all but the most indigestible nest elements, typically feather shafts.

Young nesting swifts are able to survive for a few days without food by dropping their body temperature and metabolic rate, entering a torpid state.

Several flying

Except when nesting, swifts spend their lives in the air, living on the insects caught in flight; they drink, feed, and often mate and sleep on the wing.[3] No other bird spends as much of its life in flight. Feeding parties can be very large in insect-rich areas, such as wetlands. Reports of as many as 2000 swifts feeding over flooded gravel pits, lakes and marshy river deltas are not uncommon, and may represent an ingress of swifts from within as much as a 100 kilometer radius; swifts nesting in Western Scotland are thought to venture to Lough Neagh in Northern Ireland to feed on the abundant and nutritious "Lough Neagh Fly".

Migration[edit]

Common Swifts are migratory. Their summer breeding range runs from Spain and Ireland in the West across to China and Siberia in the East. They breed as far South as Northern Africa (in Morocco and Algeria), with a presence in the Middle East in Israel, Lebanon and Syria, the Near East across Turkey, and the whole of Europe as far North as Norway, Finland, and most of sub-Arctic Russia. Swifts migrate to Africa by a variety of routes, ending up in Equatorial and Sub-Equatorial Africa, excluding the Cape. Common Swifts do not breed on the Indian Subcontinent.

Subjects of a geolocator tracking study demonstrated that swifts breeding in Sweden winter in the Congo region of Africa.[4]

Parasites[edit]

Swift nests commonly support populations of the Chewing louse, Dennyus hirundinis and the Lousefly, Crataerina pallida.[5]

In heraldry[edit]

The heraldic bird known as the "martlet", which is represented without feet, may have been based on the swift, but is generally assumed to refer to the house martin; it was used for the arms of younger sons, perhaps because it symbolized their landless wandering.

Gallery[edit]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Apus apus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Common Swift - Apus Apus
  3. ^ Common Swift - Apus Apus
  4. ^ A°kesson S, Klaassen R, Holmgren J, Fox JW, Hedenstro¨m A (2012) Migration Routes and Strategies in a Highly Aerial Migrant, the Common Swift Apus apus, Revealed by Light-Level Geolocators. PLoS ONE 7(7): e41195. doi:10.1371/journal.pone.0041195
  5. ^ Tompkins D. M.; Jones T.; Clayton D. H. (1996). "Effect of vertically transmitted ectoparasites on the reproductive success of Swifts (Apus apus)". Functional ecology (Oxford: Blackwell Science, Oxford) 10 (6): 733–40. doi:10.2307/2390508. ISSN 0269-8463. JSTOR 2390508. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!