Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Andrena barbilabris in Illinois

Andrena barbilabris Kirby: Andrenidae (Andreninae), Hymenoptera
(observations are from Robertson, Mitchell, Krombein et al., and Stoutamire)

Asteraceae: Taraxacum officinale (Kr); Orchidaceae: Cypripedium candidum exp (Stm); Rosaceae: Fragaria virginiana (Rb, Mch), Malus pumila (Kr); Salicaceae: Salix amygdaloides [stam sn cp] (Rb), Salix humilis [stam] (Rb), Salix rigida [stam sn fq] (Rb)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / kleptoparasite
larva of Sphecodes pellucidus kleptoparasitises pollen store of Andrena barbilabris

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena barbilabris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTCATCTTCGCTATATGAGCAGGAATAATTGGTGCATCATTAAGATTTATTATCCGTATAGAATTAAGAAATCCCGGAACTTGAATCAATAATGATCAAATCTATAATTCAATTGTAACATCGCACGCCTTCATTATAATTTTCTTCATAGTTATGCCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTATTACCCCCATCAATTTTAATTATTCTAATAAGAATATCATTAAATTCAGGATCAGGAACAGGATGAACTGTATATCCACCCCTGTCATCCTACGCCTTTCATCCATCATCATCTGTAGATTTAACAATCTTTTCACTTCATATTGCAGGAATTTCATCAATTATAGGAGCAATTAACTTCATCGTAACAATTCTAAATATAAAAAATATCGCAATAAATTATGATCAACTACCATTATTCCCATGATCAGTATTCATTACAACAATCCTATTGTTAATCTCTCTACCAGTACTAGCTGGAGCAATCACTATACTACTATCAGATCGAAATTTAAACTCATCATTCTTTGATCCAATAGGAGGAGGAGACCCAATCCTTTATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrena barbilabris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!