Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

Probably the most distinctive feature of the burrowing owl is the fact that, unlike most owls, this species routinely nests and lives underground (2) (5). Although fully capable of excavating its own burrow, the burrowing owl most commonly occupies the abandoned burrows of mammals (2). In the northern part of its range it commonly uses the burrows of prairie dogs, while in South America, as noted by the famous naturalist Charles Darwin, it inhabits burrows made by large, rabbit-like rodents called viscachas (6). Interestingly, burrowing owls purposefully deposit piles of mammal dung around the entrance of their burrows. This unusual behaviour has been shown to be a method of baiting, as the dung attracts numerous dung beetles, which the owl then feeds upon (7). Aside from invertebrates, the burrowing owl will also take small mammals, birds and reptiles, either pursing its prey on foot or diving down upon it from the air or a perch (2). Outside the breeding season, this species rests in its burrow during the day and mainly hunts at dusk, during the night, and at dawn. During breeding, however, burrowing owls may forage at any point during the day or night (2) (4). During the spring breeding season, burrowing owls form monogamous pairs, which maintain a small territory comprising the nesting burrow and the immediate surroundings. The female lays a clutch of up to 11 eggs, which are incubated for around one month, while the male brings food. In the initial period after hatching, the female remains with the young and is supported by the male, but as the young become more developed the female leaves the burrow and assists the male in foraging for food. After around 44 days the young leave the burrow and join the parent birds on hunting flights (2). While many burrowing owl breeding pairs remain resident around a burrow throughout the year, individuals from Canada and the northern USA are migratory. At the end of the breeding season, pairs in these regions split up and fly south to overwinter, before returning in the following spring and establishing a new breeding pair with a different partner (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The burrowing owl is a small-bodied species, with a round head lacking ear tufts, striking lemon yellow eyes and unusually long legs (2). The plumage is mostly sandy brown on the upperparts with whitish spots on the body, while the face is adorned with bold whitish eyebrows and a prominent white chin stripe (2) (4). By contrast, the underparts are buffy white with brown barring. The female normally possesses darker plumage than the male (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Athene cunicularia is found in North and South America. They live in the desert regions and grasslands of western North America, and also in the drier areas of Central and South America. Burrowing Owls spend their winters in Texas where they commonly breed. During the summer the owls also can be found in northern areas of the Great Plains and northern California (Snyder 2000; Interactive Broadcasting Company 1999).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (20,000 to >2,500,000 square km (about 8000 to >1,000,000 square miles)) Breeding range extends from southern interior British Columbia (nearly extirpated), southern Alberta, southern Saskatchewan, southwestern and south-central Manitoba south through the western United States, central Mexico, central and southern Florida, and the West Indies, and breeding also occurs locally in much of South America (Haug et al. 1993, AOU 1998). During the northern winter, the species withdraws from the northernmost portions of the breeding range in North America. Wintering occurs regularly southward to El Salvador, casually or accidentally to western Panama (AOU 1998). California, New Mexico, and Arizona are important wintering areas in the United States (James and Ethier 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Athene cunicularia is distributed throughout the Americas, occurring in Canada, U.S.A., Mexico, Guatemala, El Salvador, the Bahamas, Cuba, the Dominican Republic, Haiti, the Netherlands Antilles, Venezuela, Guyana, Brazil, Colombia, Ecuador, Peru, Bolivia, Chile, Argentina, Paraguay and Uruguay. The Lesser Antillean subspecies guadeloupensis and amaura, of Guadeloupe (to France) and Antigua and Barbuda respectively, have both been extinct since the late 1800s (del Hoyo et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Burrowing owl is a pan-American species. In North America, it is
distributed from British Columbia and Manitoba south through the western
half of the United States, Louisiana, Florida, the Carribean islands,
and Mexico. Distribution continues through Central America to western
South America, from Columbia south to Tierra del Fuego in Argentina
[2,35,61].

Distribution of North American subspecies: Athene cunicularia ssp.
hypugaea is distributed from southern interior British Columbia east to
south-central Manitoba and south to west-central Mexico. Populations in
British Columbia are reintroduced; prior to the 1986 reintroduction,
burrowing owl had not been sighted in British Columbia since 1979. The
range of S. c. ssp. hypugaea once extended to Minnesota and Iowa, but
burrowing owl is probably extirpated from those states [28].

Athene cunicularia ssp. floridana occurs in Florida and the Bahama
islands. In Florida, the subspecies was formerly restricted to central
and southern portions of the state, but has expanded its range northward
nearly to Georgia [28].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AZ CA CO FL ID KS LA MT NE NV
NM ND OK OR SD TX UT WA WY


AB BC MB SK


MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The burrowing owl has a very large breeding range that extends throughout the Americas. It occurs from central and western Canada, south through central and western North America, Central America and South America as far as Tierra del Fuego, with vagrant individuals found as far afield as the Falkland Islands (1) (2). Within South America it is widespread, being absent only from parts of the Andes and the Amazon basin (4). Disjunct populations of this species also occur in Florida and on several islands in the Caribbean, including Cuba and Hispaniola, and off the west coast of Mexico (2), but it has become extinct on Antigua, Barbuda and Guadeloupe (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Athene cunicularia is one of the smallest owl species. The owl, which resides primarily on the ground, has long lanky legs, a short tail, and it does not have any ear tufts. The average adult owl is between 8.5-11 inches tall and weighs about 4-6 oz. Unlike other owl species, the female burrowing owl is smaller than the male. The burrowing owl's body is generally brown with speckles of white. The owl's breast is a lighter color brown while its face is encircled in white, with tinges of sandy brown feathers. The owl has wings about the same size as its body, featherless legs, and round yellow eyes ("Interactive" 1999; Davis 2000).

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Weight: 159 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No other small owl has such long legs or perches habitually on the ground in open situations. Much smaller than the short-eared owl (Asio flammeus), length 24 cm vs. 38 cm, which also has relatively shorter legs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Athene cunicularia lives in burrows of open, dry grasslands, and deserts. They can also be found in airports and golf courses (Davis 2000).

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat includes open grasslands, especially prairie, plains, and savanna, sometimes other open areas such as vacant lots near human habitation or airports. This owl spends much time on the ground or on low perches such as fence posts or dirt mounds.

Nests are in abandoned burrows, such as those dug by prairie dogs, ground squirrels, foxes, woodchucks, or (in Florida) gopher tortoises, and including badger excavations (see especially Green and Anthony 1989). In Colorado and Okalhoma, burrowing owls are highly associated with and most numerous in prairie dog colonies (Smith and Lomolino 2004, Tipton et al. 2009). Owls may enlarge or modify exisitng burrows. In Florida, burrowing owls may dig their own burrow. Nesting occurs in lava cavities in some areas. See Cavanagh (1990) for an account of unsuccessful above-ground nesting on a lawn at an airport in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Burrowing owls typically live in colonies, using burrows excavated by
other animal species for cover [63]. Burrows are used for breeding,
nesting, and brooding [28]. When selecting a burrow, the owls prefer
burrows with low, open cover that provide good horizontal visibility
[23]. Burrowing owls are commonly found in plant communities in early
stages of sucession because cover is low [45]. Long-abondoned burrows
are usually not used because the burrow entrance has become overgrown.
Burrows adjacent to burrows occupied by other burrowing owls are
prefered, although burrowing owl pairs have nested alone if other
burrowing owls were not in the area [28]. Burrowing owls often evict
other animal species from desirable burrows [63].

In the Plains States, burrowing owls use black-tailed prairie dog
(Cynomys ludovicianus) burrows most often [45,56,63], although burrows
of ground squirrels (Spermophilus spp.) are also frequently used [17].
Deserted black-tailed prairie dog towns become unsuitable as burrowing
owl habitat within 1 to 3 years [9,10]. White-tailed prairie dog (C.
leucurus) burrows are used infrequently because plant cover surrounding
white-tailed prairie dog burrows is usually too high for burrowing owl
requirements [48]. In California and Idaho, burrowing owls primarily use
ground squirrel burrows [23]. Florida burrowing owls occupy raccoon
(Procyon lotor), snake (Serpentes), and gopher tortoise (Gopherus
polyphemus) burrows [63]. Other burrows commonly occupied by burrowing
owl throughout North America include those of badger (Taxidea taxus),
pocket gophers (Geomyidae), fox (Vulpes and Urocyon spp.), and
rattlesnakes (Crotalus spp.) [22,26,63]. Length and depth of the
burrow depends upon the requirements of the species that dug it [28].
In friable soil, burrowing owls dig their own burrows when suitable ones
are not available [23,63]. In Forida, where burrowing rodents are
scarce, Florida burrowing owls dig their own burrows in sandy soils. The
burrows are about 6.5 to 9 feet long (2-3 m) and less than feet 3.3 feet
(1 m) deep when burrowing owls excavate them [49].

Burrowing owls use ground cavities other than burrows for cover. On the
Snake River Plain of Idaho, they sometimes use cavities in basalt
outcrops [40,53]. Burrowing owls also use human-constructed cavities
such as culverts. Pipe can be laid down for artifical nests [11]. In
California, hatching success rate of burrowing owl eggs laid in
artificial nests was 55 percent [43].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: shrub

Burrowing owls occupy grasslands, shrub steppes, and savannas. They also
occur in other open areas such as agricultural lands, old fields,
extensive forest clearings, airports, golf courses, and spacious
residential zones [1,3,23,50,63,76].

Home range: In central Saskatchewan, home range size for six
radio-tagged males varied from 0.06 to 1.92 square miles (0.14-4.81 sq
km), with an average of 0.96 square mile (2.41 sq km). Diurnal
activities were restricted to within 825 feet (250 m) of the burrow
[30].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

Burrowing owl occurs in grasslands, shrub-grasslands, and savannas [63].

REFERENCES :
NO-ENTRY

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: shrub, vine

101 Bluebunch wheatgrass
102 Idaho fescue
103 Green fescue
104 Antelope bitterbrush-bluebunch wheatgrass
105 Antelope bitterbrush-Idaho fescue
106 Bluegrass scabland
107 Western juniper/big sagebrush/bluebunch wheatgrass
201 Blue oak woodland
202 Coast live oak woodland
204 North coastal shrub
205 Coastal sage shrub
212 Blackbush
214 Coastal prairie
215 Valley grassland
216 Montane meadows
217 Wetlands
301 Bluebunch wheatgrass-blue grama
302 Bluebunch wheatgrass-Sandberg bluegrass
303 Bluebunch wheatgrass-western wheatgrass
304 Idaho fescue-bluebunch wheatgrass
305 Idaho fescue-Richardson needlegrass
306 Idaho fescue-slender wheatgrass
307 Idaho fescue-threadleaf sedge
308 Idaho fescue-tufted hairgrass
309 Idaho fescue-western wheatgrass
310 Needle-and-thread-blue grama
311 Rough fescue-bluebunch wheatgrass
312 Rough fescue-Idaho fescue
313 Tufted hairgrass-sedge
314 Big sagebrush-bluebunch wheatgrass
315 Big sagebrush-Idaho fescue
316 Big sagebrush-rough fescue
317 Bitterbrush-bluebunch wheatgrass
318 Bitterbrush-Idaho fescue
319 Bitterbrush-rough fescue
320 Black sagebrush-bluebunch wheatgrass
321 Black sagebrush-Idaho fescue
322 Curlleaf mountain-mahogany-bluebunch wheatgrass
323 Shrubby cinquefoil-rough fescue
324 Threetip sagebrush-Idaho fescue
401 Basin big sagebrush
402 Mountain big sagebrush
403 Wyoming big sagebrush
502 Grama-galleta
505 Grama-tobosa shrub
506 Creosotebush-bursage
507 Palo verde-cactus
508 Creosotebush-tarbush
601 Bluestem prairie
602 Bluestem-prairie sandreed
603 Prairie sandreed-needlegrass
604 Bluestem-grama prairie
605 Sandsage prairie
606 Wheatgrass-bluestem-needlegrass
607 Wheatgrass-needlegrass
608 Wheatgrass-grama-needlegrass
609 Wheatgrass-grama
610 Wheatgrass
611 Blue grama-buffalograss
612 Sagebrush-grass
613 Fescue grassland
614 Crested wheatgrass
615 Wheatgrass-saltgrass-grama
701 Alkali sacaton-tobosagrass
702 Black grama-alkali sacaton
703 Black grama-sideoats grama
704 Blue grama-western wheatgrass
705 Blue grama-galleta
706 Blue grama-sideoats grama
707 Blue grama-sideoats grama-black grama
708 Bluestem-dropseed
709 Bluestem-grama
710 Bluestem prairie
711 Bluestem-sacahuista prairie
712 Galleta-alkali sacaton
713 Grama-muhly-threeawn
714 Grama-bluestem
715 Grama-buffalograss
716 Grama-feathergrass
717 Little bluestem-Indiangrass-Texas wintergrass
718 Mesquite-grama
719 Mesquite-liveoak-seacoast bluestem
720 Sand bluestem-little bluestem (dunes)
721 Sand bluestem-little bluestem (plains)
722 Sand sagebrush-mixed prairie
723 Sea oats
724 Sideoats grama-New Mexico feathergrass-winterfat
725 Vine mesquite-alkali sacaton
726 Cordgrass
727 Mesquite-buffalograss

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K024 Juniper steppe woodland
K027 Mesquite bosque
K030 California oakwoods
K035 Coastal sagebrush
K039 Blackbrush
K041 Creosotebush
K042 Creosotebush-bursage
K043 Paloverde-cactus shrub
K044 Creosotebush-tarbush
K047 Fescue-oatgrass
K048 California steppe
K049 Tule marshes
K050 Fescue-wheatgrass
K051 Wheatgrass-bluegrass
K053 Grama-galleta steppe
K054 Grama-tobosa prairie
K055 Sagebrush steppe
K056 Wheatgrass-needlegrass shrubsteppe
K057 Galleta-three-awn shrubsteppe
K058 Grama-tobosa shrubsteppe
K063 Foothills prairie
K064 Grama-needlegrass-wheatgrass
K065 Grama-buffalograss
K066 Wheatgrass-needlegrass
K067 Wheatgrass-bluestem-needlegrass
K068 Wheatgrass-grama-buffalograss
K069 Bluestem-grama prairie
K070 Sandsage-bluestem prairie
K074 Bluestem prairie
K075 Nebraska Sandhills prairie
K076 Blackland prairie
K077 Bluestem-sacahuista prairie
K079 Palmetto prairie
K085 Mesquite-buffalograss
K088 Fayette prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES40 Desert grasslands
FRES41 Wet grasslands
FRES42 Annual grasslands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

68 Mesquite
242 Mesquite
250 Blue oak-foothills pine
255 California coast live oak

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The burrowing owl occupies a range of open habitats, including grasslands, treeless plains, savanna and desert, usually in regions supporting a significant population of burrowing mammals (1) (2). Populations may also be found in settled areas, around golf courses, cemeteries, airports, vacant lots in residential areas, university campuses, and fairgrounds (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Burrowing owls are migratory in the northern portion of the range (though some birds may overwinter in north). Some U.S./Canadian breeders winter in Mexico and possibly in Central America (James and Ethier 1989). Canadian breeders are believed to winter south of the U.S.-Mexico border. Migrants arrive in the northern breeding range in April-May. The Florida population apparently is sedentary, as is the breeding population in southern California.

Home range in Saskatchewan: 0.14-4.81 sq km; 95% of all movements within 600 m of nest burrow (Haug and Oliphant 1990). Significantly smaller home ranges were reported in Saskatchewan (0.08-0.49, average 0.35 square kilometers) during period of small mammal superabundance (Sissons et al. 1998, Wellicome 1998). Dispersing young use satellite burrows in the vicinity of their natal burrows for about two months after hatching before departing the natal area (King and Belthoff 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of the burrowing owl consists of insects, small frogs, lizards, and rodents. The owl will eat beetles, crickets, moths, kangaroo rats, and snails. It eats different prey depending on availability in the habitat and the time of year. The owl is a keen hunter always on the look out for prey, during the day or night, and always keeping a supply of food in its burrow (Snyder 2000; "Interactive" 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet includes primarily large insects (especially in warmer months) and rodents, sometimes birds and amphibians. In the Dominican Republic, prey composition by number of items was 53.3% invertebrates, 28.3% birds, 14.9% reptiles, 2.5% amphibians, and 1.0% mammals (Wiley 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Burrowing owls hunt in both day and night. They hunt on the wing, from
prairie dog mounds or other high spots on the ground, and from
fenceposts or other elevated perches. Prey is either run down on foot
or caught by hovering and swooping [63]. Arthropods, mainly insects,
form the majority of the burrowing owl diet. An overall assessment of
the burrowing diet in western North America, calculated from 3,564 prey
items, included 90.0 percent invertebrates (mostly insects), 6.9 percent
mammals (mostly rodents), 2.0 percent herptiles, and 0.3 percent birds
[59]. Young prairie dogs (Cynomys spp.), ground squirrels, pocket
gophers, voles (Microtus spp.), mice (Heteromyidae, Muridae, and
Zapodidiae), young cottontails (Sylvilagus spp.), and young jackrabbits
(Lepus spp.) are common mammalian prey. Grasshoppers (Acrididae),
Jerusalem crickets (Gryllacrididae), and beetles (Coleoptera) are the
most common arthropod prey, although other arthropod taxa are taken as
available [22,24,45,63]. Herptiles are a large component of the Florida
burrowing owl's diet [28].

Seasonal variation: In Oklahoma, vertebrates comprised 85 percent of
the burrowing owl winter diet, while arthropods comprised almost 100
percent of the summer diet [9]. A study of the spring and summer diets
of burrowing owl on the shortgrass prairie of Colorado showed that most
rodents were taken in April. Most Jerusalem crickets were taken June,
most grasshoppers in July, and most dung beetles (Scarabaeinae) in
August. Ground beetles (Carabidae) were taken in quantity throughout
spring and summer [47].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Rattlesnakes and prairie dogs raid burrows for burrowing owl eggs and
nestlings [4,63]. Hawks (Accipiter and Buteo spp.), falcons (Falco
spp.), great horned owl (Bubo virginianus), coyote (Canis latrans),
domestic dog (C. domesticus), badger, skunks (Spilogale, Mephitis, and
Conepatus spp.), weasels (Mustela spp.), and bobcat (Lynx rufus) prey on
both adult and nestling burrowing owls [28].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Athene cunicularia preys on:
Coleoptera
Orthoptera
Gryllidae
Sylvilagus
Microtus ochrogaster
Mus musculus
Chaetodipus hispidus
Aves
Peromyscus maniculatus
Arthropoda
Serpentes
Athene cunicularia
Spermophilus washingtoni

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Athene cunicularia is prey of:
Athene cunicularia
Buteo swainsoni

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: The number of distinct breeding occurrences (subpopulations) has not been determined using standardized criteria, but this owl nests in a large number of locations across a wide range..

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Rich et al. (2004) estimated the global population at 2,000,000, with 31 percent of those in the United States and Canada (fewer than 2,000 pairs in Canada).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Reported densities: 8 pairs/sq km (California), 3.5-6 ha per pair in North Dakota, 13-16 ha/pair in Saskatchewan.

Territory defense mainly limited to immediate vicinity of nest burrow; individuals may share a common foraging area.

Badgers play an important role in burrowing owl nesting ecology in northern Oregon; they provide nest burrows and are a major predator (Green and Anthony 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, density, natural, prescribed fire, wildfire

Fire affects burrowing owl in two ways: by altering vegetation and by
altering their prey base [3].

Fire effects on vegetation: Wright and Bailey [66] indentified three
major fire-dependent plant associations (grassland, semidesert
grass-shrub, and sagebrush-grass) in which burrowing owl occur.
Frequent fire can maintain or improve burrowing owl habitats by reducing
plant height and cover around burrows and by controlling woody plant
invasion. For example, 3 months following a May prescribed fire on the
Nebraska sandhills prairie, where burrowing owl occur, vegetative cover
on burned sites averaged 16 percent less than on adjacent unburned sites
[7]. One year after a May 1965 wildfire on Nebraska sandhills prairie,
vegetative growth was 53 to 91 percent greater on unburned than on
burned sites [65].

Fire in grasslands has been shown to reduce encroachment of woody shrubs
and trees [66]. Mixed-grass prairie of South Dakota, for example, has
become invaded by ponderosa pine (Pinus ponderosa) in the absence of
fire; it is estimated that in the Black Hills, 50 percent of
presettlement prairie has converted to ponderosa pine woodland [20].

Fire effects on prey: Periodic fire in grasslands probably increases
prey diversity for raptors including burrowing owl, and may increase
overall prey density [3]. Rodent populations in grasslands usually show
an initial drop after fire; loss of cover makes rodents more vulnerable
to predators such as burrowing owl [12]. After a 1- to 3-year reduction
in prey, rodent numers usually match or exceed prefire levels [66].
Deer mouse (Peromyscus maniculatus) numbers have returned to prefire
levels in the first postfire growing season [12]. Ground squirrels, an
important burrowing owl prey, also increase in number after fire [5,21].

Since arthropods form the majority of the burrowing owl's diet, fire
effects on burrowing owl's arthropod prey are an important management
consideration. Because beetles, grasshoppers, and crickets form the
majority of the burrowing owl's arthropod diet, they are discussed here.

Beetles are a diverse order, and the effects of fire on beetles are
variable. Generally, however, beetle populations in grassland habitats
recover quickly from fire. After a March wildfire on an Illinois
prairie, beetle numbers initially dropped 15 percent, but nearly
equalled beetle numbers on an adjacent unburned prairie within a month.
Rove beetle (Aleocharinae) numbers on burned sites, however, stayed
below those on adjacent unburned prairie throughout the month of the
study [52]. On Minnesota tallgrass prairie, Tester and Marshall [60]
recorded an increase in beetles following fire. On the Konza Prairie
Research Natural Area of Kansas, scarab beetle (Scarabaeideae) grub
numbers were significantly (p less than 0.05) greater on annually burned prairie
than on unburned prairie [55]. (Data for other beetle families were not
collected.)

Most grasshopper species increase after spring fire due to increased
nutritional quality of new grasses [39,52,60]. On native tallgrass
prairie in Kansas, grasshopper numbers were highest after early spring
prescribed burning, followed by mid-spring burning; numbers were lowest
on late-spring burned sites [39]. In a review of fire effects on
insects, Warren and others [64] reported that grasshoppers and crickets
(Orthoptera) generally increase after fire in any season; however, "hot"
grass fires that occur before Orthoptera have developed wings may reduce
their numbers. Jerusalem crickets are a key element in the diet of
burrowing owl in many areas. Unlike most Orthoptera, they are wingless
even as adults. They habitually burrow or hide under rocks, where they
are probably protected from fire. After rangeland fire in northern
Utah, Jersalem crickets occurred exclusively on burned areas [25].

Florida burrowing owl: Periodic fire is important in keeping the sandy
soils open for burrowing. It also maintains the early successional
stages that burrowing owl and most of their herptile and mammal prey
require [42].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

Life history: Burrowing owls begin nesting in spring in burrows that
they line with cow, horse, or bison (Bison bison) dung [63]. In eastern
Colorado, burrowing owls lay eggs in May [16]. The female does all
incubation and brooding [28]. Clutch size is large, from 6 to 11 eggs
[31], with an average of 6.5 eggs [51]. Eggs are laid at intervals of
24 to 72 hours. Incubation period is 27 to 30 days and begins when the
first egg is laid, resulting in a multi-aged brood [16]. Owlets are
born partially covered with down and with eyes closed. Eyes open at 5
days of age [28]. Owlets move among nest burrows when 10 days old [31].
They fly well by 6 weeks of age, and fledge when about 44 days old [43].

At Davis, California, a DNA fingerprinting study of burrowing owl showed
that 37 percent of adult owls were raising owlets other than their
biological offspring. Owlet movement and polygamy accounted for some of
the discrepancy; intraspecific brood parasitism may also be a factor
[38].

Migration: Burrowing owls are migratory, but little is known of their
migration routes and wintering areas. The majority of burrowing owls
that breed in Canada and the northern United States are thought to
migrate south during September and October and north during March and
April. Burrowing owls migrating to Saskatchewan arrive in early May
[28]. Banding studies suggest that Canadian burrowing owls migrate
further south than burrowing owls in the United States [33]. Christmas
birds counts show California as the most important American state for
wintering burrowing owls, followed by New Mexico, Florida, Arizona, and
Texas, respectively [36]. Florida, the Southwest, and southern
California have year-round burrowing owl residents as well as winter
migrants [28].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Activity is primarily nocturnal in winter in the north, diurnal and crepuscular in summer; burrowing owls usually can be observed in daytime in Florida and in the southern part of the winter range (Evans 1982). In Saskatchewan, peak foraging activity occurred between 2030 and 0630 h (Haug and Oliphant 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Range lifespan

Status: wild:
11 (high) years.

Average lifespan

Status: wild:
108 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Burrowing owls will nest underground, either by digging its own burrow or more frequently by taking over a burrow dug by other mammals such as prairie dogs and pocket gophers. The owl lines its den with grass and roots and in April the female owl will lay about 7-9 round white eggs. After about four weeks of incubation, the eggs will hatch and the mother and father will share the responsibility of caring for the young. The young owlets will remain in their nest for about 40 days before leaving and venturing out on their own. While owlets are still in their nest, they have the capability of mimicking a rattlesnake to scare away predators (Davis 2000).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average time to hatching: 28 days.

Average eggs per season: 6.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size averages 6-7. Incubation, by female, lasts 27-30 days. Male provides food during incubation and early nestling stages. Young run and forage at 4 weeks, and attain sustained flight at 6 weeks. Nesting efforts average 3-5 fledglings per brood. Individuals first breed at 1 year (some may not) and generally produce 1 brood/year (double brooding documented in Florida).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Athene cunicularia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACCTTATCTTCGGCGCATGAGCTGGCATAGTTGGAACAGCCCTAAGCCTCTTAATCCGAGCCGAGCTGGGACAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATGGTTATACCCATTATAATCGGCGGCTTCGGAAACTGACTAGTCCCACTAATAATCGGAGCCCCGGACATAGCCTTCCCCCGCATAAACAACATGAGCTTCTGATTATTGCCCCCATCGCTCATGCTCCTCCTGGCCTCCTCCACAGTAGAGGCCGGGGCCGGCACAGGTTGAACAGTCTATCCCCCTCTGGCTGGGAACCTCGCCCATGCCGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTCCATCTAGCCGGAATCTCCTCCATCCTGGGAGCAATCAACTTCATCACAACTGCCATCAACATAAAACCCCCATCCCTATCACAATACCAAACCCCCCTGTTCGTATGGTCCGTACTAATCACCGCCATCCTCCTACTACTATCTCTCCCCGTCCTAGCAGCAGGAATCACTATACTACTCACAGATCGCAACCTAAACACCACCTTCTTCGACCCGGCCGGAGGGGGAGACCCAATTCTGTACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTCATCCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Athene cunicularia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5