Overview

Brief Summary

Caprimulgus vociferus

Named for its onomatopoeic nighttime song, the Eastern Whip-poor-will is far more likely to be heard than seen. This nightjar is mottled brown overall with a white throat and large eyes. If seen, the Eastern Whip-poor-will may be separated from other nightjars by its size (9 ½ inches) and striking white tail patches. Males and females are similar to one another in all seasons. The Eastern Whip-poor-will breeds in the northeastern United States and southern Canada, from Nova Scotia south to Georgia and from the Mid-Atlantic west to central Nebraska and Saskatchewan. In winter, this species may be found along the coast from South Carolina to Texas, as well as in Mexico, Central America, and the West Indies. A group of Whip-poor-wills breeding in Arizona and New Mexico and wintering in central Mexico was recently discovered to be a separate species, the Western Whip-poor-will (Caprimulgus arizonae). In summer, the Eastern Whip-poor-will breeds in deciduous or mixed deciduous and evergreen woodland, where they nest on the ground and roost pressed close to low branches. In winter, this species may be in similar habitats as in summer as well as in tropical forests and scrub habitats. The Eastern Whip-poor-will mainly eats flying insects. Due to its coloration and densely vegetated habitat, the Eastern Whip-poor-will is difficult to see during the day. Often, birdwatchers discover Eastern Whip-poor-wills on their nests by almost tripping over them while walking through the woods. Eastern Whip-poor-wills are more easily observed feeding at dusk, when they may be seen flying after insects and scooping them up with their beaks. This species is primarily active at dusk or dawn, but may also forage in the afternoon or late at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Caprimulgus vociferus is primarily found in North America, reaching from central and southeast Canada to parts of southern Mexico. Caprimulgus vociferus is not found in the western United States except for small, disjunct populations found in Arizona, Texas, and New Mexico. Whip-poor-wills are also found in Mexico and Central America during migration and winter.

Biogeographic Regions: nearctic (Native )

  • Cink, C. 2002. Whip-poor-will (Caprimulgus vociferus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 16 No. 620. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Whip-poor-wills are found in North America during the warm months of the year, reaching from central and southeast Canada to parts of southern Mexico. They are not found in the western United States except for small populations in Arizona, Texas, and New Mexico. Whip-poor-wills are also found in Mexico and Central America during migration and winter.

Biogeographic Regions: nearctic (Native )

  • Cink, C. 2002. Whip-poor-will (Caprimulgus vociferus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 16 No. 620. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Canada and e US; winters to Cuba and w Panama.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: BREEDING: south-central Saskatchewan east across southern Canada to Nova Scotia, south (east of Great Plains) to extreme northeastern Texas, Arkansas, northern Mississippi, north-central Alabama, South Carolina, east-central North Carolina, and Virginia (AOU 1998). NON-BREEDING: from northeastern Mexico, southern Texas, Gulf Coast, and east-central South Carolina south to Costa Rica, casually to southern California, western Panama, and Cuba (AOU 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Morphology

Whip-poor-wills are medium-sized nightjars. They range from 22 to 26 cm in length and from 43.0 to 63.7 g in mass. They have a large, flattened head, large eyes, small bill with enormous gape, and rounded tail and wings. The bill and iris are dark brown while the legs and feet are also brownish. Plumage is grayish brown with darker streaks and broad black stripes on the crown. There is a white stripe across the lower throat. The wings are covered in grayish brown feathers with tawny and buff colored spots and speckles. There is no seasonal plumage change. Females are almost identical to males with the exception of a thinner stripe on their throat and a more pale, clay color with brown for the outermost tail feathers, instead of white. Females are also slightly browner in general color. There is no known information on basal metabolic rates of whip-poor-wills.

Whip-poor-will hatchlings are completely downy with yellowish brown color. Juvenile males are similar in appearance to adult males, except the crown has black spotting instead of streaking. Outer primaries and outer tail feathers are also narrower and more tapered compared to adults. Juvenile females are similar to juvenile males except their outer tail feathers don't contain white.

In general, C. vociferus can be distinguished from other members of the Caprimulgidae family by the white band on its throat, its relatively small size, and its brownish color. Whip-poor-wills can be distinguished from Chuck-will's-widows by their smaller size, less reddish color, and smaller white markings on the tails of males. They are distinguished from common pauraques and common poorwills, which are larger, have longer tails, and have a broad white band across the primaries. Whip-poor-wills are separated from other nightjars by their paler, less reddish color. They are distinguished from other nighthawks by the lack of a white wing-stripe and smaller wings with white or buff tips on outer tail feathers.

Subspecies such as C. v. arizonae are larger, have longer tail feathers with more white on males, and darker tail tips on females. Caprimulgus vociferus oaxacae individuals are darker than the arizonae group with black spots on their crown and spotted breast. Caprimulgus vociferus chiapensis individuals are much darker and redder on top and bottom. Caprimulgus vociferus vermincularis individuals are paler, more reddish, smaller, and have fewer black spots on the scapulars.

Range mass: 43 to 63.7 g.

Range length: 22 to 26 cm.

Average length: 25 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Whip-poor-wills are medium-sized Caprimulgidae. They range from 22 to 26 cm in length and from 43.0 to 63.7 g in mass. They have a large, flattened head, large eyes, small bill with enormous gape, and rounded tail and wings. The bill and iris are dark brown while the legs and feet are also brownish. The feathers are grayish brown with darker streaks and broad black stripes on the crown. There is a white stripe across the lower throat. The wings are covered in grayish brown feathers with tawny and buff colored spots and speckles. Females are almost identical to males except that they have a thinner stripe on their throat and a more pale color with brown for the outermost tail feathers instead of white. Females are also slightly browner in general color.

Whip-poor-will hatchlings are completely downy with a yellowish brown color. Young males are similar to adult males, except the crown has black spotting instead of streaking. Young females are similar to young males, except their outer tail feathers don't contain white.

Whip-poor-wills can be distinguished from other members of the Caprimulgidae family by their white throat band, relatively small size, and brownish color. Whip-poor-wills can be distinguished from Caprimulgus carolinensis by their smaller size, less reddish color, and smaller white markings on the tails of males.

Range mass: 43 to 63.7 g.

Range length: 22 to 26 cm.

Average length: 25 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 25 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Whip-poor-wills are usually found in dry deciduous or mixed woodlands and some pine-oak woodlands. They prefer to live in young second growth forests, especially dry woods near fields and other open areas. The degree of openness in the forest seems to be more important than the type of trees that make up the inhabited forest. Shade and sparse ground cover are also key elements of whip-poor-will habitat. During migration, they can be found in low canopy levels of their migratory forest. They have a tendency to inhabit lowlands but can be found at elevations ranging from sea level to 3,600 meters.

Whip-poor-wills are usually found in dry deciduous or mixed woodlands and some pine-oak woodlands. They prefer to live in young second growth forests, especially dry woods near fields and other open areas. The amount of openness in the forest seems to be more important than the type of trees that make up the forest. Shade and small amounts of ground cover are also important in whip-poor-will habitat. During migration they are also found in forested habitats. They are usually found in lowlands but can be found from sea level to 3,600 meters elevation.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster Inc.
  • 2001. Nighthawks and Nightjars. Pp. 348-351 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Forest and open woodland, from lowland moist and deciduous forest to montane forest and pine-oak association (AOU 1983). In open woodlands with well spaced trees and a low canopy. Uncommon in mature forest; prefers even-aged successional habitats from regeneration to pole-stage stands (Bushman and Therres 1988). Rests on ground or on branch, in thicket at forest edge, in hedgerow or gallery forest (Stiles and Skutch 1989). Lays eggs on ground in open site under trees or under bush, usually on a bed of dead leaves (Harrison 1978) at woods edge or in open woodland. Breeds primarily in montane habitats in tropics (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whip-poor-wills are usually found in dry deciduous or mixed woodlands and some pine-oak woodlands. They prefer to live in young second growth forests, especially dry woods near fields and other open areas. The amount of openness in the forest seems to be more important than the type of trees that make up the forest. Shade and small amounts of ground cover are also important in whip-poor-will habitat. During migration they are also found in forested habitats. They are usually found in lowlands but can be found from sea level to 3,600 meters elevation.

Range elevation: 0 to 3600 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: agricultural

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster Inc.
  • 2001. Nighthawks and Nightjars. Pp. 348-351 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in U.S. move south for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Whip-poor-wills use aerial foraging techniques to catch their prey and primarily feed on night flying insects. They also feed on some non-flying insects. Known diets consist of moths, mosquitoes, flying beetles, ants, grasshoppers, and crickets. They especially prey on moths.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats moths and other insects caught in flight usually near ground (Terres 1980). Makes short flights from perch or ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Whip-poor-wills fly at night to catch their prey, they mostly eat night flying insects, but also eat insects that don't fly. They are known to eat Lepidoptera, Culicidae, flying Coleoptera, Formicidae, Orthoptera, and Gryllidae, but Lepidoptera make up most of their diet.

Animal Foods: insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Whip-poor-wills help to control populations of insects that they prey on. They also compete with other nightjars and nighthawks for habitat and food resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most losses through predation are of eggs and young birds because ground nests are extremely vulnerable. Predators such as skunks, raccoons, coyotes, red foxes and snakes prey on the eggs and young. To protect their young, adult whip-poor-wills fake an injury by flopping on the ground several meters away from the nest in full view of the predator, called the "Broken Wing" display. This is performed until the predator is not in view of the eggs or young and the adult then displays on a perch above the ground. Whip-poor-wills are cryptically colored and nocturnal, protecting them from some predation.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Whip-poor-wills help to control populations of insects that they prey on. They also compete with other Caprimulgidae for habitat and food resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Losses from predation are mostly of eggs and young birds because ground nests are extremely vulnerable. Predators such as Mephitis mephitis, Procyon lotor, Canis latrans, Vulpes vulpes and Serpentes prey on the eggs and young. To protect their young, adult whip-poor-wills fake an injury by flopping on the ground near the nest and in full view of the predator, called the "Broken Wing" display. This is performed until the predator is not in view of the eggs or young and the adult then displays on a perch above the ground. Whip-poor-wills are patterned in brown, helping them to blend in with their forest floor surroundings. They are also nocturnal, both of these help to protect them from predation.

Known Predators:

  • skunks (Mephitis_mephitis)
  • raccoons (Procyon_lotor)
  • red foxes (Vulpes_vulpes)
  • coyotes (Canis_latrans)
  • snakes (Serpentes)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Little information on home range or territory size. Density of breeding pairs per 40 ha: 5.8 in a pitch pine-oak forest in New Jersey (Slack and Root 1980); 2.6 on a pine plantation in Indiana (Webster 1980); and 2 in a strip mine and deciduous woodlot in Tennessee (Nicholson 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Caprimulgus vociferus is known for its three tone call, sounding like "whip-poor-will", for which it is named. The primary whip-poor-will call is usually given by males to establish territories. The "quirt" is a soft call that increases as the individual becomes more and more excited. It is usually used by wintering, territorial birds. A "growl" is a fluttering sound used when two territorial individuals aggressively meet. The "hiss" is a repeated loud call given in response to predators. The "cur" is a guttural chuckle, often given during courtship, or for nest exchanges and when moving to new sites.

Communication Channels: visual ; acoustic

Perception Channels: visual ; ultraviolet; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Whip-poor-wills are known for their three tone calls, sounding like "whip-poor-will", for which they are named. This call is usually given by males to establish territories. The "quirt" is a soft call that communicates excitement or stress, it is usually used by wintering, territorial birds. A "growl" is a fluttering sound used when two territorial individuals meet. The "hiss" is a repeated loud call used when predators are near. The "cur" is a guttural chuckle, often given during courtship or at other times by nesting birds.

Communication Channels: visual ; acoustic

Perception Channels: ultraviolet; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most active during twilight and bright moonlight (Mills 1986). Strictly nocturnal (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little information is known about the lifespan of whip-poor-wills. Tagged wild whip-poor-wills have been known to live up to 15 years. Most causes of mortality occur when birds are very young or as eggs. There is some competition with related species, such as Chuck-will's-widows for territorial space and for food that might impact their longevity.

Range lifespan

Status: wild:
15 (high) years.

Average lifespan

Status: wild:
48 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Little information is known about the lifespan of whip-poor-wills. Tagged wild whip-poor-wills have been known to live up to 15 years. Most causes of mortality occur when birds are very young or as eggs. There is some competition with related species, such as Caprimulgus carolinensis that might reduce their lifespan.

Range lifespan

Status: wild:
15 (high) years.

Average lifespan

Status: wild:
48 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15 years (wild) Observations: One banded male was recaptured 15 years later (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Caprimulgus vociferus is thought to be monogamous. There is little known about whip-poor-will courtship displays. Females may try to solicit the attention of males by strutting on the ground with a lowered head and outspread wings and tail. Females circle in different directions while producing a guttural chuckle. The male will respond by approaching the female and undulating his body up and down. The male may circle the female and she then undulates her body up and down and quivers her wings. If the female flies away, the male may not follow. The male may also try to approach the female by using a tail-flashing display.

Mating System: monogamous

Whip-poor-wills breed twice per year, from May through June, usually laying 2 eggs per clutch. They lay eggs on the ground usually beneath trees, bushes, or fallen trees branches near open areas. Most nests are depressions in leaves, pine needles, or bare ground. Eggs hatch after about 19 days. Time to fledging is about 17 days. Little is known about the age of reproductive maturity for whip-poor-wills but it is assumed that it one year of age, which is the average for the nighthawk and nightjar family. Whip-poor-will reproductive cycles are synchronized with lunar cycles to result in better moonlit nights when foraging to feed their young.

Breeding interval: Whip-poor-wills breed twice per year.

Breeding season: Whip-poor-wills breed from May through June.

Average eggs per season: 4.

Range time to hatching: 17 to 20 days.

Average time to hatching: 19 days.

Range fledging age: 14 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 2.

Both male and female whip-poor-will adults incubate the eggs, starting with the laying of the first egg. Both sexes trade incubation duties from dusk until dawn. Both parents feed their young, beginning right after hatching. While one parent is finding food, the other is protecting the nest. Whenever the returning adult comes back to the nest, it regurgitates insects to both young. Young whip-poor-wills have been known to accept food from parents at 30 days of age. Whip-poor-wills are semi-precocial birds and have the ability to avoid predators without parental care.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster Inc.
  • 2001. Nighthawks and Nightjars. Pp. 348-351 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc.
  • Cink, C. 2002. Whip-poor-will (Caprimulgus vociferus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 16 No. 620. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs laid mostly May-June in north. Clutch size two. Incubation 17-20 days, by female (male possibly helps). Hatching often occurs during early stages of a waxing moon. Young tended mainly by female, male brings food. Young first fly at about 20 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whip-poor-wills are thought to be monogamous. There is little known about whip-poor-will courtship displays. Females may try to get the attention of males by strutting on the ground with a lowered head, outspread wings and tail, and while making a guttural chuckle. Males respond by approaching the female, circling her, and moving their bodies up and down. If the female flies away, the male may not follow. The male may also try to approach the female by using a tail-flashing display.

Mating System: monogamous

Whip-poor-wills breed twice per year, from May through June, usually laying 2 eggs per clutch. They lay eggs on the ground usually beneath trees, bushes, or fallen trees branches near open areas. Most nests are depressions in leaves, pine needles, or bare ground. Eggs hatch after about 19 days. Time to fledging is about 17 days. Little is known about when whip-poor-wills have reproduce, but it is thought to be 1 year of age, the average for the Caprimulgidae family. Whip-poor-will reproductive cycles are synchronized with moon cycles, resulting in better moonlit nights when foraging to feed their young.

Breeding interval: Whip-poor-wills breed twice per year.

Breeding season: Whip-poor-wills breed from May through June.

Average eggs per season: 4.

Range time to hatching: 17 to 20 days.

Average time to hatching: 19 days.

Range fledging age: 14 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

Both male and female whip-poor-will adults incubate the eggs, starting with the laying of the first egg. Both parents feed their young, beginning right after hatching. While one parent is finding food, the other is protecting the nest. Whenever the returning adult comes back to the nest, it regurgitates insects to both young. Young whip-poor-wills have been known to accept food from parents at 30 days of age. Whip-poor-will hatchlings are able to avoid predators without parental care from a fairly early age.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster Inc.
  • 2001. Nighthawks and Nightjars. Pp. 348-351 in C Elphick, J Dunning, D Sibley, eds. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc.
  • Cink, C. 2002. Whip-poor-will (Caprimulgus vociferus). Pp. 1-20 in A Poole, F Gill, eds. The Birds of North America, Vol. 16 No. 620. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caprimulgus vociferus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTGTATCTAATCTTTGGCGCATGAGCTGGCATAGTAGGAACCGCCCTAAGCTTACTTATCCGCGCAGAACTAGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTACAACGGAATCGTTACAGCCCATGCTTTCGTAATAATCTTTTTCATAGTTATACCAATTATAATCGGAGGATTTGGTAACTGACTAGTACCATTAATAATTGGAGCCCCAGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTCCTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCTGGCACAGGATGAACTGTGTATCCACCGCTTGCCGGAAACTTGGCCCACGCCGGAGCCTCAGTGGACCTAGCTATCTTCTCCCTACACCTAGNAGGAGTATCATCCATCCTAGGTGCAATCAACTTTATCACCACCGCCATCAACATAAAACCACCCGCCCTTTCACAATACCAAACCCCACTATTCGTATGATCAGTTTTAATTACTGCCGTACTACTACTCTTATCCCTCCCAGTCCTAGCAGCAGGGATTACTATACTACTGACAGACCGCAACTTGAACACTACATTCTTTGATCCAGCTGGAGGAGGAGACCCAGTATTATACCAACACCTNTTCTGATTTTTCGGACATCCAGAAGTATACATCCTCATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caprimulgus vociferus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Whip-poor-wills have a large global population, estimated at 2,100,000 individuals. Although the population seems to be declining, it is not expected to reach the threshold for population decline that would put it on the IUCN Red List of Threatened Species. This species has an IUCN Red List status of least concern.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B,NNRN : N5B: Secure - Breeding, NNRN: Unranked - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Whip-poor-wills have a large global population, estimated at 2,100,000 individuals. Although the population seems to be declining, it is not expected to reach the threshold for population decline that would put it on the IUCN Red List of Threatened Species. This species has an IUCN Red List status of least concern.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Declines have been reported from several areas; may be related to habitat fragmentation and loss and perhaps to increased nest predation (Ehrlich et al. 1992). PESTICIDES: Gypsy Moth infestations in many parts of the northeastern U.S. have prompted the use of pesticides (Bt and Dimilin) on large portions of oak forest. Bt has been reported to be toxic to more than 40 species of lepidopterans, resulting in possible restricted foraging opportunities for nightjars, especially as the gypsy moth advances into the southeastern U.S. DEVELOPMENT: Typically fly low to the ground and forage in and along roads. Paving rural roads increases driving speeds and thereby increases the potential for auto strikes (T. O'Connell, pers. comm.). Development (especially "summer homes") along steep-sided mountain slopes will likely have a detrimental effect through loss of habitat. Restoration of healthy mountain riparian areas where steep sides occur certainly cannot hurt this species (C. Rustay, pers. comm.). GRAZING: Grazing could have a detrimental effect on this and other ground nesting species, as trampling and possible reduction of insect prey densities could occur, but no data is currently available to document this.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Breeding habitat should include medium growth woodlands of many types, usually in uplands and not far from open country, primarily deciduous and mixed forest. (Hamel 1992). May need a relatively dense oak understory for nesting perhaps intermixed with more open habitat for foraging (C. Rustay, pers. comm.). More research is needed before an accurate preserve design can be established

Management Requirements: In the west, allowing fires to burn in the lower mixed conifer zone and in Ponderosa Pine (PINUS PONDEROSA) habitat should be beneficial by opening up the understory and promoting oak growth. Burns should be undertaken in non-breeding season. Fuels should not build up to the point of allowing a catastrophic fire. It has been estimated that fire normally burned every 7-10 years on average in ponderosa pine forest. Burning every 12-15 years might be slightly more beneficial to this species (C. Rustay, pers. comm.). More research is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of whip-poor-wills on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caprimulgus vociferus is an insect eater, usually living near open, agricultural areas. It is likely that they help control insect populations that affect humans. Because whip-poor-wills are cryptic, nocturnal creatures they have no other known interactions with humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of whip-poor-wills on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Whip-poor-wills are insect eaters, usually living near open, agricultural areas. It is likely that they help control insect populations that affect humans. Because whip-poor-wills nocturnal and difficult to observe, they have no other known interactions with humans.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Breeds in open coniferous and mixed woodlands in much of the eastern U.S. and montane woodlands in the southwest. Western population believed by some to be separate species but no studies currently available. In New Mexico, closely associated with hillsides in mid-elevation forests from 1828-2438 meters which roughly corresponds to the range of Ponderosa Pine (Chihuahua Pine in the very southwestern portion of the state). Possibly expanding it's range. Often found in riparian uplands, but this may not be a requirement for nesting habitat. BBS shows declines in Illinois and southern New England. Threats include breeding and winter habitat loss, possible pesticide exposure, but no data is available to verify this. Need more research on habitat use and requirements, status, and nesting success.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eastern whip-poor-will

"Whippoorwill" redirects here. For other uses, see Whippoorwill (disambiguation).

The eastern whip-poor-will (Antrostomus vociferus), is a medium-sized (22–27 cm) nightjar bird from North and Central America. The whip-poor-will is commonly heard within its range, but less often seen because of its superior camouflage. It is named onomatopoeically after its song.[1]

Description[edit]

These medium-sized nightjars measure 22–27 cm (8.7–10.6 in) in length, span 45–50 cm (18–20 in) across the wings and weigh 42–69 g (1.5–2.4 oz).[2] Among standard measurements, the wing chord is 14.7 to 16.9 cm (5.8 to 6.7 in), the tail is 10.5 to 12.8 cm (4.1 to 5.0 in), the bill is 1 to 1.4 cm (0.39 to 0.55 in) and the tarsus is 1.5 to 1.8 cm (0.59 to 0.71 in).[3] Adults have mottled plumage: the upperparts are grey, black and brown; the lower parts are grey and black. They have a very short bill and a black throat. Males have a white patch below the throat and white tips on the outer tail feathers; in the female, these parts are light brown.

This bird is sometimes confused[4] with the related chuck-will's-widow (Antrostomus carolinensis) which has a similar but lower-pitched and slower call.

Ecology[edit]

Their habitat is deciduous or mixed woods across western, central and southeastern Canada, eastern United States, and Central America. Northern birds migrate to the southeastern United States and south to Central America. Central American races are largely resident. These birds forage at night, catching insects in flight, and normally sleep during the day. Whip-poor-wills nest on the ground, in shaded locations among dead leaves, and usually lay two eggs at a time. The bird will commonly remain on the nest unless almost stepped upon.

The eastern whip-poor-will is becoming locally rare. Several reasons for the decline are proposed, such as habitat destruction, predation by feral cats and dogs, and poisoning by insecticides, but the actual causes remain elusive.[5] Even with local populations endangered, the species as a whole is not considered globally threatened due to its large range.[6] In the northern lower Michigan (USA) Huron National Forest, the common knowledge of area sportsmen and conservation entities is the population of the eastern whip-poor-will, and most other small ground birds and animals, fluctuates in response to the population of coyotes. The populations average an approximately three year cycle, with the bird populations being higher in years of lower coyote populations and as the coyote population climbs, the bird population drops to the point the coyotes run low on viable food sources. At that point the coyote population collapses and the bird and other small ground animal populations re-surge, only to repeat the process again. 2013 has seen a great increase in whip-poor-wills, woodcock and partridge in this area of Michigan, with a noted reduction in coyote activity.

The whip-poor-will has been split into two species. Eastern populations are now referred to as the eastern whip-poor-will. The disjunct population in southwestern United States and Mexico is now referred to as the Mexican whip-poor-will, Antrostomus arizonae. The two species having different ranges and vocalizations, the eggs having different coloration, and DNA sequencing showing enough differentiation, it was determined enough evidence was available to separate the two types into different species.[7]

Cultural references[edit]

Due to its haunting, ethereal song, the eastern whip-poor-will is the topic of numerous legends. One New England legend says the whip-poor-will can sense a soul departing, and can capture it as it flees. This is used as a plot device in H. P. Lovecraft's story The Dunwich Horror. Lovecraft based this idea on information of local legends given to him by Edith Miniter of North Wilbraham, Massachusetts when he visited her in 1928. This is likely related to an earlier Native American and general American folk belief that the singing of the birds is a death omen.[8] This is also referred by Whip-poor-will, a short story by James Thurber, in which the constant nighttime singing of a whip-poor-will results in maddening insomnia of the protagonist Mr Kinstrey who eventually loses his mind and kills everyone in his house, including himself. The bird also features, however, in The Runaway Slave at Pilgrim's Point, a poem by the English poet Elizabeth Barrett Browning, in which the outcast speaker asks: "Could the whip-poor-will or the cat of the glen/Look into my eyes and be bold?" [9]

It is also frequently used as an auditory symbol of rural America, as in Washington Irving's story The Legend of Sleepy Hollow, or as a plot device. For example, William Faulkner's short story, "Barn Burning", makes several mentions of whip-poor-wills, e.g.: "and then he found that he had been asleep because he knew it was almost dawn, the night almost over. He could tell that from the whip-poor-wills. They were everywhere now among the dark trees below him, constant and inflectioned and ceaseless, so that, as the instant for giving over to the day birds drew nearer and nearer, there was no interval at all between them." [10]

"The Mountain Whippoorwill" is a poem written by Stephen Vincent Benet about a fiddling contest, won by Hillbilly Jim, who refers to his fiddle as a whip-poor-will and identifies the bird with the lonely and poor but vibrant life of the mountain people. American poet Robert Frost described the sound of a whip-poor-will in the fourth stanza of his 1915 poem "Ghost House". This is notable in Frost's use of assonance, in "The whippoorwill is coming to shout / And hush and cluck and flutter about."[11]

In the 1934 Frank Capra film It Happened One Night, before Clark Gable's character Peter Warne reveals his name to Ellie Andrews (Claudette Colbert), he famously says to her: "I am the whip-poor-will that cries in the night".[12]

Hank Williams's 1949 song "I'm So Lonesome I Could Cry" opens with the lyric, "Hear that lonesome whip-poor-will/He sounds too blue too fly." The swing classic "The Birth of the Blues" contains the line "From a whippoorwill high on a hill they took a new note / pushed it through a horn 'til it was worn into a blue note". The whippoorwill is also referenced in Hank Williams Jr's song "I'm Gonna Get Drunk and Play Hank Williams All Night Long" with the lyrics "Cause the wedding bells will never ring for me/And that whippoorwill ain't got no sympathy". Jim Croce too makes a reference to this bird in his song "I got a name": "Like the whip-poor-will and the baby's cry, I've got a song, I've got a song".

Elton John and Bernie Taupin hit gold with their 1975 hit "Philadelphia Freedom" which featured a flute mimicking the call of the whippoorwill, and included the lyrics "I like living easy without family ties, till the whippoorwill of freedom zapped me right between the eyes..."[13]

"Whippoorwill" is a song from Annuals 2013 album "Time Stamp". It makes a mention of the bird with the lines "A cold dead night, after a windswept day the fire burns high. But I’m just listening to the whippoorwills cry. Oh how it carries so fine. I’ll bet it floats miles straight through your window."

Footnotes[edit]

  1. ^ [1]
  2. ^ [2]
  3. ^ Holyoak, D.T. (2001): Nightjars and their Allies: the Caprimulgiformes. Oxford University Press, Oxford, New York. ISBN 0-19-854987-3.
  4. ^ For example, Henninger (1906) combines the old scientific name of C. carolinensis with the common name "whip-poor-will". As C. carolinensis does not occur in the area discussed, he obviously refers to C. vociferus. In other cases, the specific identity of birds may not be determinable.
  5. ^ MWP (2008)
  6. ^ BLI (2004)
  7. ^ Chesser, R. T., R. C. Banks, F. K. Barker, C. Cicero, J. L. Dunn, A. W. Kratter, I. J. Lovette, P. C. Rasmussen, J. V. Remsen, Jr, J. D. Rising , D. F. Stotz, and K. Winker. 2010. Fifty-first supplement to the American Ornithologists’ Union Check-list of North American Birds. Auk 127(3):726-744.
  8. ^ Encyclopedia of Superstitions, p. 716.
  9. ^ http://classiclit.about.com/library/bl-etexts/ebbrowning/bl-ebbrown-runaway-1.htm. Lines 55-56.
  10. ^ Faulkner, William. "Barn Burning". www.rajuabju.com. Retrieved 1 May 2011. 
  11. ^ http://www.bartleby.com/117/2.html
  12. ^ IMDb Quotes: It Happened One Night.
  13. ^ "American Certifications - Philadelphia Freedom" Recording Industry of America
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly merged with Caprimulgus, but now treated as a separate genus on the basis of genetic data (Han et al. 2010) (AOU 2012).

Caprimulgus vociferus formerly included C. arizonae, but is now separated on the basis of differences in vocalizations (Hardy et al. 1988, Cink 2002) and mitochondrial and nuclear DNA (Han et al. 2010); the two species also differ in morphology (Phillips et al. 1964, Cink 2002) and egg pigmentation (Phillips et al. 1964) (AOU 2010).

Considered conspecific with C. noctitherus of Puerto Rico by some authors (AOU 1983) and constitutes a superspecies with it (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!