You are viewing this Species as classified by:

Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The European honey bee, also known as the common or western honey bee (Apis mellifera) is so named because it produces large amounts of honey. It is believed that the honey bee originated in Africa and spread to northern Europe, India, and China. The honey bee is not native to North America, but was brought here with the first colonists. The honey bee is now distributed world wide.

European honey bees are variable in color, but are some shade of black or brown intermixed with yellow. The bee ranges from 3/8 to 3/4 of an inch long, with workers being the smallest and the queen being the largest. A queen bee is elongate and has a straight stinger with no barbs. A worker bee has hind legs specialized for collecting pollen - each leg is flattened and covered with long fringed hairs that form a pollen basket. A worker bee's stinger has barbs. A drone bee is stout-bodied and has large eyes.

Wild European honey bee nests are found in hollow trees or man-made structures. Managed colonies are often kept in wooden hives. Flowers in meadows, open woods, agricultural areas, and yards and gardens are visited by worker bees.

  • Honey Bee (AgriLIFE Extension, Texas A & M System)
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees (R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service)
  • Honeybee Biology (Ross E. Koning, Plant Physiology Website, 1994)
  • Pollination and Honey Bees (R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005)
  • Stinging Insects: Honey Bees (K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program)
  • University of Georgia Honey Bee Program (University of Georgia)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 2 people

Average rating: 4.5 of 5

Description

The honey bee is probably one of the best-known of all insects in the world (3); it performs a vital role in the pollination of flowering plants, including our crop species (4) . There are three 'castes' within a bee hive, a 'queen' (the reproductive female), the 'drones' (reproductive males) and 'workers' (non-reproductive females) (3). All three castes are broadly similar in appearance; the body is covered in short hairs, and is divided into a head, a thorax and an abdomen, the head features two large eyes and a pair of antennae. The thorax bears two pairs of wings above, and three pairs of legs below and there is a slender 'waist' between the thorax and abdomen (5). The queen has a much longer and slender abdomen than the workers, and the drones can be identified by their broader abdomens and much larger eyes (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 3.25 of 5

Honey bees are insects which make honey and wax. They are held by beekeepers in hives or chests. A colony can consist of 50,000 animals: most of them are workers, a few hundred are drones (males) and one is the queen. Dunes and salt marshes are suitable food areas for honey bees.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Apis mellifera is native to Europe, western Asia, and Africa. Human introduction of Apis mellifera to other continents started in the 17th century, and now they are found all around the world, including east Asia, Australia and North and South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Winston, M., J. Dropkin, O. Taylor. 1981. Demography and life history characteristics of two honey bee races (Apis mellifera). Oecologia, 48: 407-413.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Apis_mellifera is native to Europe, western Asia, and Africa. Human introduction of Apis_mellifera to other continents started in the 17th century, and now they are found all around the world, including east Asia, Australia and North and South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Winston, M., J. Dropkin, O. Taylor. 1981. Demography and life history characteristics of two honey bee races (Apis mellifera). Oecologia, 48: 407-413.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The honey bee is widespread in Britain, and is often a domesticated species. This bee is native to Africa, Europe and the Middle East, and has been introduced to most parts of the world including America, Australia, and Asia. Despite its wide range, however, it is in urgent need of conservation (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Generally, Apis mellifera are red/brown with black bands and orange yellow rings on abdomen. They have hair on thorax and less hair on abdomen. They also have a pollen basket on their hind legs. Honeybee legs are mostly dark brown/black.

There are two castes of females, sterile workers are smaller (adults 10-15 mm long), fertile queens are larger (18-20 mm). Males, called drones, are 15-17 mm long at maturity. Though smaller, workers have longer wings than drones. Both castes of females have a stinger that is formed from modified ovipositor structures. In workers, the sting is barbed, and tears away from the body when used. In both castes, the stinger is supplied with venom from glands in the abdomen. Males have much larger eyes than females, probably to help locate flying queens during mating flights.

There are currently 26 recognized subspecies of Apis mellifera, with differences based on differences in morphology and molecular characteristics. The differences among the subspecies is usually discussed in terms of their agricultural output in particular environmental conditions. Some subspecies have the ability to tolerate warmer or colder climates. Subspecies may also vary in their defensive behavior, tongue length, wingspan, and coloration. Abdominal banding patterns also differ - some darker and some with more of a mix between darker and lighter banding patterns.

Honeybees are partially endothermic -- they can warm their bodies and the temperature in their hive by working their flight muscles.

Range length: 10 to 20 mm.

Other Physical Features: endothermic ; ectothermic ; heterothermic ; bilateral symmetry ; venomous

Sexual Dimorphism: female larger; sexes shaped differently

  • Clarke, K., T. Rinderer, P. Franck, Q. Javier, B. Oldroyd. 2002. The africanization of honeybees (Apis mellifera L.) of the Yucatan: a study of a massive hybridization event across time. Evolution, 56/7: 1462-1474.
  • Pinto, A., W. Rubink, R. Coulson, J. Patton, S. Johnston. 2004. Temporal pattern of africanization in a feral honeybee population from texas inferred from mitochondrial DNA. Evolution, 58/5: 1047-1055.
  • Seeley, T., R. Seeley, P. Akratanakul. 1982. Colony defense strategies of the honeybees in Thailand. Ecological Monographs, 52/1: 43-63.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Generally, Apis_mellifera are red/brown with black bands and orange yellow rings on abdomen. They have hair on thorax and less hair on abdomen. They also have a pollen basket on their hind legs. Honeybee legs are mostly dark brown/black.

There are two castes of females, sterile workers are smaller (adults 10-15 mm long), fertile queens are larger (18-20 mm). Males, called drones, are 15-17 mm long at maturity. Though smaller, workers have longer wings than drones. Both castes of females have a stinger that is formed from modified ovipositor structures. In workers, the sting is barbed, and tears away from the body when used. In both castes, the stinger is supplied with venom from glands in the abdomen. Males have much larger eyes than females, probably to help locate flying queens during mating flights.

There are currently 26 recognized subspecies of Apis_mellifera, with differences based on differences in morphology and molecular characteristics. The differences among the subspecies is usually discussed in terms of their agricultural output in particular environmental conditions. Some subspecies have the ability to tolerate warmer or colder climates. Subspecies may also vary in their defensive behavior, tongue length, wingspan, and coloration. Abdominal banding patterns also differ - some darker and some with more of a mix between darker and lighter banding patterns.

Honeybees are partially endothermic -- they can warm their bodies and the temperature in their hive by working their flight muscles.

Range length: 10 to 20 mm.

Other Physical Features: endothermic ; ectothermic ; heterothermic ; bilateral symmetry ; venomous

Sexual Dimorphism: female larger; sexes shaped differently

  • Clarke, K., T. Rinderer, P. Franck, Q. Javier, B. Oldroyd. 2002. The africanization of honeybees (Apis mellifera L.) of the Yucatan: a study of a massive hybridization event across time. Evolution, 56/7: 1462-1474.
  • Pinto, A., W. Rubink, R. Coulson, J. Patton, S. Johnston. 2004. Temporal pattern of africanization in a feral honeybee population from texas inferred from mitochondrial DNA. Evolution, 58/5: 1047-1055.
  • Seeley, T., R. Seeley, P. Akratanakul. 1982. Colony defense strategies of the honeybees in Thailand. Ecological Monographs, 52/1: 43-63.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

1-2 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

European honeybees prefer habitats that have an abundant supply of suitable flowering plants, such as meadows, open wooded areas, and gardens. They can survive in grasslands, deserts, and wetlands if there is sufficient water, food, and shelter. They need cavities (e.g. in hollow trees) to nest in.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European honeybees prefer habitats that have an abundant supply of suitable flowering plants, such as meadows, open wooded areas, and gardens. They can survive in grasslands, deserts, and wetlands if there is sufficient water, food, and shelter. They need cavities (e.g. in hollow trees) to nest in.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Honey bees live in hives, which need to be close to good sources of pollen and nectar (4). Evidence of beekeeping using artificial hives can be traced to 5000 years ago in Egypt; however, natural hives do occasionally occur. Before they were domesticated, honey bees made their nests in hollow trees in woodlands. Occasionally, colonies may still become established in dead trees when they escape from a domesticated hive. The internal structure of the hive is built by the bees with wax (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Apis mellifera feed on pollen and nectar collected from blooming flowers. They also eat honey (stored, concentrated nectar) and secretions produced by other members of their colony.

Workers forage for food (nectar and pollen) for the entire colony. They use their tongues to suck up nectar, and store it in the anterior section of the digestive tract, called the crop. They collect pollen by grooming it off the bodies and onto special structures on their hind legs called pollen baskets.

Returning foragers transfer the nectar they have collected to younger worker bees that in turn feed other members of the hive, or process it into honey for long-term storage. They add enzymes to the honey, and store it in open cells where the water can evaporate, concentrating the sugars.

Young workers eat pollen and nectar, and secrete food materials, called “royal jelly” and “worker jelly”, from glands in their heads. This material is fed to young larvae, and the amount and type they get determines if they will be queens or workers.

Honeybees forage during daylight hours, but are equally active on cloudy or sunny days. They will not fly in heavy rain or high winds, or if the temperature is too extreme (workers can't fly when they get below 10°C). During the warm, calm weather the honeybees collect the most pollen even if it is cloudy. If the light intensity changes rapidly, they immediately stop working and return to the hive. If it lightly rains, pollen collection stops, because moisture inhibits the bee’s ability to collect it. However, nectar collection is not inhibited by light rain. Wind also affects the rate of pollen collection.

Honeybee workers are opportunistic. They will steal from other hives if they can. Hive-robbing can be dangerous, but a weakened or damaged hive may be raided by workers from other hives, especially when nectar flows in flowers are not abundant. Honeybees will also collect “honeydew,” the sweet fluid excreted by sap-feeding insects like aphids.

Plant Foods: nectar; pollen; sap or other plant fluids

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Nectarivore )

  • Gonzalez, A., C. Rowe, P. Weeks, D. Whittle, F. Gilbert, C. Barnard. 1995. Flower choice by honey bees (Apis mellifera L.): sex-phase of flowers and preferences among nectar and pollen foragers. Oecologia, 101/2: 258-264.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Apis_mellifera feed on pollen and nectar collected from blooming flowers. They also eat honey (stored, concentrated nectar) and secretions produced by other members of their colony.

Workers forage for food (nectar and pollen) for the entire colony. They use their tongues to suck up nectar, and store it in the anterior section of the digestive tract, called the crop. They collect pollen by grooming it off the bodies and onto special structures on their hind legs called pollen baskets.

Returning foragers transfer the nectar they have collected to younger worker bees that in turn feed other members of the hive, or process it into honey for long-term storage. They add enzymes to the honey, and store it in open cells where the water can evaporate, concentrating the sugars.

Young workers eat pollen and nectar, and secrete food materials, called “royal jelly” and “worker jelly”, from glands in their heads. This material is fed to young larvae, and the amount and type they get determines if they will be queens or workers.

Honeybees forage during daylight hours, but are equally active on cloudy or sunny days. They will not fly in heavy rain or high winds, or if the temperature is too extreme (workers can't fly when they get below 10°C). During the warm, calm weather the honeybees collect the most pollen even if it is cloudy. If the light intensity changes rapidly, they immediately stop working and return to the hive. If it lightly rains, pollen collection stops, because moisture inhibits the bee’s ability to collect it. However, nectar collection is not inhibited by light rain. Wind also affects the rate of pollen collection.

Honeybee workers are opportunistic. They will steal from other hives if they can. Hive-robbing can be dangerous, but a weakened or damaged hive may be raided by workers from other hives, especially when nectar flows in flowers are not abundant. Honeybees will also collect “honeydew,” the sweet fluid excreted by sap-feeding insects like Aphididae.

Plant Foods: nectar; pollen; sap or other plant fluids

Foraging Behavior: stores or caches food

  • Gonzalez, A., C. Rowe, P. Weeks, D. Whittle, F. Gilbert, C. Barnard. 1995. Flower choice by honey bees (Apis mellifera L.): sex-phase of flowers and preferences among nectar and pollen foragers. Oecologia, 101/2: 258-264.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Honeybees are very important pollinators, and are the primary pollinator for many plants. Without honeybees, these plants have greatly reduced fertility. In North America and Australia, where there are no native bee species with large colonies, honeybees can have especially strong effects on native flowers, and on other pollinators such as solitary bee species. Honeybees ability to recruit fellow workers by “dancing” allows them to be more efficient than other pollinators at exploiting patches of flowers. This can create strong impacts on their competitors, especially solitary bees.

Like all social insects, honeybees are hosts to a variety of parasites, commensal organisms, and pathogenic microbes. Some of these can be serious problems for apiculture, and have been studied intensively. At least 18 types of viruses have been found to cause disease in bees, including Sacbrood disease. Several of them (but not sacbrood virus) are associated with parasitic mites. Bacteria infect bees, notably Bacillus larvae, agent of American Foulbrood disease, and Melissococcus pluton, agent of European Foulbrood. Fungi grow in bee hives, and Ascosphaera apis can cause Chalkbrood disease. One of the most common diseases in domesticated hives is Nosema disease, caused by a protozoan, Nosema apis. An amoeba, Malphigamoeba mellificae, also causes disease in honeybees.

In recent decades, two mite species have spread through domesticated and feral honeybee populations around the world. Acarapis woodi is a small mite species that lives in the tracheae of adult bees and feeds on bee hemolymph. It was first discovered in Europe, but its origin is unknown. Infestations of these mites weaken bees, and in cold climates, whole colonies may fail when the bees are confined in the hive during the winter. A much worse threat is Varroa destructor. This might evolved on an Asian honeybee, Apis cerana, but switched on to Apis mellifera colonies that were set up in east Asia. It has since spread all around the world, except Australia. Juvenile mites feed on bee larvae and pupae, and adult female mites feed and disperse on adult workers. This mite is known to spread several viruses as well. Infestations of V. destructor often wipe out colonies. Nearly all the feral, untended honeybee colonies in North American are believed to have been wiped out by mite infestations, along with a large proportion of domesticated colonies. Other mite species are known from honeybee colonies, but they are not considered harmful.

Another commensal or parasitic species is Braula coeca, the bee louse. Despite the common name, this is actually a wingless fly, that apparently feeds by intercepting food being transferred from one bee to another.

Beetles in the genera Hylostoma and Aethina are found in African honeybee nests, where they seem to do little harm. However, the "small hive beetle", Aethina tumida, has become a significant problem in European and North American hives. The larvae eat all the contents of comb: honey, pollen, and bee eggs and larvae.

Ecosystem Impact: pollinates; keystone species

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Honeybees have many adaptations for defense: Adults have orange and black striping that acts as warning coloration. Predators can learn to associate that pattern with a painful sting, and avoid them. Honeybees prefer to build their hives in protected cavities (small caves or tree hollows). They seal small openings with a mix of wax and resins called propolis, leaving only one small opening. Worker bees guard the entrance of the hive. They are able to recognize members of their colony by scent, and will attack any non-members that try to enter the hive.  Workers and queens have a venomous sting at the end of the abdomen. Unlike queens, and unusual among stinging insects, the stings of Apis workers are heavily barbed and the sting and venom glands tear out of the abdomen, remaining embedded in the target. This causes the death of the worker, but may also cause a more painful sting, and discourage the predator from attacking other bees or the hive. A stinging worker releases an alarm pheromone which causes other workers to become agitated and more likely to sting, and signals the location of the first sting.

Honeybees are subject to many types of predators, some attacking the bees themselves, others consuming the wax and stored food in the hive. Some predators are specialists on bees, including honeybees.

Important invertebrate enemies of adult bees include crab spiders and orb-weaver spiders, wasps in the genus Philanthus (called “beewolves”), and many species of social wasps in the family Vespidae. Vespid wasp colonies are known to attack honeybee colonies en masse, and can wipe out a hive in one attack. Many vertebrate insectivores also eat adult honeybees. Toads (Bufo) that can reach the entrance of hive will sit and eat many workers, as will opossums (Didelphis). Birds are an important threat – the Meropidae (bee-eaters) in particular in Africa and southern Europe, but also flycatchers around the world (Tyrranidae and Muscicapidae). Apis mellifera in Africa are also subject to attack by honeyguides. These birds eat hive comb, consuming bees, wax, and stored honey. At least one species, the greater honeyguide (Indicator indicator) will guide mammal hive predators to hives, and then feed on the hive after the mammal has opened it up.

The main vertebrate predators of hives are mammals. Bears frequently attack the nests of social bees and wasps, as do many mustelids such as the tayra in the Neotropics and especially the honey badger of Africa and southern and western Asia. In the Western Hemisphere skunks, armadillos and anteaters also raid hives, as do pangolins (Manis) in Africa. Large primates, including baboons, chimpanzees (<>) and gorillas are reported to attack hives too. Smaller mammals such as mice (Mus) and rats (Rattus) will burrow into hives as well.

Some insects are predators in hives as well, including wax moth larvae (Galleria mellonella, Achroia grisella), and hive beetles (Hylostoma, Aethina), and some species of ants. In their native regions these tend not to be important enemies, but where honeybees have not co-evolved with these insects and have no defense, they can do great harm to hives.

See Ecosystem Roles section for information on honeybee parasites and pathogens.

Known Predators:

Anti-predator Adaptations: aposematic

  • Roubik, D. 1989. Ecology and natural history of tropical bees. New York City, New York, USA: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Honeybees are very important pollinators, and are the primary pollinator for many plants. Without honeybees, these plants have greatly reduced fertility. In North America and Australia, where there are no native bee species with large colonies, honeybees can have especially strong effects on native flowers, and on other pollinators such as solitary bee species. Honeybees ability to recruit fellow workers by “dancing” allows them to be more efficient than other pollinators at exploiting patches of flowers. This can create strong impacts on their competitors, especially solitary bees.

Like all social insects, honeybees are hosts to a variety of parasites, commensal organisms, and pathogenic microbes. Some of these can be serious problems for apiculture, and have been studied intensively. At least 18 types of viruses have been found to cause disease in bees, including Sacbrood disease. Several of them (but not sacbrood virus) are associated with parasitic mites. Bacteria infect bees, notably Bacillus_larvae, agent of American Foulbrood disease, and Melissococcus_pluton, agent of European Foulbrood. Fungi grow in bee hives, and Ascosphaera_apis can cause Chalkbrood disease. One of the most common diseases in domesticated hives is Nosema disease, caused by a protozoan, Nosema_apis. An amoeba, Malphigamoeba_mellificae, also causes disease in honeybees.

In recent decades, two mite species have spread through domesticated and feral honeybee populations around the world. Acarapis_woodi is a small mite species that lives in the tracheae of adult bees and feeds on bee hemolymph. It was first discovered in Europe, but its origin is unknown. Infestations of these mites weaken bees, and in cold climates, whole colonies may fail when the bees are confined in the hive during the winter. A much worse threat is Varroa_destructor. This might evolved on an Asian honeybee, Apis_cerana, but switched on to Apis_mellifera colonies that were set up in east Asia. It has since spread all around the world, except Australia. Juvenile mites feed on bee larvae and pupae, and adult female mites feed and disperse on adult workers. This mite is known to spread several viruses as well. Infestations of V. destructor often wipe out colonies. Nearly all the feral, untended honeybee colonies in North American are believed to have been wiped out by mite infestations, along with a large proportion of domesticated colonies. Other mite species are known from honeybee colonies, but they are not considered harmful.

Another commensal or parasitic species is Braula_coeca, the bee louse. Despite the common name, this is actually a wingless fly, that apparently feeds by intercepting food being transferred from one bee to another.

Beetles in the genera Hylostoma and Aethina are found in African honeybee nests, where they seem to do little harm. However, the "small hive beetle", Aethina_tumida, has become a significant problem in European and North American hives. The larvae eat all the contents of comb: honey, pollen, and bee eggs and larvae.

Ecosystem Impact: pollinates; keystone species

Commensal/Parasitic Species:

  • Melissococcus_pluton (agent of European Foulbrood)
  • Ascophaera_apis (agent of Chalkbrood)
  • honey bee tracheal mite Acarapis_woodi 
  • a wax moth Galleria_mellonella 
  • a wax moth Achroia_grisella 
  • the small hive beetle Aethina_tumida 
  • Varroa_destructor
  • bee louse Braula_coeca 
  • large hive beetles Hylostoma 
  • small hive beetles Aethina 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Honeybees have many adaptations for defense: Adults have orange and black striping that acts as warning coloration. Predators can learn to associate that pattern with a painful sting, and avoid them. Honeybees prefer to build their hives in protected cavities (small caves or tree hollows). They seal small openings with a mix of wax and resins called propolis, leaving only one small opening. Worker bees guard the entrance of the hive. They are able to recognize members of their colony by scent, and will attack any non-members that try to enter the hive.  Workers and queens have a venomous sting at the end of the abdomen. Unlike queens, and unusual among stinging insects, the stings of Apis workers are heavily barbed and the sting and venom glands tear out of the abdomen, remaining embedded in the target. This causes the death of the worker, but may also cause a more painful sting, and discourage the predator from attacking other bees or the hive. A stinging worker releases an alarm pheromone which causes other workers to become agitated and more likely to sting, and signals the location of the first sting.

Honeybees are subject to many types of predators, some attacking the bees themselves, others consuming the wax and stored food in the hive. Some predators are specialists on bees, including honeybees.

Important invertebrate enemies of adult bees include Thomisidae and Araneidae, wasps in the genus Philanthus (called “beewolves”), and many species of social wasps in the family Vespidae. Vespid wasp colonies are known to attack honeybee colonies en masse, and can wipe out a hive in one attack. Many vertebrate insectivores also eat adult honeybees. Toads (Bufo) that can reach the entrance of hive will sit and eat many workers, as will opossums (Didelphis). Birds are an important threat – the Meropidae (bee-eaters) in particular in Africa and southern Europe, but also flycatchers around the world (Tyrranidae and Muscicapidae). Apis_mellifera in Africa are also subject to attack by Indicatoridae. These birds eat hive comb, consuming bees, wax, and stored honey. At least one species, the greater honeyguide (Indicator_indicator) will guide mammal hive predators to hives, and then feed on the hive after the mammal has opened it up.

The main vertebrate predators of hives are mammals. Ursidae frequently attack the nests of social bees and wasps, as do many Mustelidae such as the Eira barbara in the Neotropics and especially the Mellivora capensis of Africa and southern and western Asia. In the Western Hemisphere Mephitidae, Cingulata and Vermilingua also raid hives, as do pangolins (Manis) in Africa. Large primates, including Papio, chimpanzees (<>) and Gorilla are reported to attack hives too. Smaller mammals such as mice (Mus) and rats (Rattus) will burrow into hives as well.

Some insects are predators in hives as well, including wax moth larvae (Galleria_mellonella, Achroia_grisella), and hive beetles (Hylostoma, Aethina), and some species of Formicidae. In their native regions these tend not to be important enemies, but where honeybees have not co-evolved with these insects and have no defense, they can do great harm to hives.

See Ecosystem Roles section for information on honeybee parasites and pathogens.

Known Predators:

  • Beewolves (Philanthus)
  • Crab spiders (Thomisidae)
  • vespid wasps (Vespidae)
  • bee-eaters (Meropidae)
  • honeyguides (Indicatoridae)
  • bears (Ursidae)
  • honey badgers (Mellivora_capensis)
  • skunks (Mephitidae)
  • toads (Bufo)

Anti-predator Adaptations: aposematic

  • Roubik, D. 1989. Ecology and natural history of tropical bees. New York City, New York, USA: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acarapis woodi endoparasitises trachaea of adult of Apis mellifera

Animal / kleptoparasite
larva of Achroia grisella kleptoparasitises wax of Apis mellifera

Animal / pathogen
Acute Bee Paralysis virus (ABPV or APV) infects Apis mellifera

Plant / pollenated
worker of Apis mellifera pollenates or fertilises flower of Epipactis palustris

Animal / pathogen
Ascosphaera apis infects dead, white, 'chalky' larva of Apis mellifera

Animal / pathogen
Aspergillus flavus infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Aspergillus dematiaceous anamorph of Aspergillus fumigatus infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Aspergillus niger infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Black Queen Cell virus (BQCV) infects dead, black larva (queen) of Apis mellifera

Animal / guest
Braula coeca is a guest in nest of Apis mellifera

Animal / pathogen
Chronic Paralysis virus infects Apis mellifera

Animal / pathogen
Cloudy Wing virus infects Apis mellifera

Animal / pathogen
Deformed Wing virus infects deformed abdomen of adult of Apis mellifera

Animal / guest
Dufouriellus ater is a guest in nest of Apis mellifera

Animal / kleptoparasite
larva of Galleria mellonella kleptoparasitises wax of Apis mellifera

Animal / pathogen
Israel Acute Paralysis virus (IAPV) infects Apis mellifera

Animal / pathogen
Kakugo virus infects mushroom body of adult (gaurd bee) of Apis mellifera

Animal / pathogen
Kashmir Bee virus (KBV) infects Apis mellifera

Animal / pathogen
Malpighamoeba mellificae infects gut of adult of Apis mellifera

Animal / parasite / endoparasite
Melissococcus plutonius endoparasitises mid-gut of larva of Apis mellifera

Animal / pathogen
Morator aetatulas infects dead, black, upright larva (capped) of Apis mellifera

Animal / pathogen
Nosema apis infects gut of adult of Apis mellifera

Animal / pathogen
Paenibacillus larvae ssp. larvae infects gut of larva of Apis mellifera

Animal / predator / stocks nest with
female of Philanthus triangulum stocks nest with Apis mellifera
Other: sole host/prey

Animal / parasite / ectoparasite / blood sucker
Varroa destructor sucks the blood of pupa of Apis mellifera

Animal / parasite / ectoparasite / blood sucker
Varroa jacobsoni sucks the blood of pupa of Apis mellifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Apis mellifera communication is based on chemical signals, and most of their communication and perception behaviors are centered around scent and taste. The members of the hive colony are bound chemically to each other. Each hive has a unique chemical signature that hivemates use to recognize each other and detect bees from other colonies.

Within the hive, bees are in constant chemical communication with each other. Workers feed and groom each other, as well as larvae, drones, and the queen. In the process they pass on pheromones, chemical signals that indicate information about the health of the queen and the state of the colony.

Chemicals not only help with detecting the right signature of hives but also with foraging. Honeybees use scent to locate flowers from a distance. When a successful forager returns to the hive, it passes the scent of the flowers to its nest mates, to help them find the same patch of flowers.

Bees also use chemicals to signal outside the hive. When a worker stings something, her stinger releases an alarm pheromone that causes other bees to become agitated, and helps them locate the enemy.

Thought it's always dark in the hive, vision is important to honeybees outside. They can see other animals, and recognize flowers. The eyes of Apis species can detect ultraviolet light wavelengths that are beyond the visible spectrum. This allows them to locate the sun on cloudy days, and see markings on flowers that are only visible in ultraviolet light. One portion of honeybee's eyes is sensitive to polarized light, and they use this to navigate.

Workers and queens can hear vibrations. New queens call to each other and workers when they first emerge. Workers hear the vibrations of the waggle dances made by returning foragers.

Apis species have a particularly notable form of communication called "dancing." Foragers that have located an abundant supply of food do a dance to communicate the location of the patch to other foragers. A "round dance" indicates food within about 300 meters of the hive, and only communicates the presence of the flowers, not the direction, though workers will also get the scent from the food the forager has brought back. The more complicated "waggle dance" indicates the direction and distance of food further away, using the location of the sun and the bee's memory of the distance it flew to return to the hive. Symbolic communication is quite unusual among invertebrates, and these honeybee "dances" have been intensively studied.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: visual ; ultraviolet; polarized light ; tactile ; acoustic ; chemical

  • Breed, M., L. Butler, T. Stiller. 1985. Kin discrimination by worker honey bees in genetically mixed groups. Proceedings of the National Academy of Sciences of the United States of America, 82/9: 3058-3061.
  • Reinhard, J., M. Srinivasan, S. Zhang. 2004. Scent-triggered navigation in honeybees. Nature, 427: 411.
  • Roat, T., C. Landim. 2008. Temporal and morphological differences in post-embryonic differentiation of the mushroom bodies in the brain of workers, queens and drones of Apis mellifera (Hymenoptera: Apidae). Micron, 39: 1171-1178.
  • Sandoz, C., M. Hammer, R. Menzel. 2002. Side specificity of olfactory learning in the honeybee: US input side. Learning and Memory, 9: 337-348.
  • Sherman, G., K. Visscher. 2002. Honeybee colonies achieve fitness through dancing. Nature, 419: 920-922.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Apis_mellifera communication is based on chemical signals, and most of their communication and perception behaviors are centered around scent and taste. The members of the hive colony are bound chemically to each other. Each hive has a unique chemical signature that hivemates use to recognize each other and detect bees from other colonies.

Within the hive, bees are in constant chemical communication with each other. Workers feed and groom each other, as well as larvae, drones, and the queen. In the process they pass on pheromones, chemical signals that indicate information about the health of the queen and the state of the colony.

Chemicals not only help with detecting the right signature of hives but also with foraging. Honeybees use scent to locate flowers from a distance. When a successful forager returns to the hive, it passes the scent of the flowers to its nest mates, to help them find the same patch of flowers.

Bees also use chemicals to signal outside the hive. When a worker stings something, her stinger releases an alarm pheromone that causes other bees to become agitated, and helps them locate the enemy.

Thought it's always dark in the hive, vision is important to honeybees outside. They can see other animals, and recognize flowers. The eyes of Apis species can detect ultraviolet light wavelengths that are beyond the visible spectrum. This allows them to locate the sun on cloudy days, and see markings on flowers that are only visible in ultraviolet light. One portion of honeybee's eyes is sensitive to polarized light, and they use this to navigate.

Workers and queens can hear vibrations. New queens call to each other and workers when they first emerge. Workers hear the vibrations of the waggle dances made by returning foragers.

Apis species have a particularly notable form of communication called "dancing." Foragers that have located an abundant supply of food do a dance to communicate the location of the patch to other foragers. A "round dance" indicates food within about 300 meters of the hive, and only communicates the presence of the flowers, not the direction, though workers will also get the scent from the food the forager has brought back. The more complicated "waggle dance" indicates the direction and distance of food further away, using the location of the sun and the bee's memory of the distance it flew to return to the hive. Symbolic communication is quite unusual among invertebrates, and these honeybee "dances" have been intensively studied.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: visual ; ultraviolet; polarized light ; tactile ; acoustic ; chemical

  • Breed, M., L. Butler, T. Stiller. 1985. Kin discrimination by worker honey bees in genetically mixed groups. Proceedings of the National Academy of Sciences of the United States of America, 82/9: 3058-3061.
  • Reinhard, J., M. Srinivasan, S. Zhang. 2004. Scent-triggered navigation in honeybees. Nature, 427: 411.
  • Roat, T., C. Landim. 2008. Temporal and morphological differences in post-embryonic differentiation of the mushroom bodies in the brain of workers, queens and drones of Apis mellifera (Hymenoptera: Apidae). Micron, 39: 1171-1178.
  • Sandoz, C., M. Hammer, R. Menzel. 2002. Side specificity of olfactory learning in the honeybee: US input side. Learning and Memory, 9: 337-348.
  • Sherman, G., K. Visscher. 2002. Honeybee colonies achieve fitness through dancing. Nature, 419: 920-922.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Honeybees build a hive out of wax secretions from their bodies, and queens lay their eggs in cells in the wax. The speed of subsequent development of the young is strongly affected by temperature, and is fastest at 33-36°C.

Honeybees are holometabolous insects, and have four stages in the life cycle: egg, larva, pupa, and adult.

A. mellifera eggs hatch in 28-144 hours, depending on their temperature. The larva that emerges is a small white grub. It stays in its wax cell, growing, and is fed and groomed by adult workers. The food that a female larva receives determines whether it will be a queen or worker. At 34°C, larvae feed and grow for 4-5 days, queens for 6 days, and males for 6-7 days. At the end of that period their cell is sealed by adult workers, and the larva molts, spins a silk cocoon, and transforms into the pupa stage. Pupae undergo a massive metamorphosis that takes about 7-8 days for queens, 12 days for workers, and 14-15 days for males. Once their final metamorphosis is complete, they chew their way out of the cell and begin their adult life. They will not grow or molt after emerging. Adult workers will live for 2-4 weeks in the summer, or as long as 11 months if they live through the winter. Males only survive for 4-8 weeks, and do not live through the winter. Queens live 2-5 years.

. The next stage is the larval stage where the larva is fed the royal jelly, pollen/nectar, and honey combination. Next the larva goes into the pupae stage where it caps itself into its cell to metamorphose into the mature stage.

Queens normally take 16 days to reach maturity, the worker bees take 21 days, and the drone takes 24 days to mature.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Honeybees build a hive out of wax secretions from their bodies, and queens lay their eggs in cells in the wax. The speed of subsequent development of the young is strongly affected by temperature, and is fastest at 33-36°C.

Honeybees are holometabolous insects, and have four stages in the life cycle: egg, larva, pupa, and adult.

A. mellifera eggs hatch in 28-144 hours, depending on their temperature. The larva that emerges is a small white grub. It stays in its wax cell, growing, and is fed and groomed by adult workers. The food that a female larva receives determines whether it will be a queen or worker. At 34°C, larvae feed and grow for 4-5 days, queens for 6 days, and males for 6-7 days. At the end of that period their cell is sealed by adult workers, and the larva molts, spins a silk cocoon, and transforms into the pupa stage. Pupae undergo a massive metamorphosis that takes about 7-8 days for queens, 12 days for workers, and 14-15 days for males. Once their final metamorphosis is complete, they chew their way out of the cell and begin their adult life. They will not grow or molt after emerging. Adult workers will live for 2-4 weeks in the summer, or as long as 11 months if they live through the winter. Males only survive for 4-8 weeks, and do not live through the winter. Queens live 2-5 years.

. The next stage is the larval stage where the larva is fed the royal jelly, pollen/nectar, and honey combination. Next the larva goes into the pupae stage where it caps itself into its cell to metamorphose into the mature stage.

Queens normally take 16 days to reach maturity, the worker bees take 21 days, and the drone takes 24 days to mature.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

European honey bees are social insects with a hive typically consisting of a single queen, between 6,000 and 60,000 workers, and a few hundred to a few thousand drones. Upon hatching in the spring, the queen bee destroys all unhatched queens, kills any hatched queens, and takes a mating flight where she mates with several males. The queen stores the sperm and uses it throughout her life to fertilize eggs. After returning from her mating flight, the queen begins to lay eggs and continues to do so throughout the summer. Three days after being laid, an egg hatches into a worm-like larva. The larva then molts each day for four days into a pupa. The pupa goes into a resting stage for a few days and emerges as an adult honey bee.

New European honey bee hives are created by swarming - the original queen and several thousand workers will leave the nest, typically in May or June but sometimes in September or October, and seek a new location in which to build a wax comb hive. The swarm will cluster on a branch near the original nest while scouts locate a suitable nesting site. This process can take a few hours or days. A honey bee colony can survive for up to several years.

  • Honey Bee (AgriLIFE Extension, Texas A & M System)
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees (R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service)
  • Honeybee Biology (Ross E. Koning, Plant Physiology Website, 1994)
  • Pollination and Honey Bees (R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005)
  • Stinging Insects: Honey Bees (K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program)
  • University of Georgia Honey Bee Program (University of Georgia)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Apis mellifera queens usually live 2 to 3 years, but some have been known to last for 5 years. Workers typically only live for a few weeks, sometimes a few months if their hive becomes dormant in winter. Males live for 4-8 weeks at the most.

Typical lifespan

Status: wild:
2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Apis_mellifera queens usually live 2 to 3 years, but some have been known to last for 5 years. Workers typically only live for a few weeks, sometimes a few months if their hive becomes dormant in winter. Males live for 4-8 weeks at the most.

Typical lifespan

Status: wild:
2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8 years Observations: As in other social insects, workers and queens have distinct lifespans in the honey bee. Queens have been reported to live up to 8 years. Workers have a short lifespan due to foraging but can live 0.2-0.4 years if prevented from foraging. In the winter, workers can develop into a stress-resistant form called the "diunitus" and live up to 0.9 years (Haddad et al. 2007).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The great majority of female A. mellifera in a hive are sterile workers. Only queens mate and lay eggs. Normally there is only a single reproductive queen in a hive.

During periods of suitably mild weather in spring and summer, males leave the hive and gather at "drone assembly areas" near the hive. Virgin queens will fly through these areas, attracting the males with pheromones. The males pursue, and attempt to mate with the queen in flight. Sometimes a "comet" forms, as a cluster of males forms around the female, with a string of other males trying to catch up. Each male who succeeds in mating drops away, and dies within a few hours or days. Males who do not mate will continue to loiter in the assembly areas until they mate or die trying. Queens will mate with up to 10 males in a single flight.

Queens may mate with males from their own hive, or from other hives in the area. The queen's mating behavior is centered around finding the best place to mate beforehand, by taking directional flights for a period of time, lasting no more than a couple of days. Afterward, she leaves the hive and flies to mate with drones in an assembly area. This normally starts to occur after their first week of birth. The queen does this up to four times. After this congregate of mating has occurred, she never mates again in her lifetime.

Mating System: polyandrous ; eusocial

Apis mellifera queens are the primary reproducers of the nest and all of the activities of the colony are centered around their reproductive behaviors and their survival. The queen is the only fertile female in the colony. She lays eggs nearly continuously throughout the year, sometimes pausing in late fall in cold climates. A particularly fertile queen may lay as many as 1,000 eggs/day, and 200,000 eggs in her lifetime. It takes a queen about 16 days to reach adulthood, and another week or more to begin laying eggs. Males take about 24 days to emerge as adults, and begin leaving the nest for assembly areas a few days after that.

Queen honeybees can control whether or not an egg they lay is fertilized. Unfertilized eggs develop as males and are haploid (have only one set of chromosomes). Fertilized eggs are diploid (two sets of chromosomes) and develop as workers or new queens, depending on how they are fed as larvae. Queens may increase the ratio of male to female eggs they lay if they are diseased or injured, or in response to problems in the colony.

Healthy, well-fed honeybee colonies reproduce by "swarming." The workers in the colony begin by producing numerous queen larvae. Shortly before the new queens emerge, the resident, egg-laying queen leaves the hive, taking up to half the workers with her. This "swarm" forms a temporary group in a tree nearby, while workers scout for a suitable location for a new hive. Once they find one, the swarm moves into the space, and begins building comb and starting the process of food collection and reproduction again.

Meanwhile at the old hive, the new queens emerge from their cells. If the population of workers is large enough, and there are few queens emerging, then the first one or two may leave with "afterswarms" of workers. After the swarming is completed, any remaining new queens try to sting and kill each other, continuing to fight until all but one is dead. After her competition is removed, the surviving queen begins to lay eggs.

Normally the pheromones secreted by a healthy queen prevent workers from reproducing, but if a colony remains queenless for long, some workers will begin laying eggs. These eggs are unfertilized, and so develop as males.

Breeding interval: Colonies typically swarm once or twice a year, usually at the beginning of the season that provides the most nectar.

Breeding season: Late spring until the winter months

Range eggs per season: 60,000 to 80,000.

Average gestation period: 3 days.

Range age at sexual or reproductive maturity (female): 15 to 17 days.

Average age at sexual or reproductive maturity (male): 24 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; induced ovulation ; fertilization (Internal ); oviparous ; sperm-storing

As in most eusocial insects, the offspring of fertile females (queens) are cared for other members of the colony. In honeybees, the caretakers are sterile females, daughters of the queen, called workers.

Workers build and maintain the comb where young bees are raised, gather food (nectar and pollen) feed and tend larvae, and defend the hive and its young from predators and parasites.

Young queens inherit their hive from their mothers. Often several new queens emerge after the old queen leaves with a swarm to found a new colony. The new queens fight for control of the hive, and only one survives the conflict.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Adjare, S. 1990. Beekeeping in Africa. Rome, Italy: Food and Agriculture Organisation of the United Nations. Accessed November 06, 2008 at http://www.fao.org/docrep/t0104e/T0104E00.htm.
  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Tarpy, D., R. Page Jr.. 2000. No behavior control over mating frequency in queen honeybees (Apis mellifera L.): implications for the evolution of extreme polyandry. The American Naturalist, 155/6: 820-827.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The great majority of female A. mellifera in a hive are sterile workers. Only queens mate and lay eggs. Normally there is only a single reproductive queen in a hive.

During periods of suitably mild weather in spring and summer, males leave the hive and gather at "drone assembly areas" near the hive. Virgin queens will fly through these areas, attracting the males with pheromones. The males pursue, and attempt to mate with the queen in flight. Sometimes a "comet" forms, as a cluster of males forms around the female, with a string of other males trying to catch up. Each male who succeeds in mating drops away, and dies within a few hours or days. Males who do not mate will continue to loiter in the assembly areas until they mate or die trying. Queens will mate with up to 10 males in a single flight.

Queens may mate with males from their own hive, or from other hives in the area. The queen's mating behavior is centered around finding the best place to mate beforehand, by taking directional flights for a period of time, lasting no more than a couple of days. Afterward, she leaves the hive and flies to mate with drones in an assembly area. This normally starts to occur after their first week of birth. The queen does this up to four times. After this congregate of mating has occurred, she never mates again in her lifetime.

Mating System: polyandrous ; eusocial

Apis_mellifera queens are the primary reproducers of the nest and all of the activities of the colony are centered around their reproductive behaviors and their survival. The queen is the only fertile female in the colony. She lays eggs nearly continuously throughout the year, sometimes pausing in late fall in cold climates. A particularly fertile queen may lay as many as 1,000 eggs/day, and 200,000 eggs in her lifetime. It takes a queen about 16 days to reach adulthood, and another week or more to begin laying eggs. Males take about 24 days to emerge as adults, and begin leaving the nest for assembly areas a few days after that.

Queen honeybees can control whether or not an egg they lay is fertilized. Unfertilized eggs develop as males and are haploid (have only one set of chromosomes). Fertilized eggs are diploid (two sets of chromosomes) and develop as workers or new queens, depending on how they are fed as larvae. Queens may increase the ratio of male to female eggs they lay if they are diseased or injured, or in response to problems in the colony.

Healthy, well-fed honeybee colonies reproduce by "swarming." The workers in the colony begin by producing numerous queen larvae. Shortly before the new queens emerge, the resident, egg-laying queen leaves the hive, taking up to half the workers with her. This "swarm" forms a temporary group in a tree nearby, while workers scout for a suitable location for a new hive. Once they find one, the swarm moves into the space, and begins building comb and starting the process of food collection and reproduction again.

Meanwhile at the old hive, the new queens emerge from their cells. If the population of workers is large enough, and there are few queens emerging, then the first one or two may leave with "afterswarms" of workers. After the swarming is completed, any remaining new queens try to sting and kill each other, continuing to fight until all but one is dead. After her competition is removed, the surviving queen begins to lay eggs.

Normally the pheromones secreted by a healthy queen prevent workers from reproducing, but if a colony remains queenless for long, some workers will begin laying eggs. These eggs are unfertilized, and so develop as males.

Breeding interval: Colonies typically swarm once or twice a year, usually at the beginning of the season that provides the most nectar.

Breeding season: Late spring until the winter months

Range eggs per season: 60,000 to 80,000.

Average gestation period: 3 days.

Range age at sexual or reproductive maturity (female): 15 to 17 days.

Average age at sexual or reproductive maturity (male): 24 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; induced ovulation ; fertilization (Internal ); oviparous ; sperm-storing

As in most eusocial insects, the offspring of fertile females (queens) are cared for other members of the colony. In honeybees, the caretakers are sterile females, daughters of the queen, called workers.

Workers build and maintain the comb where young bees are raised, gather food (nectar and pollen) feed and tend larvae, and defend the hive and its young from predators and parasites.

Young queens inherit their hive from their mothers. Often several new queens emerge after the old queen leaves with a swarm to found a new colony. The new queens fight for control of the hive, and only one survives the conflict.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Adjare, S. 1990. Beekeeping in Africa. Rome, Italy: Food and Agriculture Organisation of the United Nations. Accessed November 06, 2008 at http://www.fao.org/docrep/t0104e/T0104E00.htm.
  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Tarpy, D., R. Page Jr.. 2000. No behavior control over mating frequency in queen honeybees (Apis mellifera L.): implications for the evolution of extreme polyandry. The American Naturalist, 155/6: 820-827.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Water collection cools hive: honeybee
 

Honeybees cool the hive by collecting water, spreading it, and fanning to increase evaporation.

   
  "Honeybee colonies collect water for two reasons, related to different types of weather: for cooling of the brood area by evaporation on hot days, and for feeding the larval brood when foraging is limited on cool days (Lindauer, 1955; Seeley, 1995). The classic studies of Lindauer showed how bees regulate the hive temperature in hot conditions (Lindauer, 1955). Water is collected by water foragers, then distributed around the hive and in cells containing eggs and larvae; fanning accelerates its evaporation, as does regurgitation and evaporation on the tongue (Lindauer, 1955). Visscher and colleagues measured mean water loads of 44 mg in honeybees collecting water under desert conditions (Visscher et al., 1996). Paper wasps and hornets also use water for cooling their nests, but the highly social stingless bees do not (Jones and Oldroyd, 2007; Roubik, 2006)." (Nicholson 2009:430-431)

  Learn more about this functional adaptation.
  • Nicholson SW. 2009. Water homeostasis in bees, with the emphasis on sociality. Journal of Experimental Biology. 212: 429-434.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Varying response thresholds aid hive thermoregulation: honeybee
 

Honeybees in a colony regulate hive temperature due to diverse response thresholds.

       
  "A honey bee colony is characterized by high genetic diversity among its workers, generated by high levels of multiple mating by its queen. Few clear benefits of this genetic diversity are known. Here we show that brood nest temperatures in genetically diverse colonies (i.e., those sired by several males) tend to be more stable than in genetically uniform ones (i.e., those sired by one male). One reason this increased stability arises is because genetically determined diversity in workers' temperature response thresholds modulates the hive-ventilating behavior of individual workers, preventing excessive colony-level responses to temperature fluctuations." (Jones 2006:402)

Watch Video of Bees Fanning Hive
  Learn more about this functional adaptation.
  • Jones, J. C.; Myerscough, M. R.; Graham, S.; Oldroyd, B. P. 2004. Honey Bee Nest Thermoregulation: Diversity Promotes Stability. American Association for the Advancement of Science. 402-404 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Vibration creates heat: honeybee
 

Honeybees create heat in hives via thoracic vibrations.

     
  "Researchers at the University of Würzburg in Germany found that bee hive temperatures were not only maintained by general hive activity, but also by workers congregating at the brood and vibrating their thoracic muscles to warm the incubating young. Some of the workers stay completely motionless on a brood cap for several minutes, pressing their thoraxes against the cap to warm the young within. But many of the bees occupy an empty cell amongst sealed brood cells, and take up residence, sometimes for over an hour. Here, they vibrate their thoracic muscles and reach temperatures up to 41°C. The bees' heat can be felt up to 3 chambers away, and their head warms the six surrounding chambers. Usually a single occupant is the only beneficiary from a worker perched above it on the comb." (Courtesy of the Biomimicry Guild)

  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Groups vote on hive locations: honeybees
 

Honeybees in a colony select a new hive location via range voting.

   
  "Thomas Seeley, a biologist at Cornell University, has been looking into the uncanny ability of honeybees to make good decisions. With as many as 50,000 workers in a single hive, honeybees have evolved ways to work through individual differences of opinion to do what's best for the colony. If only people could be as effective in boardrooms, church committees, and town meetings, Seeley says, we could avoid problems making decisions in our own lives.

"During the past decade, Seeley, Kirk Visscher of the University of California, Riverside, and others have been studying colonies of honeybees (Apis mellifera) to see how they choose a new home. In late spring, when a hive gets too crowded, a colony normally splits, and the queen, some drones, and about half the workers fly a short distance to cluster on a tree branch. There the bees bivouac while a small percentage of them go searching for new real estate. Ideally, the site will be a cavity in a tree, well off the ground, with a small entrance hole facing south, and lots of room inside for brood and honey. Once a colony selects a site, it usually won't move again, so it has to make the right choice.

"To find out how, Seeley's team applied paint dots and tiny plastic tags to identify all 4,000 bees in each of several small swarms that they ferried to Appledore Island, home of the Shoals Marine Laboratory. There, in a series of experiments, they released each swarm to locate nest boxes they'd placed on one side of the half-mile-long (one kilometer) island, which has plenty of shrubs but almost no trees or other places for nests.

"In one test they put out five nest boxes, four that weren't quite big enough and one that was just about perfect. Scout bees soon appeared at all five. When they returned to the swarm, each performed a waggle dance urging other scouts to go have a look. (These dances include a code giving directions to a box's location.) The strength of each dance reflected the scout's enthusiasm for the site. After a while, dozens of scouts were dancing their little feet off, some for one site, some for another, and a small cloud of bees was buzzing around each box.

"The decisive moment didn't take place in the main cluster of bees, but out at the boxes, where scouts were building up. As soon as the number of scouts visible near the entrance to a box reached about 15—a threshold confirmed by other experiments—the bees at that box sensed that a quorum had been reached, and they returned to the swarm with the news.

"'It was a race,' Seeley says. 'Which site was going to build up 15 bees first?'

"Scouts from the chosen box then spread through the swarm, signaling that it was time to move. Once all the bees had warmed up, they lifted off for their new home, which, to no one's surprise, turned out to be the best of the five boxes.

"The bees' rules for decision-making—seek a diversity of options, encourage a free competition among ideas, and use an effective mechanism to narrow choices—so impressed Seeley that he now uses them at Cornell as chairman of his department." (Miller 2007:4-5)

  Learn more about this functional adaptation.
  • Miller, Peter. 2007. The Genius of Swarms. National Geographic [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Strategy ensures smooth landings: honeybee
 

The landing strategy of honeybees results in smooth touchdowns on any surface because it is tailored to varying topography.

       
  "Although landing is a crucial part of insect flight, it has attracted  relatively little study. Here, we investigate, for the first  time, the final moments of a honeybee's (Apis mellifera) landing  manoeuvre. Using high-speed video recordings, we analyse the  behaviour of bees as they approach and land on surfaces of  various orientations. The bees enter a stable hover phase, immediately  prior to touchdown. We have quantified behaviour during this  hover phase and examined whether it changes as the tilt of  the landing surface is varied from horizontal (floor), through  sloped (uphill) and vertical (wall), to inverted (ceiling). The  bees hover at a remarkably constant distance from the surface, irrespective  of its tilt. Body inclination increases progressively as the  tilt of the surface is increased, and is accompanied by an  elevation of the antennae. The tight correlation between the  tilt of the surface, and the orientation of the body and the  antennae, indicates that the bee's visual system is capable of  inferring the tilt of the surface, and pointing the antennae toward  it. Touchdown is initiated by extending the appendage closest  to the surface, namely, the hind legs when landing on horizontal  or sloping surfaces, and the front legs or antennae when  landing on vertical surfaces. Touchdown on inverted surfaces is  most likely triggered by a mechanosensory signal from the antennae.  Evidently, bees use a landing strategy that is flexibly tailored  to the varying topography of the terrain." (Evangelista et al. 2010:262)

  Learn more about this functional adaptation.
  • Evangelista C; Kraft P; Dacke M; Reinhard J; Srinivasan MV. 2010. The moment before touchdown: landing manoeuvres of the honeybee Apis mellifera. Journal of Experimental Biology. 213: 262-270.
  • Sohn E. 2009. Bees always have a safe landing. Discovery News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Diet diversity affects health: honeybees
 

Immunocompetence of honeybees is maintained with a diverse diet.

     
  "The maintenance of the immune system can be costly, and a lack of  dietary protein can increase the susceptibility of organisms  to disease. However, few studies have investigated  the relationship between protein nutrition and immunity in insects.  Here,  we tested in honeybees (Apis mellifera)  whether dietary protein quantity (monofloral pollen) and diet diversity  (polyfloral pollen) can shape baseline immunocompetence  (IC) by measuring parameters of individual immunity  (haemocyte concentration, fat body content and phenoloxidase activity)  and glucose oxidase (GOX) activity, which enables  bees to sterilize colony and brood food, as a parameter of social  immunity.  Protein feeding modified both individual and social  IC but increases in dietary protein quantity did not enhance IC.  However,  diet diversity increased IC levels. In particular,  polyfloral diets induced higher GOX activity compared with monofloral  diets,  including protein-richer diets. These results  suggest a link between protein nutrition and immunity in honeybees and  underscore  the critical role of resource availability on  pollinator health." (Alaux et al. 2010)
  Learn more about this functional adaptation.
  • Alaux C; Ducloz F; Crauser D; Le Conte Y. 2010. Diet effects on honeybee immunocompetence. Biology Letters.
  • Black R. 2010. Bee decline linked to falling biodiversity. BBC News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Body detects magnetic fields: honeybee
 

The abdomens of honeybees may be able to detect magnetic fields and use them in navigation thanks to magnetite.

     
  "The bodies of honeybees also contain magnetite. In the 1970s, Princeton University zoologist Dr. Joseph Kirschvink showed that the magnetite lies in bands of cells in each segment of the bee's abdomen. It is most concentrated just below the ganglion (a compact mass of nerve cells)." (Shuker 2001:45)

"'How do MGs found in the abdomen function as magnetoreceptors' is an enigma yet to be resolved. Suffice to note that peripheral neurons of insects may play a role independent of the brain, such that a male cockroach can continue with mating, with its head bitten off by his female partner. Certainly, a magnetoreception system for positioning and orientation exists in honeybees, and this simple, primitive, and highly accurate sensing mechanism may be present in all other magnetotactic organisms." (Hsu et al. 2007:8)
  Learn more about this functional adaptation.
  • Hsu C-Y; Ko F-Y; Li C-W; Fann K; Lue J-T. 2007. Magnetoreception system in honeybees Apis mellifera. PLoS ONE. 2(4): e395.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Heat creates precise shapes: bees
 

The body heat of bees helps create precise angles and size within honeycombs via use of thermoplastic wax.

       
  "Geometrical investigations of honeycombs and speculations on how honeybees measure and construct the hexagons and rhombi of their cells are centuries old. Here we show that honeybees neither have to measure nor construct the highly regular structures of a honeycomb, and that the observed pattern of combs can be parsimoniously explained by wax flowing in liquid equilibrium. The structure of the combs of honeybees results from wax as a thermoplastic building medium, which softens and hardens as a result of increasing and decreasing temperatures. It flows among an array of transient, close-packed cylinders which are actually the self-heated honeybees themselves. The three apparent rhomboids forming the base of each cell do not exist but arise as optical artefacts from looking through semi-transparent combs." (Pirk et al. 2004:350)
  Learn more about this functional adaptation.
  • Pirk, CWW; Hepburn, HR; Radloff, SE; Tautz. 2004. Honeybee combs: construction through a liquid equilibrium process?. Naturwissenschaften. 91: 350-353.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Wings generate lift: honeybee
 

The wings of a honeybee generate lift by arcing back and flipping over on the return.

       
  "The notion that engineers once 'proved' that bees can't fly has become an urban myth. So partly to restore the reputation of the profession, Michael Dickinson decided to investigate the forces at work during honeybee flight.

In 1996, Charlie Ellington at the University of Cambridge showed how vortices rolling along the leading edge of the wing were the vital source of lift for most insects. But this can't explain how a heavy insect with a short wing beat, such as a bee, generates enough lift to fly.

Dickinson and his colleagues at Caltech in Pasadena, California, filmed hovering bees at 6000 frames per second, and plotted the unusual pattern of wing beats. The wing sweeps back in a 90-degree arc, then flips over as it returns — 230 times a second. The team made a robot to scale to measure the forces involved.

It is the more exotic forces created as the wing changes direction that dominate, says Dickinson. Additional vortices are produced by the rotation of the wing. 'It's like a propeller, where the blade is rotating too,' he says. Also, the wing flaps back into its own wake, which leads to higher forces than flapping in still air. Lastly, there is 'added-mass force' which peaks at the end of each stroke and comes from the acceleration of the wing after it changes direction." (Phillips 2005:17)

  Learn more about this functional adaptation.
  • Helen Phillips. 2005. The aerodynamic tricks that keep bees airborne. New Scientist. 188(2528):
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genome

The genome sequence of the honeybee was first reported in 2006 (Weinstock et al. 2006, Wilson 2005). Notable characteristics of this genome include high A+T and CpG contents, the lack of major transposon families, relatively slow evolution, and similarity to vertebrates for circadian rhythm, RNA interference and DNA methylation genes. The honeybee was found to have relatively few genes for innate immunity, detoxification enzymes, cuticle-forming proteins and gustatory receptors, but a fairly high number of genes for odorant receptors. Novel genes were found for nectar and pollen utilization (Weinstock et al. 2006).

  • Weinstock, G.M. et al. 2006. (The Honeybee Genome Sequencing Consortium). Insights into social insects from the genome of the honeybee Apis mellifera. Nature 443:931–949. 10.1038/nature05260
  • Wilson, E.O. 2006. Genomics: How to make a social insect. Nature 443:919-920. 10.1038/443919a
Creative Commons Attribution 3.0 (CC BY 3.0)

© Katja Schulz

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Apis mellifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTAATTGGAGGATTTGGAAATTGGCTTATTCCTTTAATACTAGGATCACCTGATATAGCATTCCCCCGAATAAATAATATTAGATTTTGATTACTTCCTCCCTCATTATTTATACTTTTATTAAGAAATTTATTTTATCCAAGACCAGGAACTGGATGAACAGTATATCCACCATTATCAGCATATTTATATCATTCTTCACCTTCAGTAGATTTTGCAATTTTTTCTCTTCATATATCAGGAATTTCCTCAATTATAGGATCATTAAACTTAATAGTTACAATTATAATAATAAAAAATTTTTCTATAAATTATGACCAAATTTCATTATTTCCATGATCAGTTTTTATTACAGCAATTTTATTAATTATATCATTACCTGTATTAGCTGGAGCAATTACTATACTATTATTTGATCGAAATTTTAATACATCATTTTTCGATCCTATAGGAGGTGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATCTCTCATATTGTAATAAATGAAAGAGGAAAAAAAGAAATTTTTGGTAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTCTAGGTTTTATTGTTTGAGCACATCACATATTTACAGTCGGATTAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apis mellifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 64
Specimens with Barcodes: 272
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Melittin

Chemical Structure

Melittin is the main component of apitoxin (Apis mellifera venom), accounting for approximately 50% of its dry weight (Terra et al., 2006). The water-soluble, 26 amino acid-long polypeptide chain, weighing 2,840 Da, is largely composed of hydrophobic residues, with the exception of the cationic and hydrophilic carboxy-terminal sequence (Vogel et al., 1986). It is this amphiphilic nature that gives melittin its characteristic detergent-like properties (Maulet et al., 1980).

Using a range of techniques, including X-ray crystallography, NMR spectroscopy, and molecular dynamics simulations, melittin was found to adopt a variety of conformations, depending on factors including the pH and the type of aqueous medium. For instance, when dissolved in water, the hydrophilic residues 22-26 were shown to form a non-helical segment, whereas the remaining hydrophobic residues of melittin were reported to form a bent helix, composed of two smaller α-helical segments of residues 1-11 and 12-21. The concave side of the bent helix was found to be hydrophobic, while the convex side was shown to be hydrophilic (Vogel, et al., 1986). Additionally, melittin was found to be tetrameric at high pH, a random coil at pH 7.0, and monomeric in plasma (Terra, et al., 2006).

Mode of Action

In the bloodstream, melittin is able to rapidly bind to erythrocytes (red blood cells), inducing the release of haemoglobin and other cellular contents into the extracellular medium. Once melittin has penetrated the erythrocyte, it causes micellisation of phosphatidylcholine bilayers, ultimately leading to haemolysis and cell death (Dempsey, et al., 1990).

Apart from its ability to disrupt lipid bilayers, melittin can also inhibit transmembrane proteins, including Na+/K+-ATPase, leading to a rise in sodium concentration within cells (Yang, et al., 2001). The increase in sodium induces an increase in the concentration of intracellular calcium, which results in the increased contraction of cardiac and smooth muscle.

Potential Therapeutic Use

Melittin is currently one of the most extensively used peptides in the research on lipid-peptide and peptide-peptide interactions (Wessman, et al., 2010). The presence of a single tryptophan residue at position 19 allows for a facilitated interpretation of fluorescence data via the tryptophan fluorescence technique, whereby intrinsic fluorescence emissions can be measured via the excitation of tryptophan residues (Raghuraman, et al., 2004).

More recently, the peptide has been shown to possess a variety of therapeutic uses. For instance, melittin is currently being analysed as a potential treatment and preventative for HIV. In a study currently being conducted at Washington University School of Medicine in St. Louis, a melittin-nanoparticle complex was shown to effectively destroy the AIDS-causing virus by forming pores in its protective viral envelope, required for viral reproduction (Evangelou Strait, 2013).

Another use of melittin is in the treatment of cancer. A promising study, once again conducted by researchers at Washington University School of Medicine in St. Louis, involves the attaching of melittin to a different nanoparticle. The novel melittin-nanoparticle complex, named the “nanobee”, selectively targets tumour cells, thus avoiding healthy cells. Once attached to a tumour cell, melittin is able to break down the tumour by forming pores in the cell membrane (Loftus, 2009). 

  • Dempsey C.E., Sternberg B. 1991. Reversible disc-micellization of dimyristoylphosphatidylcholine bilayers induced by melittin and [Ala-14]melittin. Biochim. Biophys. Acta. 1061:175–184.
  • Evangelou Strait J. (2013, March 7). Nanoparticles loaded with bee venom kill HIV. Newsroom. Retrieved June 19, 2013 from http://news.wustl.edu/news/Pages/25061.aspx
  • Loftus P. (2009, September 28). The Buzz: Targeting cancer with bee venom in animal studies, tiny composite spheres deliver drug directly to tumor sites; 'It's Like an Injection'. The Wall Street Journal. Retrieved June 19, 2013 from http://online.wsj.com/article/SB10001424052970203803904574433382922095534.html?mod=WSJ_hpp_MIDDLENexttoWhatsNewsThird
  • Maulet Y., Matthey-Prevot B., Kaiser G., Rüegg U.T., Fulpius B.W. 1980. Purification and chemical characterization of melittin and acetylated derivatives. Biochim. Biophys. Acta. 625:274-280
  • Raghuraman H., Chattopadhyay A. 2004. Interaction of melittin with membrane cholesterol: a fluorescence approach. Biophys J. 87:2419–2432.
  • Terra R.M., Guimarães J.A., Verli H. 2006. Structural and functional behavior of biologically active monomeric melittin. Journal of Molecular Graphics and Modelling. 25:767–772.
  • Vogel H., Jahnig F. 1986. The structure of melittin in membranes. Biophysical Journal. 50(4):573-582.
  • Wessman P., Morin M., Reijmar K., Edwards K. 2010. Effect of a-helical peptides on liposome structure: A comparative study of melittin and alamethicin. Journal of Colloid and Interface Science 346:127–135.
  • Yang S., Zhang X.M., Jiang M.H. 2001. Inhibitory effect of melittin on Na+,K+-ATPase from guinea pig myocardial mitochondria. Acta Pharmacologica Sinica. 22(3):279-282.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Momoka Hayashi

Supplier: Momoka Hayashi

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

While the species as a whole is still very numerous, there is concern in Europe that widespread commercialization of beekeeping is endangering locally-adapted populations and subspecies. This, combined with higher mortality of colonies due to Varroa mite and tracheal mite infestations, and the recent phenomenon of Colony Collapse Disorder in North America, has cause significant concern for the health of the population. Colony Collapse Disorder (CCD) is a condition of commercial beehives, where there are sudden massive waves of mortality among the workers. Beekeepers discover their hives simply empty of workers, with so few surviving that they cannot tend the queen and brood. This condition has occurred mainly in North America, and mainly in large commercial apiaries. No single cause has been identified yet.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

While the species as a whole is still very numerous, there is concern in Europe that widespread commercialization of beekeeping is endangering locally-adapted populations and subspecies. This, combined with higher mortality of colonies due to Varroa mite and tracheal mite infestations, and the recent phenomenon of Colony Collapse Disorder in North America, has cause significant concern for the health of the population. Colony Collapse Disorder (CCD) is a condition of commercial beehives, where there are sudden massive waves of mortality among the workers. Beekeepers discover their hives simply empty of workers, with so few surviving that they cannot tend the queen and brood. This condition has occurred mainly in North America, and mainly in large commercial apiaries. No single cause has been identified yet.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

A widespread, usually domesticated species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Natural populations of honey bees have been severely affected by the activities of humans (6). Non-native subspecies have been widely introduced to many areas of Europe, and managed colonies have often interbred with native bees, causing a loss of unique genetic diversity in local populations (6). In Germany the native race Apis mellifera mellifera is now thought to be extinct, as it has been completely replaced by the introduced Apis mellifera carnica (6). A more recent threat to the species in Britain is the mite Varroa jacobsoni, which is devastating honey bee populations around the world (4) and was first found in Britain in 1992. These mites attack larvae, pupae and adults (3) and are very expensive to control; in the last 15 years the expense involved has caused a worrying 40-45 % of beekeepers to abandon the craft. To make matters worse, strains of the mite with resistance to the chemicals used in their control have recently been found (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The European Commission has set up the 'Beekeeping and Apis Biodiversity in Europe' (BABE) project, which aims to conserve local subspecies of Apis mellifera, and to maintain the genetic uniqueness of local populations (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Honeybee workers will sting humans and domesticated animals in defense of themselves or their hive. A single sting is painful but not dangerous unless the target is allergic to the venom, in which case it can be life threatening. Otherwise, it takes about 20 stings per kilogram of body weight to be life threatening.

Each subspecies of Apis mellifera has different behavioral patterns in regards to intruders near or around the hive. The African subspecies are particularly aggressive. One of them, Apis mellifera scutellata, was accidentally released in South America, and has spread north to the southern United States. This is the "killer bee." It is notable for having a much higher aggressive response to disturbance -- more workers attack than in other subspecies, and they pursue targets much longer than European bees do. The spread of these bees made beekeeping much more expensive and complicated, and the aggressive bees caused many deaths.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Honeybees pollinate billions of US dollars worth of commercial agricultural crops around the world every year. They are important pollinators for economically important wild plant populations as well.

Honeybee hives provide honey and wax, and pollen, propolis, and royal jelly that are sold for medicines and cosmetics.

Honeybees are important study organisms for research in the connections between nervous system structure and behavior.

Some research suggests honeybee venom may have medically useful applications in the treatment of auto-immune disease or inflammation.

Positive Impacts: food ; source of medicine or drug ; research and education; pollinates crops

  • Kang, S., C. Pak, H. Choi. 2002. The effect of whole bee venom on arthritis. The American Journal of Chinese Medicine, 30/1: 73-80.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Honeybee workers will sting humans and domesticated animals in defense of themselves or their hive. A single sting is painful but not dangerous unless the target is allergic to the venom, in which case it can be life threatening. Otherwise, it takes about 20 stings per kilogram of body weight to be life threatening.

Each subspecies of Apis_mellifera has different behavioral patterns in regards to intruders near or around the hive. The African subspecies are particularly aggressive. One of them, Apis mellifera scutellata, was accidentally released in South America, and has spread north to the southern United States. This is the "killer bee." It is notable for having a much higher aggressive response to disturbance -- more workers attack than in other subspecies, and they pursue targets much longer than European bees do. The spread of these bees made beekeeping much more expensive and complicated, and the aggressive bees caused many deaths.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Honeybees pollinate billions of US dollars worth of commercial agricultural crops around the world every year. They are important pollinators for economically important wild plant populations as well.

Honeybee hives provide honey and wax, and pollen, propolis, and royal jelly that are sold for medicines and cosmetics.

Honeybees are important study organisms for research in the connections between nervous system structure and behavior.

Some research suggests honeybee venom may have medically useful applications in the treatment of auto-immune disease or inflammation.

Positive Impacts: food ; source of medicine or drug ; research and education; pollinates crops

  • Kang, S., C. Pak, H. Choi. 2002. The effect of whole bee venom on arthritis. The American Journal of Chinese Medicine, 30/1: 73-80.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pollinator

The European honey bee is particularly well adapted for pollination. Each colony has many individuals available to collect pollen and, therefore provide pollination services. Honey bees have a complex communication system, allowing individuals to "point out" food sources to other members of the colony. The European honey bee also has a well developed sense of smell and is easily able to locate flowers. When a worker bee visits a flower, pollen is dusted all over its body and is then transferred between flowers. In a single day, one bee can make more than 12 trips from the hive and can visit several thousand flowers.

In the United States, honey bees pollinate over 90 commercial crops and add billions of dollars per year to agricultural output. In fact, over 3.5 million acres of crop land in the United States is reliant upon honey bees for pollination. Some specific crops pollinated by the honey bee include apple, strawberry, almond, cotton, broccoli, carrot, pepper, and squash.

  • Honey Bee, AgriLIFE Extension, Texas A & M System
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees, R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service
  • Honeybee Biology, Ross E. Koning, Plant Physiology Website, 1994
  • Pollination and Honey Bees, R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005
  • Stinging Insects: Honey Bees, K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program
  • University of Georgia Honey Bee Program, University of Georgia
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Buckfast bee

The Buckfast bee is a strain of honey bee. It is a hybrid, a cross of many strains of bees, developed by "Brother Adam", (born Karl Kehrle on 3 August 1898 in Germany), who was in charge of beekeeping at Buckfast Abbey, where the bees are still bred today. Most of the breeding work in Europe is done by breeders belonging to the breeders accociation "Gemeinschaft der Europäischen Buckfastimker". This organisation is maintaining a pedigree for Buckfast bees, originating from Brother Adam's years.

Contents

Origin

In the early 20th century bee populations were being decimated by Isle of Wight disease. This condition, later called "acarine" disease, after the acarine parasitic mite that invaded the bees' tracheal tubes and shortened their lives, was killing off thousands of colonies in the British Isles in the early part of the 20th century.[1]

In 1916 there were only 16 surviving colonies in the Abbey. All of them were either pure Ligurian (Italian) or of Ligurian origin, hybrids between Ligurian and the English black bee A.m. mellifera. Brother Adam also imported some more Italian queens. From these he began to develop what would come to be known as the Buckfast bee.

Heritage

The Buckfast contains heritage from mainly A.m. ligurica (North Italian), A.m. mellifera (English), A.m. mellifera (French), A.m. anatolica (Turkish) and A.m. cecropia (Greek). The Buckfast bee of today also contains heritage from two rare and docile African stocks A. m. sahariensis and the A.m. monticola, but not the "Africanized" A. m. scutellata. "[2]

History

Brother Adam moved the bees he discovered to the isolated valley of Dartmoor which became a mating station for selective breeding. With no other bees within range, Brother Adam could maintain their genetic integrity and develop desirable traits.

Brother Adam investigated various honey bee races and made many long journeys in Europe, Africa and the Middle-East searching for pure races and interesting local stocks. The book In Search of the Best Strains of Bee tells about his travels in search of genetic building blocks. Brother Adam imported more bees to cross with his developing Buckfast bee.

Every new bee strain or bee race was first crossed with the existing Buckfast Bee. In most cases, the new desired qualities were passed on to the new generation and the new combination was then made stable with further breeding work. Every crossing with a new race took about 10 years before the desired genes were fixed in the strain. Over seventy years, Brother Adam managed to develop a vigorous, healthy, and fecund honey bee which he christened the Buckfast bee.

The Buckfast bee is popular among beekeepers and is available from bee breeders in Germany, Ireland, the United Kingdom, France, and more. Most of the Buckfast bee's qualities are very favorable. They are extremely gentle and highly productive. Brother Adam, in his book, Beekeeping at Buckfast Abbey writes that in 1920 they obtained "an average of no less than 192 lbs surplus per colony and individual yields exceeding 3 cwt [approx. 336 lbs]. "[3] In the 1986 BBC-affiliated documentary, The Monk and the Honey Bee, more than 400 pounds of honey are reported to have been produced by a single Buckfast colony. According to Brother Adam, "The average annual honey yield over the last thirty years has been 30 kg (66 lb.) per colony. Thus we have a favourable balance compared with the average production in America or in Europe. "[4][5]

The stock has been imported into the United States (eggs, semen, and adult queens via Canada) and they are easily available.[6]

Buckfast Breeding Program

The qualities and characteristics desired in Brother Adam's breeding can be divided into three groups; Primary, Subsidiary, and 3rd, those that have bearing on management.

Primary

Primary qualities are those qualities essential for any maximum honey production.

  • Fecundity - maintaining at least 9 frames of brood May - July
  • Foraging zeal - a boundless capacity for foraging work, close inbreeding to intensify this quality can be counter-productive.
  • Resistance to disease
  • Disinclination to swarm

Subsidiary

  • Longevity
  • Wing-power
  • Keen sense of smell
  • Defensive characteristics
  • Hardiness and ability to over winter
  • Spring development
  • Thrift
  • Instinct of self provisioning
  • Arrangement of honey stores
  • Wax production and comb building
  • Gathering of pollen
  • Tongue-reach

Qualities which Influence Management

  • Good temper
  • Calm behavior
  • Disinclination to propolize
  • No brace combs
  • Cleanliness
  • Honey capping
  • Sense of orientation[7][8]

Characteristics

Strong Points

  • Good honey producer
  • Prolific queens (lay many eggs)
  • Overwinters well
  • Frugal - Low amount of brood during fall (uses less honey stores during winter)
  • Packs brood nest with honey for good wintering
  • Curtails egg laying during dearths
  • Brood rearing ceases during late fall
  • Extremely gentle, with low sting instinct
  • Low swarm instinct
  • High Tracheal Mite Tolerant
  • Low incidence of chalkbrood and wax moths due to good housecleaning techniques
  • Very hygienic
  • Build-up rapidly once started
  • Produces little propolis/brace comb[9]
  • Does well in cold/wet spring

Weak Points

  • Low amount of brood during Winter
  • Less honey or pollen due to erratic spring weather conditions
  • Possibility of second generation defensiveness if not requeened
    • This is not due to being a "second generation" hybrid. The Buckfast is a mix of many, many generations with many different species. A likely cause of "hot" hives in subsequent generations is the introduction of Africanized bee genetics being introduced either to the mother queen or to the daughter queen via local Africanized drones. Buckfast bees in cooler regions where Africanized bees have not arrived do not have this problem.

Significance

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!