You are viewing this Species as classified by:

Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The European honey bee, also known as the common or western honey bee (Apis mellifera) is so named because it produces large amounts of honey. It is believed that the honey bee originated in Africa and spread to northern Europe, India, and China. The honey bee is not native to North America, but was brought here with the first colonists. The honey bee is now distributed world wide.

European honey bees are variable in color, but are some shade of black or brown intermixed with yellow. The bee ranges from 3/8 to 3/4 of an inch long, with workers being the smallest and the queen being the largest. A queen bee is elongate and has a straight stinger with no barbs. A worker bee has hind legs specialized for collecting pollen - each leg is flattened and covered with long fringed hairs that form a pollen basket. A worker bee's stinger has barbs. A drone bee is stout-bodied and has large eyes.

Wild European honey bee nests are found in hollow trees or man-made structures. Managed colonies are often kept in wooden hives. Flowers in meadows, open woods, agricultural areas, and yards and gardens are visited by worker bees.

  • Honey Bee (AgriLIFE Extension, Texas A & M System)
  • University of Georgia Honey Bee Program (University of Georgia)
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees (R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service)
  • Stinging Insects: Honey Bees (K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program)
  • Pollination and Honey Bees (R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005)
  • Honeybee Biology (Ross E. Koning, Plant Physiology Website, 1994)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 2 people

Average rating: 4.5 of 5

Description

The honey bee is probably one of the best-known of all insects in the world (3); it performs a vital role in the pollination of flowering plants, including our crop species (4) . There are three 'castes' within a bee hive, a 'queen' (the reproductive female), the 'drones' (reproductive males) and 'workers' (non-reproductive females) (3). All three castes are broadly similar in appearance; the body is covered in short hairs, and is divided into a head, a thorax and an abdomen, the head features two large eyes and a pair of antennae. The thorax bears two pairs of wings above, and three pairs of legs below and there is a slender 'waist' between the thorax and abdomen (5). The queen has a much longer and slender abdomen than the workers, and the drones can be identified by their broader abdomens and much larger eyes (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 3.25 of 5

Honey bees are insects which make honey and wax. They are held by beekeepers in hives or chests. A colony can consist of 50,000 animals: most of them are workers, a few hundred are drones (males) and one is the queen. Dunes and salt marshes are suitable food areas for honey bees.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Apis_mellifera is native to Europe, western Asia, and Africa. Human introduction of Apis_mellifera to other continents started in the 17th century, and now they are found all around the world, including east Asia, Australia and North and South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Winston, M., J. Dropkin, O. Taylor. 1981. Demography and life history characteristics of two honey bee races (Apis mellifera). Oecologia, 48: 407-413.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Apis mellifera is native to Europe, western Asia, and Africa. Human introduction of Apis mellifera to other continents started in the 17th century, and now they are found all around the world, including east Asia, Australia and North and South America.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Winston, M., J. Dropkin, O. Taylor. 1981. Demography and life history characteristics of two honey bee races (Apis mellifera). Oecologia, 48: 407-413.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The honey bee is widespread in Britain, and is often a domesticated species. This bee is native to Africa, Europe and the Middle East, and has been introduced to most parts of the world including America, Australia, and Asia. Despite its wide range, however, it is in urgent need of conservation (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Generally, Apis_mellifera are red/brown with black bands and orange yellow rings on abdomen. They have hair on thorax and less hair on abdomen. They also have a pollen basket on their hind legs. Honeybee legs are mostly dark brown/black.

There are two castes of females, sterile workers are smaller (adults 10-15 mm long), fertile queens are larger (18-20 mm). Males, called drones, are 15-17 mm long at maturity. Though smaller, workers have longer wings than drones. Both castes of females have a stinger that is formed from modified ovipositor structures. In workers, the sting is barbed, and tears away from the body when used. In both castes, the stinger is supplied with venom from glands in the abdomen. Males have much larger eyes than females, probably to help locate flying queens during mating flights.

There are currently 26 recognized subspecies of Apis_mellifera, with differences based on differences in morphology and molecular characteristics. The differences among the subspecies is usually discussed in terms of their agricultural output in particular environmental conditions. Some subspecies have the ability to tolerate warmer or colder climates. Subspecies may also vary in their defensive behavior, tongue length, wingspan, and coloration. Abdominal banding patterns also differ - some darker and some with more of a mix between darker and lighter banding patterns.

Honeybees are partially endothermic -- they can warm their bodies and the temperature in their hive by working their flight muscles.

Range length: 10 to 20 mm.

Other Physical Features: endothermic ; ectothermic ; heterothermic ; bilateral symmetry ; venomous

Sexual Dimorphism: female larger; sexes shaped differently

  • Pinto, A., W. Rubink, R. Coulson, J. Patton, S. Johnston. 2004. Temporal pattern of africanization in a feral honeybee population from texas inferred from mitochondrial DNA. Evolution, 58/5: 1047-1055.
  • Seeley, T., R. Seeley, P. Akratanakul. 1982. Colony defense strategies of the honeybees in Thailand. Ecological Monographs, 52/1: 43-63.
  • Clarke, K., T. Rinderer, P. Franck, Q. Javier, B. Oldroyd. 2002. The africanization of honeybees (Apis mellifera L.) of the Yucatan: a study of a massive hybridization event across time. Evolution, 56/7: 1462-1474.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Generally, Apis mellifera are red/brown with black bands and orange yellow rings on abdomen. They have hair on thorax and less hair on abdomen. They also have a pollen basket on their hind legs. Honeybee legs are mostly dark brown/black.

There are two castes of females, sterile workers are smaller (adults 10-15 mm long), fertile queens are larger (18-20 mm). Males, called drones, are 15-17 mm long at maturity. Though smaller, workers have longer wings than drones. Both castes of females have a stinger that is formed from modified ovipositor structures. In workers, the sting is barbed, and tears away from the body when used. In both castes, the stinger is supplied with venom from glands in the abdomen. Males have much larger eyes than females, probably to help locate flying queens during mating flights.

There are currently 26 recognized subspecies of Apis mellifera, with differences based on differences in morphology and molecular characteristics. The differences among the subspecies is usually discussed in terms of their agricultural output in particular environmental conditions. Some subspecies have the ability to tolerate warmer or colder climates. Subspecies may also vary in their defensive behavior, tongue length, wingspan, and coloration. Abdominal banding patterns also differ - some darker and some with more of a mix between darker and lighter banding patterns.

Honeybees are partially endothermic -- they can warm their bodies and the temperature in their hive by working their flight muscles.

Range length: 10 to 20 mm.

Other Physical Features: endothermic ; ectothermic ; heterothermic ; bilateral symmetry ; venomous

Sexual Dimorphism: female larger; sexes shaped differently

  • Pinto, A., W. Rubink, R. Coulson, J. Patton, S. Johnston. 2004. Temporal pattern of africanization in a feral honeybee population from texas inferred from mitochondrial DNA. Evolution, 58/5: 1047-1055.
  • Seeley, T., R. Seeley, P. Akratanakul. 1982. Colony defense strategies of the honeybees in Thailand. Ecological Monographs, 52/1: 43-63.
  • Clarke, K., T. Rinderer, P. Franck, Q. Javier, B. Oldroyd. 2002. The africanization of honeybees (Apis mellifera L.) of the Yucatan: a study of a massive hybridization event across time. Evolution, 56/7: 1462-1474.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

1-2 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

European honeybees prefer habitats that have an abundant supply of suitable flowering plants, such as meadows, open wooded areas, and gardens. They can survive in grasslands, deserts, and wetlands if there is sufficient water, food, and shelter. They need cavities (e.g. in hollow trees) to nest in.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European honeybees prefer habitats that have an abundant supply of suitable flowering plants, such as meadows, open wooded areas, and gardens. They can survive in grasslands, deserts, and wetlands if there is sufficient water, food, and shelter. They need cavities (e.g. in hollow trees) to nest in.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Honey bees live in hives, which need to be close to good sources of pollen and nectar (4). Evidence of beekeeping using artificial hives can be traced to 5000 years ago in Egypt; however, natural hives do occasionally occur. Before they were domesticated, honey bees made their nests in hollow trees in woodlands. Occasionally, colonies may still become established in dead trees when they escape from a domesticated hive. The internal structure of the hive is built by the bees with wax (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Apis_mellifera feed on pollen and nectar collected from blooming flowers. They also eat honey (stored, concentrated nectar) and secretions produced by other members of their colony.

Workers forage for food (nectar and pollen) for the entire colony. They use their tongues to suck up nectar, and store it in the anterior section of the digestive tract, called the crop. They collect pollen by grooming it off the bodies and onto special structures on their hind legs called pollen baskets.

Returning foragers transfer the nectar they have collected to younger worker bees that in turn feed other members of the hive, or process it into honey for long-term storage. They add enzymes to the honey, and store it in open cells where the water can evaporate, concentrating the sugars.

Young workers eat pollen and nectar, and secrete food materials, called “royal jelly” and “worker jelly”, from glands in their heads. This material is fed to young larvae, and the amount and type they get determines if they will be queens or workers.

Honeybees forage during daylight hours, but are equally active on cloudy or sunny days. They will not fly in heavy rain or high winds, or if the temperature is too extreme (workers can't fly when they get below 10°C). During the warm, calm weather the honeybees collect the most pollen even if it is cloudy. If the light intensity changes rapidly, they immediately stop working and return to the hive. If it lightly rains, pollen collection stops, because moisture inhibits the bee’s ability to collect it. However, nectar collection is not inhibited by light rain. Wind also affects the rate of pollen collection.

Honeybee workers are opportunistic. They will steal from other hives if they can. Hive-robbing can be dangerous, but a weakened or damaged hive may be raided by workers from other hives, especially when nectar flows in flowers are not abundant. Honeybees will also collect “honeydew,” the sweet fluid excreted by sap-feeding insects like Aphididae.

Plant Foods: nectar; pollen; sap or other plant fluids

Foraging Behavior: stores or caches food

  • Gonzalez, A., C. Rowe, P. Weeks, D. Whittle, F. Gilbert, C. Barnard. 1995. Flower choice by honey bees (Apis mellifera L.): sex-phase of flowers and preferences among nectar and pollen foragers. Oecologia, 101/2: 258-264.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Apis mellifera feed on pollen and nectar collected from blooming flowers. They also eat honey (stored, concentrated nectar) and secretions produced by other members of their colony.

Workers forage for food (nectar and pollen) for the entire colony. They use their tongues to suck up nectar, and store it in the anterior section of the digestive tract, called the crop. They collect pollen by grooming it off the bodies and onto special structures on their hind legs called pollen baskets.

Returning foragers transfer the nectar they have collected to younger worker bees that in turn feed other members of the hive, or process it into honey for long-term storage. They add enzymes to the honey, and store it in open cells where the water can evaporate, concentrating the sugars.

Young workers eat pollen and nectar, and secrete food materials, called “royal jelly” and “worker jelly”, from glands in their heads. This material is fed to young larvae, and the amount and type they get determines if they will be queens or workers.

Honeybees forage during daylight hours, but are equally active on cloudy or sunny days. They will not fly in heavy rain or high winds, or if the temperature is too extreme (workers can't fly when they get below 10°C). During the warm, calm weather the honeybees collect the most pollen even if it is cloudy. If the light intensity changes rapidly, they immediately stop working and return to the hive. If it lightly rains, pollen collection stops, because moisture inhibits the bee’s ability to collect it. However, nectar collection is not inhibited by light rain. Wind also affects the rate of pollen collection.

Honeybee workers are opportunistic. They will steal from other hives if they can. Hive-robbing can be dangerous, but a weakened or damaged hive may be raided by workers from other hives, especially when nectar flows in flowers are not abundant. Honeybees will also collect “honeydew,” the sweet fluid excreted by sap-feeding insects like aphids.

Plant Foods: nectar; pollen; sap or other plant fluids

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Nectarivore )

  • Gonzalez, A., C. Rowe, P. Weeks, D. Whittle, F. Gilbert, C. Barnard. 1995. Flower choice by honey bees (Apis mellifera L.): sex-phase of flowers and preferences among nectar and pollen foragers. Oecologia, 101/2: 258-264.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Apis mellifera in Illinois

Apis mellifera Linnaeus: Apidae (Apinae), Hymenoptera
(observations are from Robertson, Graenicher, Reed, Betz et al., Baskin et al., Michener & Rettenmeyer, Bock & Peterson, Hilty, Evans, Petersen, Stephenson, Williams, Clinebell & Bernhardt, Clinebell, Smith & Snow, Catling, Bernhardt, Motten, Schemske et al., Stoutamire, Standley et al., Osborn & Schneider, Aspinwall & Christian, Luer, Lindsey, Willson & Bertin, Bertin, Estes & Thorp, Cane et al., Small, Reader, Cane & Schiffhauser, Todd et al., Macior, and Wist)

Acanthaceae: Justicia americana sn fq (Rb); Aceraceae: Acer negundo cp fq (Rb), Acer saccharum [oozing sap fq] (Rb); Alismataceae: Sagittaria latifolia [stam sn] [pist sn] (Rb); Amaranthaceae: Amaranthus spinosus cp fq (Rb); Anacardiaceae: Rhus copallina [pist sn fq] (Rb), Rhus glabra [pist sn fq] (Rb); Apiaceae: Cicuta maculata sn (Rb), Erigenia bulbosa sn cp fq (Rb, Gr), Eryngium yuccifolium sn (Rb), Heracleum maximum sn cp fq (Rb), Osmorhiza longistylis sn (Rb), Oxypolis rigidior sn (Rb), Pastinaca sativa sn (Rb), Polytaenia nuttalli sn (Rb), Sium suave sn (Rb), Taenidia integerrima sn (Rb), Thaspium barbinode (Lnd), Zizia aurea sn cp (Rb); Apocynaceae: Apocynum cannabinum [plpr sn] (Rb); Aquifoliaceae: Nemopanthus mucronatus (Sm); Asclepiadaceae: Asclepias amplexicaulis [plup sn] (Btz), Asclepias hirtella [plpr sn] (Rb), Asclepias incarnata [plpr sn fq] (Rb, Btz), Asclepias meadii [plup sn] (Btz), Asclepias purpurascens [plpr sn] (Rb, Btz), Asclepias sullivanti [plup sn fq] [dead] (Btz, Rb), Asclepias syriaca [unsp sn fq] [dead] (Btz, Rb), Asclepias tuberosa [plpr sn fq] (Rb, Btz), Asclepias verticillata [plpr sn] [plup sn fq] (Rb, Btz, WB); Asteraceae: Ageratina altissima sn cp fq (Rb, Gr), Ambrosia trifida cp fq (Rb), Antennaria neglecta [stam sn cp] (Gr, Ev), Antennaria plantaginifolia [stam sn] [pist sn] (Rb), Arctium lappa sn cp (Gr), Arctium minus sn (Rb), Arnoglossum muhlenbergii sn (Rb, Gr), Aster anomalus sn cp (Rb), Aster drummondii sn (Gr), Aster dumosus (Pt), Aster ericoides sn cp (Rb, Pt, Re), Aster furcatus sn (Rb), Aster laevis sn (Gr, Pt), Aster lanceolatus sn (Rb, Gr, H), Aster lateriflorus sn fq (Rb), Aster macrophyllus sn (Gr), Aster novae-angliae sn cp (Rb, Gr), Aster pilosus sn cp fq (Rb, H), Aster prenanthoides sn (Gr), Aster sagittifolius sn fq (Rb), Aster salicifolius sn (Rb), Aster turbinellus sn cp fq (Rb), Bidens aristosa sn (Rb), Bidens bipinnata sn cp fq (Rb), Bidens cernua sn fq (Rb), Bidens frondosa sn (Rb), Boltonia asterioides sn cp fq (Rb), Cirsium altissimum sn cp (Rb, Gr), Cirsium arvense sn cp (Gr), Conoclinium coelestinum sn (Rb), Coreopsis palmata sn cp (Rb), Coreopsis tripteris sn cp (Rb), Echinacea angustifolia (Ws), Echinacea pallida sn cp (Rb), Echinacea purpurea sn fq (Rb), Erechtites hieracifolia sn q (Rb), Erigeron philadelphicus sn (Rb), Erigeron strigosus sn (Rb), Eupatoriadelphus purpureus sn fq (Rb, Gr), Eupatorium altissimum sn fq (Rb, H), Eupatorium serotinum sn cp fq (Rb), Euthamia graminifolia sn cp fq (Rb), Helenium autumnale sn cp (Rb, Gr), Helianthus annuus sn cp fq (Rb), Helianthus divaricatus sn (Rb), Helianthus giganteus sn cp (Gr), Helianthus grosseserratus sn fq (Rb), Helianthus strumosus sn cp (Gr), Heliopsis helianthoides sn cp (Gr, Re), Krigia biflora sn cp fq (Rb), Lactuca floridana sn cp fq (Rb), Leucanthemum vulgare sn cp (Gr), Liatris pycnostachya sn fq (Rb, Cl), Oligoneuron rigidum sn (Rb, Ev, Re), Pseudognaphalium obtusifolium sn (Rb), Pyrrhopappus carolinianus cp (ET), Ratibida pinnata sn cp (Gr), Rudbeckia hirta sn (Rb, Ev), Rudbeckia laciniata sn cp fq (Rb, Gr), Rudbeckia subtomentosa sn (Rb), Rudbeckia triloba sn cp (Rb), Silphium integrifolium sn cp (Rb), Silphium laciniatum sn (Rb), Silphium perfoliatum sn cp fq (Rb), Silphium terebinthinaceum sn cp fq (Rb), Solidago canadensis sn cp fq (Rb, Gr, Pt, Re), Solidago juncea sn cp (Gr), Solidago missouriensis sn (Rb), Solidago nemoralis sn cp fq (Rb, Ev), Solidago speciosa sn fq (Rb, Re), Tanacetum vulgare sn (Gr), Taraxacum officinale sn cp fq (Rb), Verbesina alternifolia sn cp fq (Rb), Verbesina helianthoides sn cp fq (Rb), Vernonia fasciculata sn (Rb); Balsaminaceae: Impatiens capensis sn cp (Rb); Berberidaceae: Podophyllum peltatum cp (Rb); Bignoniaceae: Campsis radicans sn cp (Brt), Catalpa speciosa sn np (St); Boraginaceae: Mertensia virginica cp (Rb), Onosmodium molle (Wm); Brassicaceae: Arabis shortii sn cp fq (Rb), Capsella bursa-pastoris sn fq (Rb), Dentaria laciniata sn cp fq (Rb, Shm), Rorippa teres sn fq (Rb); Cabombaceae: Brasenia schreberi cp np (OS); Caesalpiniaceae: Chamaecrista fasciculata [flwr cp fq] (Rb), Gleditsia triacanthos sn cp fq (Rb); Campanulaceae: Campanulastrum americanum sn (Rb), Lobelia spicata sn (Rb); Caprifoliaceae: Lonicera oblongifolia sn (Gr), Lonicera reticulata sn (Gr), Sambucus canadensis cp fq (Rb), Symphoricarpos albus sn (Gr), Symphoricarpos occidentalis sn (Gr), Symphoricarpos orbiculatus sn fq (Rb), Viburnum prunifolium sn cp (Rb); Caryophyllaceae: Cerastium fontanum sn (Rb), Cerastium nutans sn fq (Rb), Stellaria media sn (Rb); Commelinaceae: Tradescantia ohiensis cp fq (Rb), Tradescantia virginiensis cp (Rb); Convolvulaceae: Ipomoea pandurata sn (Rb), Stylisma pickeringii pattersonii (TOC); Cornaceae: Cornus obliqua sn cp fq (Rb), Cornus racemosa sn cp fq (Rb); Cucurbitaceae: Cucurbita pepo sn cp fq (Rb), Echinocystis lobata [unsp sn] (Rb), Sicyos angulatus [unsp sn fq] (Rb); Ebenaceae: Diospyros virginiana [stam sn cp fq] [pist sn fq] (Rb); Ericaceae: Andromeda glaucophylla fq (Rd), Chamaedaphne calyculata sn fq (Rd), Gaylussacia baccata (Sm), Vaccinium macrocarpon sn cp fq (Rd, CS), Vaccinium myrtilloides sn fq (Sm, Rd), Vaccinium stamineum fq (Cn); Fabaceae: Astragalus canadensis sn (Rb), Astragalus tennesseenis sn (BBQ), Cercis canadensis sn cp fq (Rb), Dalea candida sn (Rb), Dalea purpurea sn cp fq (Rb), Melilotus alba sn fq (Rb, Re), Orbexilum onobrychis sn fq (Rb), Robinia pseudoacacia sn (Rb), Trifolium hybridum sn cp fq (Rb), Trifolium repens sn fq (Rb); Fumariaceae: Dicentra cucullaria cp fq np (Rb); Gentianaceae: Frasera caroliniensis sn fq (Rb); Geraniaceae: Geranium maculatum sn (Rb); Grossulariaceae: Ribes cynosbati sn (Gr), Ribes missouriense sn cp fq np (Rb); Hydrophyllaceae: Hydrophyllum appendiculatum sn cp fq (Rb), Polemonium reptans sn cp fq (Rb); Lamiaceae: Agastache foeniculum (Re), Agastache neptoides sn fq (Rb), Agastache scrophulariaefolia sn fq (Rb), Blephilia ciliata sn fq (Rb), Blephilia hirsuta sn fq (Rb), Glechoma hederacea sn fq (Rb), Lycopus americanus sn fq (Rb), Marrubium vulgare sn fq (Rb), Monarda bradburiana sn fq (Rb), Monarda fistulosa sn@prf cp np (Rb, Ev, Re, Cl), Nepeta cataria sn fq (Rb, Re), Pycnanthemum pilosum sn fq (Rb), Pycnanthemum tenuifolium sn fq (Rb), Pycnanthemum virginianum sn fq (Rb), Teucrium canadense sn cp fq (Rb); Liliaceae: Allium cernuum sn (Gr), Allium tricoccum sn (Gr), Asparagus officinalis sn (Rb), Camassia scilloides sn fq (Rb), Erythronium albidum sn cp fq (Rb, Shm), Erythronium mesochoreum (MR), Polygonatum pubescens sn (Gr), Smilacina racemosa cp (Rb), Smilacina stellata sn (Gr), Tofieldia glutinosa sn (Gr); Lythraceae: Lythrum alatum sn fq (Rb); Malvaceae: Abutilon theophrastii sn (Rb), Malva neglecta sn fq (Rb); Mimosaceae: Schrankia nuttallii cp (Bht); Nelumbonaceae: Nelumbo lutea cp fq (Rb); Oleaceae: Fraxinus americanus cp fq (Rb); Onagraceae: Gaura biennis sn cp (Rb), Ludwigia peploides glabrescens sn cp (ET), Oenothera biennis sn cp fq (Rb); Orchidaceae: Calopogon tuberosus exp (Lu), Cypripedium pubescens exp (Stm), Platanthera blephariglottis sn (SS), Spiranthes vernalis sn (Ct); Oxalidaceae: Oxalis corniculata sn (Rb), Oxalis violacea sn (Rb); Papaveraceae: Sanguinaria canadensis cp fq (Rb, Shm, Mtt); Parnassiaceae: Parnassia glauca sn (Gr); Phytolaccaceae: Phytolacca americana sn (Rb); Poaceae: Zea mays cp np (Rb); Polygonaceae: Persicaria hydropiperoides sn (Rb), Persicaria pensylvanica sn cp (Rb, H), Persicaria punctata sn (Rb); Portulacaceae: Claytonia virginica sn cp fq (Rb, Shm, Mtt); Pyrolaceae: Chimaphila maculata sn (Std); Ranunculaceae: Anemone patens multifida cp (BP), Anemonella thalictroides sn (Rb), Aquilegia canadensis sn cp (Mc), Clematis virginiana [stam sn] (Rb), Enemion biternatum cp fq (Rb, Shm), Hepatica acutiloba cp fq (Rb), Hepatica americana cp (Mtt), Ranunculus abortivus sn (Rb), Ranunculus fascicularis sn (Rb), Thalictrum dasycarpum cp np (Rb); Rhamnaceae: Rhamnus lanceolata sn (Rb); Rosaceae: Amelanchier arborea sn cp fq (Rb), Crataegus crus-galli sn cp fq (Rb), Crataegus intricata sn cp fq (Rb), Crataegus mollis sn cp fq (Rb), Filipendula rubra cp fq (AC), Fragaria virginiana sn (Rb), Malus coronaria sn fq (Rb), Prunus americana sn cp fq (Rb), Prunus serotina [flwr sn cp fq] (Rb), Rosa setigera cp fq (Rb), Rubus allegheniensis sn cp fq (Rb), Rubus flagellaris sn fq (Rb, Ev), Rubus occidentalis sn fq (Rb); Rubiaceae: Cephalanthus occidentalis sn fq (Rb), Houstonia lanceolata sn (Rb), Houstonia longifolia sn (Ev); Rutaceae: Ptelea trifoliata sn cp fq (Rb), Zanthoxylum americanum [stam sn cp fq] [pist sn fq] (Rb); Salicaceae: Populus deltoides cp fq (Rb), Populus tremuloides cp fq (Rb), Salix amygdaloides [stam sn cp fq] [pist sn fq] (Rb), Salix discolor [unsp sn] (Gr), Salix fragilis (Sm), Salix humilis [stam cp] [pist sn fq] (Rb), Salix interior [stam sn] (Rb), Salix nigra [stam sn cp fq] (Rb), Salix rigida [stam sn cp fq] [pist sn fq] (Rb); Santalaceae: Comandra umbellata sn (Rb); Saxifragaceae: Saxifraga pensylvanica sn (Gr); Scrophulariaceae: Agalinis tenuifolia sn cp fq (Rb), Collinsia verna sn cp fq (Rb), Dasistoma macrophylla sn (Rb), Linaria vulgaris sn cp np (Rb), Penstemon digitalis sn (Rb), Penstemon pallidus sn (CB), Scrophularia marilandica sn fq (Rb), Tomanthera auriculata sn (Rb), Verbascum thapsus cp (Rb), Veronicastrum virginicum sn fq (Rb, Cl); Smilacaceae: Smilax herbacea [stam cp] (Rb), Smilax tamnoides hispida sn cp (Rb); Solanaceae: Datura stramonium tatula cp fq np (Rb); Staphyleaceae: Staphylea trifolia sn cp fq (Rb); Tiliaceae: Tilia americana sn fq (Rb); Ulmaceae: Ulmus americana cp fq (Rb), Ulmus rubra cp fq (Rb); Verbenaceae: Verbena hastata sn fq (Rb, Re), Verbena stricta sn fq (Rb, Re), Verbena urticifolia sn (Rb); Violaceae: Viola cucullata sn (Rb), Viola pedata sn (Rb), Viola striata sn np (Rb); Vitaceae: Vitis vulpina cp (Rb)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acarapis woodi endoparasitises trachaea of adult of Apis mellifera

Animal / kleptoparasite
larva of Achroia grisella kleptoparasitises wax of Apis mellifera

Animal / pathogen
Acute Bee Paralysis virus (ABPV or APV) infects Apis mellifera

Plant / pollenated
worker of Apis mellifera pollenates or fertilises flower of Epipactis palustris

Animal / pathogen
Ascosphaera apis infects dead, white, 'chalky' larva of Apis mellifera

Animal / pathogen
Aspergillus flavus infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Aspergillus dematiaceous anamorph of Aspergillus fumigatus infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Aspergillus niger infects dead, mummified, black, hard brood of Apis mellifera

Animal / pathogen
Black Queen Cell virus (BQCV) infects dead, black larva (queen) of Apis mellifera

Animal / guest
Braula coeca is a guest in nest of Apis mellifera

Animal / pathogen
Chronic Paralysis virus infects Apis mellifera

Animal / pathogen
Cloudy Wing virus infects Apis mellifera

Animal / pathogen
Deformed Wing virus infects deformed abdomen of adult of Apis mellifera

Animal / guest
Dufouriellus ater is a guest in nest of Apis mellifera

Animal / kleptoparasite
larva of Galleria mellonella kleptoparasitises wax of Apis mellifera

Animal / pathogen
Israel Acute Paralysis virus (IAPV) infects Apis mellifera

Animal / pathogen
Kakugo virus infects mushroom body of adult (gaurd bee) of Apis mellifera

Animal / pathogen
Kashmir Bee virus (KBV) infects Apis mellifera

Animal / pathogen
Malpighamoeba mellificae infects gut of adult of Apis mellifera

Animal / parasite / endoparasite
Melissococcus plutonius endoparasitises mid-gut of larva of Apis mellifera

Animal / pathogen
Morator aetatulas infects dead, black, upright larva (capped) of Apis mellifera

Animal / pathogen
Nosema apis infects gut of adult of Apis mellifera

Animal / pathogen
Paenibacillus larvae ssp. larvae infects gut of larva of Apis mellifera

Animal / predator / stocks nest with
female of Philanthus triangulum stocks nest with Apis mellifera
Other: sole host/prey

Animal / parasite / ectoparasite / blood sucker
Varroa destructor sucks the blood of pupa of Apis mellifera

Animal / parasite / ectoparasite / blood sucker
Varroa jacobsoni sucks the blood of pupa of Apis mellifera

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Honeybees are very important pollinators, and are the primary pollinator for many plants. Without honeybees, these plants have greatly reduced fertility. In North America and Australia, where there are no native bee species with large colonies, honeybees can have especially strong effects on native flowers, and on other pollinators such as solitary bee species. Honeybees ability to recruit fellow workers by “dancing” allows them to be more efficient than other pollinators at exploiting patches of flowers. This can create strong impacts on their competitors, especially solitary bees.

Like all social insects, honeybees are hosts to a variety of parasites, commensal organisms, and pathogenic microbes. Some of these can be serious problems for apiculture, and have been studied intensively. At least 18 types of viruses have been found to cause disease in bees, including Sacbrood disease. Several of them (but not sacbrood virus) are associated with parasitic mites. Bacteria infect bees, notably Bacillus_larvae, agent of American Foulbrood disease, and Melissococcus_pluton, agent of European Foulbrood. Fungi grow in bee hives, and Ascosphaera_apis can cause Chalkbrood disease. One of the most common diseases in domesticated hives is Nosema disease, caused by a protozoan, Nosema_apis. An amoeba, Malphigamoeba_mellificae, also causes disease in honeybees.

In recent decades, two mite species have spread through domesticated and feral honeybee populations around the world. Acarapis_woodi is a small mite species that lives in the tracheae of adult bees and feeds on bee hemolymph. It was first discovered in Europe, but its origin is unknown. Infestations of these mites weaken bees, and in cold climates, whole colonies may fail when the bees are confined in the hive during the winter. A much worse threat is Varroa_destructor. This might evolved on an Asian honeybee, Apis_cerana, but switched on to Apis_mellifera colonies that were set up in east Asia. It has since spread all around the world, except Australia. Juvenile mites feed on bee larvae and pupae, and adult female mites feed and disperse on adult workers. This mite is known to spread several viruses as well. Infestations of V. destructor often wipe out colonies. Nearly all the feral, untended honeybee colonies in North American are believed to have been wiped out by mite infestations, along with a large proportion of domesticated colonies. Other mite species are known from honeybee colonies, but they are not considered harmful.

Another commensal or parasitic species is Braula_coeca, the bee louse. Despite the common name, this is actually a wingless fly, that apparently feeds by intercepting food being transferred from one bee to another.

Beetles in the genera Hylostoma and Aethina are found in African honeybee nests, where they seem to do little harm. However, the "small hive beetle", Aethina_tumida, has become a significant problem in European and North American hives. The larvae eat all the contents of comb: honey, pollen, and bee eggs and larvae.

Ecosystem Impact: pollinates; keystone species

Commensal/Parasitic Species:

  • Melissococcus_pluton (agent of European Foulbrood)
  • Ascophaera_apis (agent of Chalkbrood)
  • honey bee tracheal mite Acarapis_woodi 
  • a wax moth Galleria_mellonella 
  • a wax moth Achroia_grisella 
  • the small hive beetle Aethina_tumida 
  • Varroa_destructor
  • bee louse Braula_coeca 
  • large hive beetles Hylostoma 
  • small hive beetles Aethina 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Honeybees have many adaptations for defense: Adults have orange and black striping that acts as warning coloration. Predators can learn to associate that pattern with a painful sting, and avoid them. Honeybees prefer to build their hives in protected cavities (small caves or tree hollows). They seal small openings with a mix of wax and resins called propolis, leaving only one small opening. Worker bees guard the entrance of the hive. They are able to recognize members of their colony by scent, and will attack any non-members that try to enter the hive.  Workers and queens have a venomous sting at the end of the abdomen. Unlike queens, and unusual among stinging insects, the stings of Apis workers are heavily barbed and the sting and venom glands tear out of the abdomen, remaining embedded in the target. This causes the death of the worker, but may also cause a more painful sting, and discourage the predator from attacking other bees or the hive. A stinging worker releases an alarm pheromone which causes other workers to become agitated and more likely to sting, and signals the location of the first sting.

Honeybees are subject to many types of predators, some attacking the bees themselves, others consuming the wax and stored food in the hive. Some predators are specialists on bees, including honeybees.

Important invertebrate enemies of adult bees include Thomisidae and Araneidae, wasps in the genus Philanthus (called “beewolves”), and many species of social wasps in the family Vespidae. Vespid wasp colonies are known to attack honeybee colonies en masse, and can wipe out a hive in one attack. Many vertebrate insectivores also eat adult honeybees. Toads (Bufo) that can reach the entrance of hive will sit and eat many workers, as will opossums (Didelphis). Birds are an important threat – the Meropidae (bee-eaters) in particular in Africa and southern Europe, but also flycatchers around the world (Tyrranidae and Muscicapidae). Apis_mellifera in Africa are also subject to attack by Indicatoridae. These birds eat hive comb, consuming bees, wax, and stored honey. At least one species, the greater honeyguide (Indicator_indicator) will guide mammal hive predators to hives, and then feed on the hive after the mammal has opened it up.

The main vertebrate predators of hives are mammals. Ursidae frequently attack the nests of social bees and wasps, as do many Mustelidae such as the Eira barbara in the Neotropics and especially the Mellivora capensis of Africa and southern and western Asia. In the Western Hemisphere Mephitidae, Cingulata and Vermilingua also raid hives, as do pangolins (Manis) in Africa. Large primates, including Papio, chimpanzees (<>) and Gorilla are reported to attack hives too. Smaller mammals such as mice (Mus) and rats (Rattus) will burrow into hives as well.

Some insects are predators in hives as well, including wax moth larvae (Galleria_mellonella, Achroia_grisella), and hive beetles (Hylostoma, Aethina), and some species of Formicidae. In their native regions these tend not to be important enemies, but where honeybees have not co-evolved with these insects and have no defense, they can do great harm to hives.

See Ecosystem Roles section for information on honeybee parasites and pathogens.

Known Predators:

  • Beewolves (Philanthus)
  • Crab spiders (Thomisidae)
  • vespid wasps (Vespidae)
  • bee-eaters (Meropidae)
  • honeyguides (Indicatoridae)
  • bears (Ursidae)
  • honey badgers (Mellivora_capensis)
  • skunks (Mephitidae)
  • toads (Bufo)

Anti-predator Adaptations: aposematic

  • Roubik, D. 1989. Ecology and natural history of tropical bees. New York City, New York, USA: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Honeybees are very important pollinators, and are the primary pollinator for many plants. Without honeybees, these plants have greatly reduced fertility. In North America and Australia, where there are no native bee species with large colonies, honeybees can have especially strong effects on native flowers, and on other pollinators such as solitary bee species. Honeybees ability to recruit fellow workers by “dancing” allows them to be more efficient than other pollinators at exploiting patches of flowers. This can create strong impacts on their competitors, especially solitary bees.

Like all social insects, honeybees are hosts to a variety of parasites, commensal organisms, and pathogenic microbes. Some of these can be serious problems for apiculture, and have been studied intensively. At least 18 types of viruses have been found to cause disease in bees, including Sacbrood disease. Several of them (but not sacbrood virus) are associated with parasitic mites. Bacteria infect bees, notably Bacillus larvae, agent of American Foulbrood disease, and Melissococcus pluton, agent of European Foulbrood. Fungi grow in bee hives, and Ascosphaera apis can cause Chalkbrood disease. One of the most common diseases in domesticated hives is Nosema disease, caused by a protozoan, Nosema apis. An amoeba, Malphigamoeba mellificae, also causes disease in honeybees.

In recent decades, two mite species have spread through domesticated and feral honeybee populations around the world. Acarapis woodi is a small mite species that lives in the tracheae of adult bees and feeds on bee hemolymph. It was first discovered in Europe, but its origin is unknown. Infestations of these mites weaken bees, and in cold climates, whole colonies may fail when the bees are confined in the hive during the winter. A much worse threat is Varroa destructor. This might evolved on an Asian honeybee, Apis cerana, but switched on to Apis mellifera colonies that were set up in east Asia. It has since spread all around the world, except Australia. Juvenile mites feed on bee larvae and pupae, and adult female mites feed and disperse on adult workers. This mite is known to spread several viruses as well. Infestations of V. destructor often wipe out colonies. Nearly all the feral, untended honeybee colonies in North American are believed to have been wiped out by mite infestations, along with a large proportion of domesticated colonies. Other mite species are known from honeybee colonies, but they are not considered harmful.

Another commensal or parasitic species is Braula coeca, the bee louse. Despite the common name, this is actually a wingless fly, that apparently feeds by intercepting food being transferred from one bee to another.

Beetles in the genera Hylostoma and Aethina are found in African honeybee nests, where they seem to do little harm. However, the "small hive beetle", Aethina tumida, has become a significant problem in European and North American hives. The larvae eat all the contents of comb: honey, pollen, and bee eggs and larvae.

Ecosystem Impact: pollinates; keystone species

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Honeybees have many adaptations for defense: Adults have orange and black striping that acts as warning coloration. Predators can learn to associate that pattern with a painful sting, and avoid them. Honeybees prefer to build their hives in protected cavities (small caves or tree hollows). They seal small openings with a mix of wax and resins called propolis, leaving only one small opening. Worker bees guard the entrance of the hive. They are able to recognize members of their colony by scent, and will attack any non-members that try to enter the hive.  Workers and queens have a venomous sting at the end of the abdomen. Unlike queens, and unusual among stinging insects, the stings of Apis workers are heavily barbed and the sting and venom glands tear out of the abdomen, remaining embedded in the target. This causes the death of the worker, but may also cause a more painful sting, and discourage the predator from attacking other bees or the hive. A stinging worker releases an alarm pheromone which causes other workers to become agitated and more likely to sting, and signals the location of the first sting.

Honeybees are subject to many types of predators, some attacking the bees themselves, others consuming the wax and stored food in the hive. Some predators are specialists on bees, including honeybees.

Important invertebrate enemies of adult bees include crab spiders and orb-weaver spiders, wasps in the genus Philanthus (called “beewolves”), and many species of social wasps in the family Vespidae. Vespid wasp colonies are known to attack honeybee colonies en masse, and can wipe out a hive in one attack. Many vertebrate insectivores also eat adult honeybees. Toads (Bufo) that can reach the entrance of hive will sit and eat many workers, as will opossums (Didelphis). Birds are an important threat – the Meropidae (bee-eaters) in particular in Africa and southern Europe, but also flycatchers around the world (Tyrranidae and Muscicapidae). Apis mellifera in Africa are also subject to attack by honeyguides. These birds eat hive comb, consuming bees, wax, and stored honey. At least one species, the greater honeyguide (Indicator indicator) will guide mammal hive predators to hives, and then feed on the hive after the mammal has opened it up.

The main vertebrate predators of hives are mammals. Bears frequently attack the nests of social bees and wasps, as do many mustelids such as the tayra in the Neotropics and especially the honey badger of Africa and southern and western Asia. In the Western Hemisphere skunks, armadillos and anteaters also raid hives, as do pangolins (Manis) in Africa. Large primates, including baboons, chimpanzees (<>) and gorillas are reported to attack hives too. Smaller mammals such as mice (Mus) and rats (Rattus) will burrow into hives as well.

Some insects are predators in hives as well, including wax moth larvae (Galleria mellonella, Achroia grisella), and hive beetles (Hylostoma, Aethina), and some species of ants. In their native regions these tend not to be important enemies, but where honeybees have not co-evolved with these insects and have no defense, they can do great harm to hives.

See Ecosystem Roles section for information on honeybee parasites and pathogens.

Known Predators:

Anti-predator Adaptations: aposematic

  • Roubik, D. 1989. Ecology and natural history of tropical bees. New York City, New York, USA: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Apis_mellifera communication is based on chemical signals, and most of their communication and perception behaviors are centered around scent and taste. The members of the hive colony are bound chemically to each other. Each hive has a unique chemical signature that hivemates use to recognize each other and detect bees from other colonies.

Within the hive, bees are in constant chemical communication with each other. Workers feed and groom each other, as well as larvae, drones, and the queen. In the process they pass on pheromones, chemical signals that indicate information about the health of the queen and the state of the colony.

Chemicals not only help with detecting the right signature of hives but also with foraging. Honeybees use scent to locate flowers from a distance. When a successful forager returns to the hive, it passes the scent of the flowers to its nest mates, to help them find the same patch of flowers.

Bees also use chemicals to signal outside the hive. When a worker stings something, her stinger releases an alarm pheromone that causes other bees to become agitated, and helps them locate the enemy.

Thought it's always dark in the hive, vision is important to honeybees outside. They can see other animals, and recognize flowers. The eyes of Apis species can detect ultraviolet light wavelengths that are beyond the visible spectrum. This allows them to locate the sun on cloudy days, and see markings on flowers that are only visible in ultraviolet light. One portion of honeybee's eyes is sensitive to polarized light, and they use this to navigate.

Workers and queens can hear vibrations. New queens call to each other and workers when they first emerge. Workers hear the vibrations of the waggle dances made by returning foragers.

Apis species have a particularly notable form of communication called "dancing." Foragers that have located an abundant supply of food do a dance to communicate the location of the patch to other foragers. A "round dance" indicates food within about 300 meters of the hive, and only communicates the presence of the flowers, not the direction, though workers will also get the scent from the food the forager has brought back. The more complicated "waggle dance" indicates the direction and distance of food further away, using the location of the sun and the bee's memory of the distance it flew to return to the hive. Symbolic communication is quite unusual among invertebrates, and these honeybee "dances" have been intensively studied.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: visual ; ultraviolet; polarized light ; tactile ; acoustic ; chemical

  • Sandoz, C., M. Hammer, R. Menzel. 2002. Side specificity of olfactory learning in the honeybee: US input side. Learning and Memory, 9: 337-348.
  • Reinhard, J., M. Srinivasan, S. Zhang. 2004. Scent-triggered navigation in honeybees. Nature, 427: 411.
  • Sherman, G., K. Visscher. 2002. Honeybee colonies achieve fitness through dancing. Nature, 419: 920-922.
  • Breed, M., L. Butler, T. Stiller. 1985. Kin discrimination by worker honey bees in genetically mixed groups. Proceedings of the National Academy of Sciences of the United States of America, 82/9: 3058-3061.
  • Roat, T., C. Landim. 2008. Temporal and morphological differences in post-embryonic differentiation of the mushroom bodies in the brain of workers, queens and drones of Apis mellifera (Hymenoptera: Apidae). Micron, 39: 1171-1178.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Apis mellifera communication is based on chemical signals, and most of their communication and perception behaviors are centered around scent and taste. The members of the hive colony are bound chemically to each other. Each hive has a unique chemical signature that hivemates use to recognize each other and detect bees from other colonies.

Within the hive, bees are in constant chemical communication with each other. Workers feed and groom each other, as well as larvae, drones, and the queen. In the process they pass on pheromones, chemical signals that indicate information about the health of the queen and the state of the colony.

Chemicals not only help with detecting the right signature of hives but also with foraging. Honeybees use scent to locate flowers from a distance. When a successful forager returns to the hive, it passes the scent of the flowers to its nest mates, to help them find the same patch of flowers.

Bees also use chemicals to signal outside the hive. When a worker stings something, her stinger releases an alarm pheromone that causes other bees to become agitated, and helps them locate the enemy.

Thought it's always dark in the hive, vision is important to honeybees outside. They can see other animals, and recognize flowers. The eyes of Apis species can detect ultraviolet light wavelengths that are beyond the visible spectrum. This allows them to locate the sun on cloudy days, and see markings on flowers that are only visible in ultraviolet light. One portion of honeybee's eyes is sensitive to polarized light, and they use this to navigate.

Workers and queens can hear vibrations. New queens call to each other and workers when they first emerge. Workers hear the vibrations of the waggle dances made by returning foragers.

Apis species have a particularly notable form of communication called "dancing." Foragers that have located an abundant supply of food do a dance to communicate the location of the patch to other foragers. A "round dance" indicates food within about 300 meters of the hive, and only communicates the presence of the flowers, not the direction, though workers will also get the scent from the food the forager has brought back. The more complicated "waggle dance" indicates the direction and distance of food further away, using the location of the sun and the bee's memory of the distance it flew to return to the hive. Symbolic communication is quite unusual among invertebrates, and these honeybee "dances" have been intensively studied.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: visual ; ultraviolet; polarized light ; tactile ; acoustic ; chemical

  • Sandoz, C., M. Hammer, R. Menzel. 2002. Side specificity of olfactory learning in the honeybee: US input side. Learning and Memory, 9: 337-348.
  • Reinhard, J., M. Srinivasan, S. Zhang. 2004. Scent-triggered navigation in honeybees. Nature, 427: 411.
  • Sherman, G., K. Visscher. 2002. Honeybee colonies achieve fitness through dancing. Nature, 419: 920-922.
  • Breed, M., L. Butler, T. Stiller. 1985. Kin discrimination by worker honey bees in genetically mixed groups. Proceedings of the National Academy of Sciences of the United States of America, 82/9: 3058-3061.
  • Roat, T., C. Landim. 2008. Temporal and morphological differences in post-embryonic differentiation of the mushroom bodies in the brain of workers, queens and drones of Apis mellifera (Hymenoptera: Apidae). Micron, 39: 1171-1178.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Honeybees build a hive out of wax secretions from their bodies, and queens lay their eggs in cells in the wax. The speed of subsequent development of the young is strongly affected by temperature, and is fastest at 33-36°C.

Honeybees are holometabolous insects, and have four stages in the life cycle: egg, larva, pupa, and adult.

A. mellifera eggs hatch in 28-144 hours, depending on their temperature. The larva that emerges is a small white grub. It stays in its wax cell, growing, and is fed and groomed by adult workers. The food that a female larva receives determines whether it will be a queen or worker. At 34°C, larvae feed and grow for 4-5 days, queens for 6 days, and males for 6-7 days. At the end of that period their cell is sealed by adult workers, and the larva molts, spins a silk cocoon, and transforms into the pupa stage. Pupae undergo a massive metamorphosis that takes about 7-8 days for queens, 12 days for workers, and 14-15 days for males. Once their final metamorphosis is complete, they chew their way out of the cell and begin their adult life. They will not grow or molt after emerging. Adult workers will live for 2-4 weeks in the summer, or as long as 11 months if they live through the winter. Males only survive for 4-8 weeks, and do not live through the winter. Queens live 2-5 years.

. The next stage is the larval stage where the larva is fed the royal jelly, pollen/nectar, and honey combination. Next the larva goes into the pupae stage where it caps itself into its cell to metamorphose into the mature stage.

Queens normally take 16 days to reach maturity, the worker bees take 21 days, and the drone takes 24 days to mature.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Honeybees build a hive out of wax secretions from their bodies, and queens lay their eggs in cells in the wax. The speed of subsequent development of the young is strongly affected by temperature, and is fastest at 33-36°C.

Honeybees are holometabolous insects, and have four stages in the life cycle: egg, larva, pupa, and adult.

A. mellifera eggs hatch in 28-144 hours, depending on their temperature. The larva that emerges is a small white grub. It stays in its wax cell, growing, and is fed and groomed by adult workers. The food that a female larva receives determines whether it will be a queen or worker. At 34°C, larvae feed and grow for 4-5 days, queens for 6 days, and males for 6-7 days. At the end of that period their cell is sealed by adult workers, and the larva molts, spins a silk cocoon, and transforms into the pupa stage. Pupae undergo a massive metamorphosis that takes about 7-8 days for queens, 12 days for workers, and 14-15 days for males. Once their final metamorphosis is complete, they chew their way out of the cell and begin their adult life. They will not grow or molt after emerging. Adult workers will live for 2-4 weeks in the summer, or as long as 11 months if they live through the winter. Males only survive for 4-8 weeks, and do not live through the winter. Queens live 2-5 years.

. The next stage is the larval stage where the larva is fed the royal jelly, pollen/nectar, and honey combination. Next the larva goes into the pupae stage where it caps itself into its cell to metamorphose into the mature stage.

Queens normally take 16 days to reach maturity, the worker bees take 21 days, and the drone takes 24 days to mature.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European honey bees are social insects with a hive typically consisting of a single queen, between 6,000 and 60,000 workers, and a few hundred to a few thousand drones. Upon hatching in the spring, the queen bee destroys all unhatched queens, kills any hatched queens, and takes a mating flight where she mates with several males. The queen stores the sperm and uses it throughout her life to fertilize eggs. After returning from her mating flight, the queen begins to lay eggs and continues to do so throughout the summer. Three days after being laid, an egg hatches into a worm-like larva. The larva then molts each day for four days into a pupa. The pupa goes into a resting stage for a few days and emerges as an adult honey bee.

New European honey bee hives are created by swarming - the original queen and several thousand workers will leave the nest, typically in May or June but sometimes in September or October, and seek a new location in which to build a wax comb hive. The swarm will cluster on a branch near the original nest while scouts locate a suitable nesting site. This process can take a few hours or days. A honey bee colony can survive for up to several years.

  • Honey Bee (AgriLIFE Extension, Texas A & M System)
  • University of Georgia Honey Bee Program (University of Georgia)
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees (R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service)
  • Stinging Insects: Honey Bees (K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program)
  • Pollination and Honey Bees (R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005)
  • Honeybee Biology (Ross E. Koning, Plant Physiology Website, 1994)
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Apis_mellifera queens usually live 2 to 3 years, but some have been known to last for 5 years. Workers typically only live for a few weeks, sometimes a few months if their hive becomes dormant in winter. Males live for 4-8 weeks at the most.

Typical lifespan

Status: wild:
2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Apis mellifera queens usually live 2 to 3 years, but some have been known to last for 5 years. Workers typically only live for a few weeks, sometimes a few months if their hive becomes dormant in winter. Males live for 4-8 weeks at the most.

Typical lifespan

Status: wild:
2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8 years Observations: As in other social insects, workers and queens have distinct lifespans in the honey bee. Queens have been reported to live up to 8 years. Workers have a short lifespan due to foraging but can live 0.2-0.4 years if prevented from foraging. In the winter, workers can develop into a stress-resistant form called the "diunitus" and live up to 0.9 years (Haddad et al. 2007).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The great majority of female A. mellifera in a hive are sterile workers. Only queens mate and lay eggs. Normally there is only a single reproductive queen in a hive.

During periods of suitably mild weather in spring and summer, males leave the hive and gather at "drone assembly areas" near the hive. Virgin queens will fly through these areas, attracting the males with pheromones. The males pursue, and attempt to mate with the queen in flight. Sometimes a "comet" forms, as a cluster of males forms around the female, with a string of other males trying to catch up. Each male who succeeds in mating drops away, and dies within a few hours or days. Males who do not mate will continue to loiter in the assembly areas until they mate or die trying. Queens will mate with up to 10 males in a single flight.

Queens may mate with males from their own hive, or from other hives in the area. The queen's mating behavior is centered around finding the best place to mate beforehand, by taking directional flights for a period of time, lasting no more than a couple of days. Afterward, she leaves the hive and flies to mate with drones in an assembly area. This normally starts to occur after their first week of birth. The queen does this up to four times. After this congregate of mating has occurred, she never mates again in her lifetime.

Mating System: polyandrous ; eusocial

Apis_mellifera queens are the primary reproducers of the nest and all of the activities of the colony are centered around their reproductive behaviors and their survival. The queen is the only fertile female in the colony. She lays eggs nearly continuously throughout the year, sometimes pausing in late fall in cold climates. A particularly fertile queen may lay as many as 1,000 eggs/day, and 200,000 eggs in her lifetime. It takes a queen about 16 days to reach adulthood, and another week or more to begin laying eggs. Males take about 24 days to emerge as adults, and begin leaving the nest for assembly areas a few days after that.

Queen honeybees can control whether or not an egg they lay is fertilized. Unfertilized eggs develop as males and are haploid (have only one set of chromosomes). Fertilized eggs are diploid (two sets of chromosomes) and develop as workers or new queens, depending on how they are fed as larvae. Queens may increase the ratio of male to female eggs they lay if they are diseased or injured, or in response to problems in the colony.

Healthy, well-fed honeybee colonies reproduce by "swarming." The workers in the colony begin by producing numerous queen larvae. Shortly before the new queens emerge, the resident, egg-laying queen leaves the hive, taking up to half the workers with her. This "swarm" forms a temporary group in a tree nearby, while workers scout for a suitable location for a new hive. Once they find one, the swarm moves into the space, and begins building comb and starting the process of food collection and reproduction again.

Meanwhile at the old hive, the new queens emerge from their cells. If the population of workers is large enough, and there are few queens emerging, then the first one or two may leave with "afterswarms" of workers. After the swarming is completed, any remaining new queens try to sting and kill each other, continuing to fight until all but one is dead. After her competition is removed, the surviving queen begins to lay eggs.

Normally the pheromones secreted by a healthy queen prevent workers from reproducing, but if a colony remains queenless for long, some workers will begin laying eggs. These eggs are unfertilized, and so develop as males.

Breeding interval: Colonies typically swarm once or twice a year, usually at the beginning of the season that provides the most nectar.

Breeding season: Late spring until the winter months

Range eggs per season: 60,000 to 80,000.

Average gestation period: 3 days.

Range age at sexual or reproductive maturity (female): 15 to 17 days.

Average age at sexual or reproductive maturity (male): 24 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; induced ovulation ; fertilization (Internal ); oviparous ; sperm-storing

As in most eusocial insects, the offspring of fertile females (queens) are cared for other members of the colony. In honeybees, the caretakers are sterile females, daughters of the queen, called workers.

Workers build and maintain the comb where young bees are raised, gather food (nectar and pollen) feed and tend larvae, and defend the hive and its young from predators and parasites.

Young queens inherit their hive from their mothers. Often several new queens emerge after the old queen leaves with a swarm to found a new colony. The new queens fight for control of the hive, and only one survives the conflict.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Adjare, S. 1990. Beekeeping in Africa. Rome, Italy: Food and Agriculture Organisation of the United Nations. Accessed November 06, 2008 at http://www.fao.org/docrep/t0104e/T0104E00.htm.
  • Tarpy, D., R. Page Jr.. 2000. No behavior control over mating frequency in queen honeybees (Apis mellifera L.): implications for the evolution of extreme polyandry. The American Naturalist, 155/6: 820-827.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The great majority of female A. mellifera in a hive are sterile workers. Only queens mate and lay eggs. Normally there is only a single reproductive queen in a hive.

During periods of suitably mild weather in spring and summer, males leave the hive and gather at "drone assembly areas" near the hive. Virgin queens will fly through these areas, attracting the males with pheromones. The males pursue, and attempt to mate with the queen in flight. Sometimes a "comet" forms, as a cluster of males forms around the female, with a string of other males trying to catch up. Each male who succeeds in mating drops away, and dies within a few hours or days. Males who do not mate will continue to loiter in the assembly areas until they mate or die trying. Queens will mate with up to 10 males in a single flight.

Queens may mate with males from their own hive, or from other hives in the area. The queen's mating behavior is centered around finding the best place to mate beforehand, by taking directional flights for a period of time, lasting no more than a couple of days. Afterward, she leaves the hive and flies to mate with drones in an assembly area. This normally starts to occur after their first week of birth. The queen does this up to four times. After this congregate of mating has occurred, she never mates again in her lifetime.

Mating System: polyandrous ; eusocial

Apis mellifera queens are the primary reproducers of the nest and all of the activities of the colony are centered around their reproductive behaviors and their survival. The queen is the only fertile female in the colony. She lays eggs nearly continuously throughout the year, sometimes pausing in late fall in cold climates. A particularly fertile queen may lay as many as 1,000 eggs/day, and 200,000 eggs in her lifetime. It takes a queen about 16 days to reach adulthood, and another week or more to begin laying eggs. Males take about 24 days to emerge as adults, and begin leaving the nest for assembly areas a few days after that.

Queen honeybees can control whether or not an egg they lay is fertilized. Unfertilized eggs develop as males and are haploid (have only one set of chromosomes). Fertilized eggs are diploid (two sets of chromosomes) and develop as workers or new queens, depending on how they are fed as larvae. Queens may increase the ratio of male to female eggs they lay if they are diseased or injured, or in response to problems in the colony.

Healthy, well-fed honeybee colonies reproduce by "swarming." The workers in the colony begin by producing numerous queen larvae. Shortly before the new queens emerge, the resident, egg-laying queen leaves the hive, taking up to half the workers with her. This "swarm" forms a temporary group in a tree nearby, while workers scout for a suitable location for a new hive. Once they find one, the swarm moves into the space, and begins building comb and starting the process of food collection and reproduction again.

Meanwhile at the old hive, the new queens emerge from their cells. If the population of workers is large enough, and there are few queens emerging, then the first one or two may leave with "afterswarms" of workers. After the swarming is completed, any remaining new queens try to sting and kill each other, continuing to fight until all but one is dead. After her competition is removed, the surviving queen begins to lay eggs.

Normally the pheromones secreted by a healthy queen prevent workers from reproducing, but if a colony remains queenless for long, some workers will begin laying eggs. These eggs are unfertilized, and so develop as males.

Breeding interval: Colonies typically swarm once or twice a year, usually at the beginning of the season that provides the most nectar.

Breeding season: Late spring until the winter months

Range eggs per season: 60,000 to 80,000.

Average gestation period: 3 days.

Range age at sexual or reproductive maturity (female): 15 to 17 days.

Average age at sexual or reproductive maturity (male): 24 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; induced ovulation ; fertilization (Internal ); oviparous ; sperm-storing

As in most eusocial insects, the offspring of fertile females (queens) are cared for other members of the colony. In honeybees, the caretakers are sterile females, daughters of the queen, called workers.

Workers build and maintain the comb where young bees are raised, gather food (nectar and pollen) feed and tend larvae, and defend the hive and its young from predators and parasites.

Young queens inherit their hive from their mothers. Often several new queens emerge after the old queen leaves with a swarm to found a new colony. The new queens fight for control of the hive, and only one survives the conflict.

Parental Investment: pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); inherits maternal/paternal territory; maternal position in the dominance hierarchy affects status of young

  • Milne, M., L. Milne. 2000. National Audubon Society: Field Guide To Insects and Spiders. New York, Canada: Alfred A. Knopf, Inc..
  • Sammataro, D., A. Avitabile. 1998. The Beekeeper's Handbook, 3rd edition. Ithaca, New York, USA: Comstock Publishing Associates.
  • Adjare, S. 1990. Beekeeping in Africa. Rome, Italy: Food and Agriculture Organisation of the United Nations. Accessed November 06, 2008 at http://www.fao.org/docrep/t0104e/T0104E00.htm.
  • Tarpy, D., R. Page Jr.. 2000. No behavior control over mating frequency in queen honeybees (Apis mellifera L.): implications for the evolution of extreme polyandry. The American Naturalist, 155/6: 820-827.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Water collection cools hive: honeybee
 

Honeybees cool the hive by collecting water, spreading it, and fanning to increase evaporation.

   
  "Honeybee colonies collect water for two reasons, related to different types of weather: for cooling of the brood area by evaporation on hot days, and for feeding the larval brood when foraging is limited on cool days (Lindauer, 1955; Seeley, 1995). The classic studies of Lindauer showed how bees regulate the hive temperature in hot conditions (Lindauer, 1955). Water is collected by water foragers, then distributed around the hive and in cells containing eggs and larvae; fanning accelerates its evaporation, as does regurgitation and evaporation on the tongue (Lindauer, 1955). Visscher and colleagues measured mean water loads of 44 mg in honeybees collecting water under desert conditions (Visscher et al., 1996). Paper wasps and hornets also use water for cooling their nests, but the highly social stingless bees do not (Jones and Oldroyd, 2007; Roubik, 2006)." (Nicholson 2009:430-431)

  Learn more about this functional adaptation.
  • Nicholson SW. 2009. Water homeostasis in bees, with the emphasis on sociality. Journal of Experimental Biology. 212: 429-434.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Varying response thresholds aid hive thermoregulation: honeybee
 

Honeybees in a colony regulate hive temperature due to diverse response thresholds.

       
  "A honey bee colony is characterized by high genetic diversity among its workers, generated by high levels of multiple mating by its queen. Few clear benefits of this genetic diversity are known. Here we show that brood nest temperatures in genetically diverse colonies (i.e., those sired by several males) tend to be more stable than in genetically uniform ones (i.e., those sired by one male). One reason this increased stability arises is because genetically determined diversity in workers' temperature response thresholds modulates the hive-ventilating behavior of individual workers, preventing excessive colony-level responses to temperature fluctuations." (Jones 2006:402)

Watch Video of Bees Fanning Hive
  Learn more about this functional adaptation.
  • Jones, J. C.; Myerscough, M. R.; Graham, S.; Oldroyd, B. P. 2004. Honey Bee Nest Thermoregulation: Diversity Promotes Stability. American Association for the Advancement of Science. 402-404 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Vibration creates heat: honeybee
 

Honeybees create heat in hives via thoracic vibrations.

     
  "Researchers at the University of Würzburg in Germany found that bee hive temperatures were not only maintained by general hive activity, but also by workers congregating at the brood and vibrating their thoracic muscles to warm the incubating young. Some of the workers stay completely motionless on a brood cap for several minutes, pressing their thoraxes against the cap to warm the young within. But many of the bees occupy an empty cell amongst sealed brood cells, and take up residence, sometimes for over an hour. Here, they vibrate their thoracic muscles and reach temperatures up to 41°C. The bees' heat can be felt up to 3 chambers away, and their head warms the six surrounding chambers. Usually a single occupant is the only beneficiary from a worker perched above it on the comb." (Courtesy of the Biomimicry Guild)

  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Groups vote on hive locations: honeybees
 

Honeybees in a colony select a new hive location via range voting.

   
  "Thomas Seeley, a biologist at Cornell University, has been looking into the uncanny ability of honeybees to make good decisions. With as many as 50,000 workers in a single hive, honeybees have evolved ways to work through individual differences of opinion to do what's best for the colony. If only people could be as effective in boardrooms, church committees, and town meetings, Seeley says, we could avoid problems making decisions in our own lives.

"During the past decade, Seeley, Kirk Visscher of the University of California, Riverside, and others have been studying colonies of honeybees (Apis mellifera) to see how they choose a new home. In late spring, when a hive gets too crowded, a colony normally splits, and the queen, some drones, and about half the workers fly a short distance to cluster on a tree branch. There the bees bivouac while a small percentage of them go searching for new real estate. Ideally, the site will be a cavity in a tree, well off the ground, with a small entrance hole facing south, and lots of room inside for brood and honey. Once a colony selects a site, it usually won't move again, so it has to make the right choice.

"To find out how, Seeley's team applied paint dots and tiny plastic tags to identify all 4,000 bees in each of several small swarms that they ferried to Appledore Island, home of the Shoals Marine Laboratory. There, in a series of experiments, they released each swarm to locate nest boxes they'd placed on one side of the half-mile-long (one kilometer) island, which has plenty of shrubs but almost no trees or other places for nests.

"In one test they put out five nest boxes, four that weren't quite big enough and one that was just about perfect. Scout bees soon appeared at all five. When they returned to the swarm, each performed a waggle dance urging other scouts to go have a look. (These dances include a code giving directions to a box's location.) The strength of each dance reflected the scout's enthusiasm for the site. After a while, dozens of scouts were dancing their little feet off, some for one site, some for another, and a small cloud of bees was buzzing around each box.

"The decisive moment didn't take place in the main cluster of bees, but out at the boxes, where scouts were building up. As soon as the number of scouts visible near the entrance to a box reached about 15—a threshold confirmed by other experiments—the bees at that box sensed that a quorum had been reached, and they returned to the swarm with the news.

"'It was a race,' Seeley says. 'Which site was going to build up 15 bees first?'

"Scouts from the chosen box then spread through the swarm, signaling that it was time to move. Once all the bees had warmed up, they lifted off for their new home, which, to no one's surprise, turned out to be the best of the five boxes.

"The bees' rules for decision-making—seek a diversity of options, encourage a free competition among ideas, and use an effective mechanism to narrow choices—so impressed Seeley that he now uses them at Cornell as chairman of his department." (Miller 2007:4-5)

  Learn more about this functional adaptation.
  • Miller, Peter. 2007. The Genius of Swarms. National Geographic [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Strategy ensures smooth landings: honeybee
 

The landing strategy of honeybees results in smooth touchdowns on any surface because it is tailored to varying topography.

       
  "Although landing is a crucial part of insect flight, it has attracted  relatively little study. Here, we investigate, for the first  time, the final moments of a honeybee's (Apis mellifera) landing  manoeuvre. Using high-speed video recordings, we analyse the  behaviour of bees as they approach and land on surfaces of  various orientations. The bees enter a stable hover phase, immediately  prior to touchdown. We have quantified behaviour during this  hover phase and examined whether it changes as the tilt of  the landing surface is varied from horizontal (floor), through  sloped (uphill) and vertical (wall), to inverted (ceiling). The  bees hover at a remarkably constant distance from the surface, irrespective  of its tilt. Body inclination increases progressively as the  tilt of the surface is increased, and is accompanied by an  elevation of the antennae. The tight correlation between the  tilt of the surface, and the orientation of the body and the  antennae, indicates that the bee's visual system is capable of  inferring the tilt of the surface, and pointing the antennae toward  it. Touchdown is initiated by extending the appendage closest  to the surface, namely, the hind legs when landing on horizontal  or sloping surfaces, and the front legs or antennae when  landing on vertical surfaces. Touchdown on inverted surfaces is  most likely triggered by a mechanosensory signal from the antennae.  Evidently, bees use a landing strategy that is flexibly tailored  to the varying topography of the terrain." (Evangelista et al. 2010:262)

  Learn more about this functional adaptation.
  • Evangelista C; Kraft P; Dacke M; Reinhard J; Srinivasan MV. 2010. The moment before touchdown: landing manoeuvres of the honeybee Apis mellifera. Journal of Experimental Biology. 213: 262-270.
  • Sohn E. 2009. Bees always have a safe landing. Discovery News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Diet diversity affects health: honeybees
 

Immunocompetence of honeybees is maintained with a diverse diet.

     
  "The maintenance of the immune system can be costly, and a lack of  dietary protein can increase the susceptibility of organisms  to disease. However, few studies have investigated  the relationship between protein nutrition and immunity in insects.  Here,  we tested in honeybees (Apis mellifera)  whether dietary protein quantity (monofloral pollen) and diet diversity  (polyfloral pollen) can shape baseline immunocompetence  (IC) by measuring parameters of individual immunity  (haemocyte concentration, fat body content and phenoloxidase activity)  and glucose oxidase (GOX) activity, which enables  bees to sterilize colony and brood food, as a parameter of social  immunity.  Protein feeding modified both individual and social  IC but increases in dietary protein quantity did not enhance IC.  However,  diet diversity increased IC levels. In particular,  polyfloral diets induced higher GOX activity compared with monofloral  diets,  including protein-richer diets. These results  suggest a link between protein nutrition and immunity in honeybees and  underscore  the critical role of resource availability on  pollinator health." (Alaux et al. 2010)
  Learn more about this functional adaptation.
  • Alaux C; Ducloz F; Crauser D; Le Conte Y. 2010. Diet effects on honeybee immunocompetence. Biology Letters.
  • Black R. 2010. Bee decline linked to falling biodiversity. BBC News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Body detects magnetic fields: honeybee
 

The abdomens of honeybees may be able to detect magnetic fields and use them in navigation thanks to magnetite.

     
  "The bodies of honeybees also contain magnetite. In the 1970s, Princeton University zoologist Dr. Joseph Kirschvink showed that the magnetite lies in bands of cells in each segment of the bee's abdomen. It is most concentrated just below the ganglion (a compact mass of nerve cells)." (Shuker 2001:45)

"'How do MGs found in the abdomen function as magnetoreceptors' is an enigma yet to be resolved. Suffice to note that peripheral neurons of insects may play a role independent of the brain, such that a male cockroach can continue with mating, with its head bitten off by his female partner. Certainly, a magnetoreception system for positioning and orientation exists in honeybees, and this simple, primitive, and highly accurate sensing mechanism may be present in all other magnetotactic organisms." (Hsu et al. 2007:8)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Hsu C-Y; Ko F-Y; Li C-W; Fann K; Lue J-T. 2007. Magnetoreception system in honeybees Apis mellifera. PLoS ONE. 2(4): e395.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Heat creates precise shapes: bees
 

The body heat of bees helps create precise angles and size within honeycombs via use of thermoplastic wax.

       
  "Geometrical investigations of honeycombs and speculations on how honeybees measure and construct the hexagons and rhombi of their cells are centuries old. Here we show that honeybees neither have to measure nor construct the highly regular structures of a honeycomb, and that the observed pattern of combs can be parsimoniously explained by wax flowing in liquid equilibrium. The structure of the combs of honeybees results from wax as a thermoplastic building medium, which softens and hardens as a result of increasing and decreasing temperatures. It flows among an array of transient, close-packed cylinders which are actually the self-heated honeybees themselves. The three apparent rhomboids forming the base of each cell do not exist but arise as optical artefacts from looking through semi-transparent combs." (Pirk et al. 2004:350)
  Learn more about this functional adaptation.
  • Pirk, CWW; Hepburn, HR; Radloff, SE; Tautz. 2004. Honeybee combs: construction through a liquid equilibrium process?. Naturwissenschaften. 91: 350-353.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Wings generate lift: honeybee
 

The wings of a honeybee generate lift by arcing back and flipping over on the return.

       
  "The notion that engineers once 'proved' that bees can't fly has become an urban myth. So partly to restore the reputation of the profession, Michael Dickinson decided to investigate the forces at work during honeybee flight.

In 1996, Charlie Ellington at the University of Cambridge showed how vortices rolling along the leading edge of the wing were the vital source of lift for most insects. But this can't explain how a heavy insect with a short wing beat, such as a bee, generates enough lift to fly.

Dickinson and his colleagues at Caltech in Pasadena, California, filmed hovering bees at 6000 frames per second, and plotted the unusual pattern of wing beats. The wing sweeps back in a 90-degree arc, then flips over as it returns — 230 times a second. The team made a robot to scale to measure the forces involved.

It is the more exotic forces created as the wing changes direction that dominate, says Dickinson. Additional vortices are produced by the rotation of the wing. 'It's like a propeller, where the blade is rotating too,' he says. Also, the wing flaps back into its own wake, which leads to higher forces than flapping in still air. Lastly, there is 'added-mass force' which peaks at the end of each stroke and comes from the acceleration of the wing after it changes direction." (Phillips 2005:17)

  Learn more about this functional adaptation.
  • Helen Phillips. 2005. The aerodynamic tricks that keep bees airborne. New Scientist. 188(2528):
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genome

The genome sequence of the honeybee was first reported in 2006 (Weinstock et al. 2006, Wilson 2005). Notable characteristics of this genome include high A+T and CpG contents, the lack of major transposon families, relatively slow evolution, and similarity to vertebrates for circadian rhythm, RNA interference and DNA methylation genes. The honeybee was found to have relatively few genes for innate immunity, detoxification enzymes, cuticle-forming proteins and gustatory receptors, but a fairly high number of genes for odorant receptors. Novel genes were found for nectar and pollen utilization (Weinstock et al. 2006).

  • Weinstock, G.M. et al. 2006. (The Honeybee Genome Sequencing Consortium). Insights into social insects from the genome of the honeybee Apis mellifera. Nature 443:931–949. 10.1038/nature05260
  • Wilson, E.O. 2006. Genomics: How to make a social insect. Nature 443:919-920. 10.1038/443919a
Creative Commons Attribution 3.0 (CC BY 3.0)

© Katja Schulz

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Apis mellifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTAATTGGAGGATTTGGAAATTGGCTTATTCCTTTAATACTAGGATCACCTGATATAGCATTCCCCCGAATAAATAATATTAGATTTTGATTACTTCCTCCCTCATTATTTATACTTTTATTAAGAAATTTATTTTATCCAAGACCAGGAACTGGATGAACAGTATATCCACCATTATCAGCATATTTATATCATTCTTCACCTTCAGTAGATTTTGCAATTTTTTCTCTTCATATATCAGGAATTTCCTCAATTATAGGATCATTAAACTTAATAGTTACAATTATAATAATAAAAAATTTTTCTATAAATTATGACCAAATTTCATTATTTCCATGATCAGTTTTTATTACAGCAATTTTATTAATTATATCATTACCTGTATTAGCTGGAGCAATTACTATACTATTATTTGATCGAAATTTTAATACATCATTTTTCGATCCTATAGGAGGTGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATCTCTCATATTGTAATAAATGAAAGAGGAAAAAAAGAAATTTTTGGTAATTTAAGAATAATTTATGCAATATTAGGAATTGGATTTCTAGGTTTTATTGTTTGAGCACATCACATATTTACAGTCGGATTAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apis mellifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 257
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

While the species as a whole is still very numerous, there is concern in Europe that widespread commercialization of beekeeping is endangering locally-adapted populations and subspecies. This, combined with higher mortality of colonies due to Varroa mite and tracheal mite infestations, and the recent phenomenon of Colony Collapse Disorder in North America, has cause significant concern for the health of the population. Colony Collapse Disorder (CCD) is a condition of commercial beehives, where there are sudden massive waves of mortality among the workers. Beekeepers discover their hives simply empty of workers, with so few surviving that they cannot tend the queen and brood. This condition has occurred mainly in North America, and mainly in large commercial apiaries. No single cause has been identified yet.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While the species as a whole is still very numerous, there is concern in Europe that widespread commercialization of beekeeping is endangering locally-adapted populations and subspecies. This, combined with higher mortality of colonies due to Varroa mite and tracheal mite infestations, and the recent phenomenon of Colony Collapse Disorder in North America, has cause significant concern for the health of the population. Colony Collapse Disorder (CCD) is a condition of commercial beehives, where there are sudden massive waves of mortality among the workers. Beekeepers discover their hives simply empty of workers, with so few surviving that they cannot tend the queen and brood. This condition has occurred mainly in North America, and mainly in large commercial apiaries. No single cause has been identified yet.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

A widespread, usually domesticated species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Natural populations of honey bees have been severely affected by the activities of humans (6). Non-native subspecies have been widely introduced to many areas of Europe, and managed colonies have often interbred with native bees, causing a loss of unique genetic diversity in local populations (6). In Germany the native race Apis mellifera mellifera is now thought to be extinct, as it has been completely replaced by the introduced Apis mellifera carnica (6). A more recent threat to the species in Britain is the mite Varroa jacobsoni, which is devastating honey bee populations around the world (4) and was first found in Britain in 1992. These mites attack larvae, pupae and adults (3) and are very expensive to control; in the last 15 years the expense involved has caused a worrying 40-45 % of beekeepers to abandon the craft. To make matters worse, strains of the mite with resistance to the chemicals used in their control have recently been found (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The European Commission has set up the 'Beekeeping and Apis Biodiversity in Europe' (BABE) project, which aims to conserve local subspecies of Apis mellifera, and to maintain the genetic uniqueness of local populations (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Honeybee workers will sting humans and domesticated animals in defense of themselves or their hive. A single sting is painful but not dangerous unless the target is allergic to the venom, in which case it can be life threatening. Otherwise, it takes about 20 stings per kilogram of body weight to be life threatening.

Each subspecies of Apis_mellifera has different behavioral patterns in regards to intruders near or around the hive. The African subspecies are particularly aggressive. One of them, Apis mellifera scutellata, was accidentally released in South America, and has spread north to the southern United States. This is the "killer bee." It is notable for having a much higher aggressive response to disturbance -- more workers attack than in other subspecies, and they pursue targets much longer than European bees do. The spread of these bees made beekeeping much more expensive and complicated, and the aggressive bees caused many deaths.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Honeybees pollinate billions of US dollars worth of commercial agricultural crops around the world every year. They are important pollinators for economically important wild plant populations as well.

Honeybee hives provide honey and wax, and pollen, propolis, and royal jelly that are sold for medicines and cosmetics.

Honeybees are important study organisms for research in the connections between nervous system structure and behavior.

Some research suggests honeybee venom may have medically useful applications in the treatment of auto-immune disease or inflammation.

Positive Impacts: food ; source of medicine or drug ; research and education; pollinates crops

  • Kang, S., C. Pak, H. Choi. 2002. The effect of whole bee venom on arthritis. The American Journal of Chinese Medicine, 30/1: 73-80.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Honeybee workers will sting humans and domesticated animals in defense of themselves or their hive. A single sting is painful but not dangerous unless the target is allergic to the venom, in which case it can be life threatening. Otherwise, it takes about 20 stings per kilogram of body weight to be life threatening.

Each subspecies of Apis mellifera has different behavioral patterns in regards to intruders near or around the hive. The African subspecies are particularly aggressive. One of them, Apis mellifera scutellata, was accidentally released in South America, and has spread north to the southern United States. This is the "killer bee." It is notable for having a much higher aggressive response to disturbance -- more workers attack than in other subspecies, and they pursue targets much longer than European bees do. The spread of these bees made beekeeping much more expensive and complicated, and the aggressive bees caused many deaths.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Honeybees pollinate billions of US dollars worth of commercial agricultural crops around the world every year. They are important pollinators for economically important wild plant populations as well.

Honeybee hives provide honey and wax, and pollen, propolis, and royal jelly that are sold for medicines and cosmetics.

Honeybees are important study organisms for research in the connections between nervous system structure and behavior.

Some research suggests honeybee venom may have medically useful applications in the treatment of auto-immune disease or inflammation.

Positive Impacts: food ; source of medicine or drug ; research and education; pollinates crops

  • Kang, S., C. Pak, H. Choi. 2002. The effect of whole bee venom on arthritis. The American Journal of Chinese Medicine, 30/1: 73-80.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pollinator

The European honey bee is particularly well adapted for pollination. Each colony has many individuals available to collect pollen and, therefore provide pollination services. Honey bees have a complex communication system, allowing individuals to "point out" food sources to other members of the colony. The European honey bee also has a well developed sense of smell and is easily able to locate flowers. When a worker bee visits a flower, pollen is dusted all over its body and is then transferred between flowers. In a single day, one bee can make more than 12 trips from the hive and can visit several thousand flowers.

In the United States, honey bees pollinate over 90 commercial crops and add billions of dollars per year to agricultural output. In fact, over 3.5 million acres of crop land in the United States is reliant upon honey bees for pollination. Some specific crops pollinated by the honey bee include apple, strawberry, almond, cotton, broccoli, carrot, pepper, and squash.

  • Honey Bee, AgriLIFE Extension, Texas A & M System
  • University of Georgia Honey Bee Program, University of Georgia
  • Honey Bees, Bumble Bees, Carpenter Bees, and Sweat Bees, R. Wright, P. Mulder, and H. Reed, Oklahoma Cooperative Extension Service
  • Stinging Insects: Honey Bees, K. Gardner, C. Klass, and N. Calderone, Cornell University - Master Beekeeper Program
  • Pollination and Honey Bees, R. D. Fell, Mid-Atlantic Orchard Monitoring Guide, April 27, 2005
  • Honeybee Biology, Ross E. Koning, Plant Physiology Website, 1994
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western honey bee

The western honey bee or European honey bee (Apis mellifera) is a species of honey bee. The genus Apis is Latin for "bee", and mellifera comes from Latin melli- "honey" and ferre "to bear"—hence the scientific name means "honey-bearing bee". The name was coined in 1758 by Carolus Linnaeus who, upon realizing the bees do not bear honey, but nectar, tried later to correct it to Apis mellifica ("honey-making bee") in a subsequent publication. However, according to the rules of synonymy in zoological nomenclature, the older name has precedence. As of October 28, 2006, the Honey Bee Genome Sequencing Consortium fully sequenced and analyzed the genome of Apis mellifera.

In 2007, media attention focused on colony collapse disorder, a decline in European honey bee colonies in various parts of the world.

Contents

Geographic distribution [edit]

The western honey bee is native to the continents of Europe, Asia, and Africa. As of the early 1600s, the insect was introduced to North America, with subsequent introductions of other European subspecies two centuries later.[1] Since then, they have spread throughout the Americas.

Western honey bees differentiated into geographic races as they spread from Africa into Eurasia.[2] Currently, 28 subspecies based on these geographic variations are recognized.[citation needed] All races are cross-fertile, though reproductive adaptations may make crossing unlikely. The 28 subspecies can be assigned to one of four major branches based on work by Ruttner, and subsequently confirmed by analysis of mitochondrial DNA. African subspecies are assigned to branch A, northwest European subspecies to branch M, southwest European subspecies to branch C, and Mideast subspecies to branch O. The subspecies are grouped and listed in the sidebar. Regions with localized variations may become identified subspecies in the near future, such as A. m. pomonella from the Tian Shan Mountains, which would be included in the Mideast subspecies branch.

Geographic isolation led to numerous adaptations as honey bees spread after the last ice age. These adaptations include brood cycles synchronized with the bloom period of local flora, forming a winter cluster in colder climates, migratory swarming in Africa, enhanced foraging behavior in desert areas, and numerous other inherited traits.

Biology, life cycle [edit]

Larvae to the left and eggs to the right
Pupae of drones
Stages of development of the drone pupae

In the temperate zone, honey bees survive winter as a colony, and the queen begins egg laying in mid to late winter, to prepare for spring. This is most likely triggered by longer day length. She is the only fertile female, and deposits all the eggs from which the other bees are produced. Except for a brief mating period when she may make several flights to mate with drones, or if she leaves in later life with a swarm to establish a new colony, the queen rarely leaves the hive after the larvae have become full-grown bees. The queen deposits each egg in a cell prepared by the worker bees. The egg hatches into a small larva which is fed by 'nurse' bees (worker bees which maintain the interior of the colony). After about a week, the larva is sealed up in its cell by the nurse bees and begins the pupal stage. After another week, it will emerge an adult bee.

For the first 10 days of their lives, the female worker bees clean the hive and feed the larvae. After this, they begin building comb cells. On days 16 through 20, a worker receives nectar and pollen from older workers and stores it. After the 20th day, a worker leaves the hive and spends the remainder of its life as a forager. The population of a healthy hive in mid-summer can average between 40,000 and 80,000 bees.

The larvae and pupae in a frame of honeycomb are referred to as frames of brood and are often sold (with adhering bees) by beekeepers to other beekeepers to start new beehives.

Both workers and queens are fed "royal jelly" during the first three days of the larval stage. Then workers are switched to a diet of pollen and nectar or diluted honey, while those intended for queens will continue to receive royal jelly. This causes the larva to develop to the pupa stage more quickly, while being also larger and fully developed sexually. Queen breeders consider good nutrition during the larval stage to be of critical importance to the quality of the queens raised, with good genetics and sufficient number of matings also being factors. During the larval and pupal stages, various parasites can attack the pupa/larva and destroy or damage it.

Queens are not raised in the typical horizontal brood cells of the honeycomb. The typical queen cell is specially constructed to be much larger, and has a vertical orientation. However, should the workers sense the old queen is weakening, they will produce emergency cells known as supersedure cells. These cells are made from a cell with an egg or very young larva. These cells protrude from the comb. As the queen finishes her larval feeding, and pupates, she moves into a head downward position, from which she will later chew her way out of the cell. At pupation, the workers cap or seal the cell. Just prior to emerging from their cells, young queens can often be heard "piping". The queen makes this noise to prove her space. If successful, this piping seems to have a calming and harmonizing effect on the worker bees.[3]

Worker bees are infertile females, but in some circumstances, generally only in times of severe stress or with the loss or injury or declining health of the queen, they may lay infertile eggs, and in some subspecies these eggs may actually be fertile. However, since the worker bees are 'imperfect' females (not fully sexually developed), they do not mate with drones. Any fertile eggs they lay would be haploid, having only the genetic contribution of their mother, and in honey bees these haploid eggs will always develop into drones. Worker bees also secrete the wax used to build the hive, clean and maintain the hive, raise the young, guard the hive and forage for nectar and pollen.

In honey bees, the worker bees have a modified ovipositor called a stinger with which they can sting to defend the hive, but unlike other bees of any other genus (and even unlike the queens of their own species), the stinger is barbed. Contrary to popular belief, the bee will not always die soon after stinging: this misconception is based on the fact that a bee will usually die after stinging a human or other mammal. The sting and associated venom sac are modified so as to pull free of the body once lodged (autotomy), and the sting apparatus has its own musculature and ganglion which allow it to keep delivering venom once detached. This complex apparatus, including the barbs on the sting, is presumed to have evolved specifically in response to predation by vertebrates, as the barbs do not function (and the sting apparatus does not detach) unless the sting is embedded in elastic material. Even then, the barbs do not always "catch", so a bee may occasionally pull the sting free and either fly off unharmed, or sting again.

Drones [edit]

Drones are the male bees of the colony. Since they do not have ovipositors, they also do not have stingers. Drone honey bees do not forage for nectar or pollen. In some species, they are suspected of playing a contributing role in the temperature regulation of the hive. The primary purpose of a drone bee is to fertilize a new queen. Multiple drones will mate with any given queen in flight, and each will die immediately after mating; the process of insemination requires a lethally convulsive effort. Drone honey bees are haploid (having single, unpaired chromosomes) in their genetic structure and are descended only from their mother, the queen. They truly do not have a father. In essence, drones are the equivalent of flying gametes. In regions of temperate climate, the drones are generally expelled from the hive before winter and left to die of cold and starvation, since they are unable to forage, produce honey, or take care of themselves.

Life expectancy [edit]

The average lifespan of the queen in most subspecies is three to four years. However, reports from the German/European black bee subspecies previously used for beekeeping, indicate the queen could live up to eight years.[4] Because queens deplete their store of sperm, towards the end of their lives, they start laying more and more unfertilized eggs. Beekeepers therefore frequently change queens every year or every other year.

The lifespan of the workers varies drastically over the year in places with an extended winter. Workers born in the spring and summer will work hard and live only a few weeks, whereas those born in the autumn will stay inside for several months as the colony clusters. On average during the year, about one percent of a colony's worker bees die naturally per day.[5] Except for the queen, all of the colony's workers are therefore exchanged about every four months.

Honey production [edit]

Honey bee with tongue partially extended
Enlarged image of a Honey bee's "tongue".

Bees produce honey by collecting nectar, which is a clear liquid consisting of nearly 80% water, with complex sugars. The collecting bees store the nectar in a second stomach and return to the hive, where worker bees remove the nectar. The worker bees digest the raw nectar for about 30 minutes using enzymes to break up the complex sugars into simpler ones. Raw honey is then spread out in empty honeycomb cells to dry, which reduces the water content to less than 20%. When nectar is being processed, honey bees create a draft through the hive by fanning with their wings. Once dried, the cells of the honeycomb are sealed (capped) with wax to preserve the honey.

When a hive detects smoke, many bees become remarkably nonaggressive; this is speculated to be a defense mechanism. Wild colonies generally live in hollow trees, and when bees detect smoke, they are assumed to prepare to evacuate from a forest fire, carrying as much food reserve as they can. To do this, they will go to the nearest honey storage cells and gorge on honey. In this state, they are quite docile, since defense from predation is less important than saving as much food as possible.

Thermoregulation [edit]

The honey bee needs an internal body temperature of 35 °C (95 °F) to fly — which is also the temperature maintained within the cluster. The same temperature is required in the brood nest over a long period to develop the brood, and it is the optimal temperature for the creation of wax. The temperature on the periphery of the cluster varies with the outside air temperature and in the winter cluster, the internal temperature may be as low as 20–22 °C (68–72 °F).

Honey bees are able to forage over a 30 °C (54 °F) range of air temperature, largely because they have behavioural and physiological mechanisms for regulating the temperature of their flight muscles. From very low to very high air temperatures, the successive mechanisms are: shivering before flight and stopping flight for additional shivering, passive body temperature regulation in a comfort range that is a function of work effort, and finally, active heat dissipation by evaporative cooling from regurgitated honey sac contents. The body temperatures maintained differ depending on caste and expected foraging rewards.[6]

The optimal air temperature for foraging is 22–25 °C (72–77 °F). During flight, the rather large flight muscles create heat, which must dissipate. The honey bee uses a form of evaporative cooling to release heat through its mouth. Under hot conditions, heat from the thorax is dissipated through the head; the bee regurgitates a droplet of hot internal fluid — a "honeycrop droplet" – which immediately cools the head temperature by 10 °C (18 °F).[7]

Below 7–10 °C (45–50 °F), bees become immobile, and above 38 °C (100 °F), their activity slows. Honey bees can tolerate temperatures up to 50 °C (122 °F) for short periods.

Queens [edit]

Periodically, the colony determines a new queen is needed. There are three general triggers:

  1. The colony becomes space-constrained because the hive is filled with honey, leaving little room for new eggs. This will trigger a swarm where the old queen will take about half the worker bees to found a new colony, leaving the new queen with the other half of worker bees to continue the old colony.
  2. The old queen begins to fail. This is thought to be recognized by a decrease in queen pheromones throughout the hive. This situation is called supersedure; at the end of the supersedure, the old queen is generally killed.
  3. The old queen dies suddenly. This situation is known as emergency supersedure. The worker bees will find several eggs or larvae of the right age-range, and attempt to develop them into queens. Emergency supersedure can generally be recognized because the new queen cells are built out from regular cells of the comb rather than hanging from the bottom of a frame.

Regardless of the trigger, the workers develop the larvae into queens by continuing to feed them royal jelly, which triggers an extended development as a pupa.

When the virgin queen emerges, she is commonly thought to seek out other queen cells and sting the infant queens within. Should two queens emerge simultaneously, they are thought to fight to the death. Recent studies, however, have indicated as many as 10% of Apis mellifera colonies may maintain two queens. The mechanism by which this occurs is not yet known, but it has been reported to occur more frequently in some South African subspecies.[citation needed] Regardless, the queen asserts her control over the worker bees through the release of a complex suite of pheromones called queen scent.

Peanut-like queen brood cells are extended outward from the brood comb.

After several days of orientation within and around the hive, the young queen flies to a drone congregation point (a site near a clearing and generally about 30 feet (9.1 m) above the ground), where the drones from different hives tend to congregate in a swirling aerial mass. Drones detect the presence of a queen in their congregation area by her smell, and then find her by sight and mate with her in midair (drones can be induced to mate with "dummy" queens if they have the queen pheromone applied). A queen will mate multiple times and may leave to mate several days in a row, weather permitting, until her spermatheca is full.

The queen lays all the eggs in a healthy colony. The number and pace of egg-laying is controlled by weather, availability of resources and the characteristics of the specific race of honey bee. Queens generally begin to slow egg-laying in the early fall and may even stop during the winter. Egg-laying will generally resume in late winter as soon as the days begin to get longer and peak in the spring. At the height of the season, the queen may lay over 2500 eggs per day – more than her own body mass.

The queen fertilizes each egg as it is being laid into a worker-sized cell using stored sperm from the spermatheca. Eggs laid into drone-sized (larger) cells are left unfertilized. The unfertilized eggs have only half as many genes as the queen or worker eggs and develop into drones.

Queen-Worker Conflict [edit]

In instances where a fertile female worker produces drones, a conflict arises between her interests and those of the queen. The worker shares half of her genes with the drone and a quarter with her brothers, favoring her own offspring over those of the queen. The queen, however, shares half of her genes with her sons and only a quarter with the sons of fertile female workers.[8] This situation pits the interest of the worker against those of the queen and other workers, who will each try to maximize their reproductive fitness by rearing the offspring most related to them. This relationship leads to the phenomenon known as "worker policing". In these rare situations, other worker bees in the hive which are more genetically related to the queen's sons than those of the fertile workers and will actively patrol the hive and remove the worker-laid eggs. Another form of worker-based policing is aggression toward the fertile females.[9] Some studies have suggested the presence of a queen pheromone that may aid workers in discrimination of worker and queen-laid eggs, whereas other studies claim that egg viability is the key difference in eliciting the behavior.[10][11] Worker policing is an example of forced altruism, in which the benefits of worker reproduction are reduced and the benefit of rearing the queen's offspring are raised.

In very rare instances, workers can subvert the policing mechanisms of the hive and lay eggs that are removed at a lower rate by other workers, a condition termed the "anarchic syndrome". Anarchic workers can activate their ovaries at a higher rate and contribute a greater proportion of males to the hive. Although an increase in the number of drones would decrease the overall productivity of the hive, the reproductive fitness of the mother of the drones would greatly increase. Thus, the anarchic syndrome is an example of selection working at both the individual and group levels in opposite directions for hive stability.[12]

Under ordinary circumstances, the death or removal of a queen is sufficient to increase reproduction in workers. A significant proportion of the workers will have active ovaries in the absence of a queen. The workers of the hive produce a last batch of drones before the hive eventually collapses. During this period, worker policing is noticeably absent. However, in certain groups of bees, worker policing continues.[13]

According to kin selection theory, worker policing is not favored if a queen does not mate multiply. Workers would be related by three-quarters of their genes, and so the difference in relatedness between the sons of the queen and those of the other workers would decrease. Thus, the benefit obtained by policing is negated. Under these circumstances, policing is less favored. Experiments confirming this hypothesis have shown a correlation between higher mating rates and increased rates of worker policing in many species of social hymenoptera.[14]

Genome [edit]

The European honey bee is the third insect, after the fruit fly and the mosquito, to have its genome mapped. According to the scientists who analysed its genetic code, the honey bee originated in Africa and spread to Europe in two ancient migrations.[2] They have also discovered the number of genes related to smell outnumber those for taste, and they have fewer genes for immunity than the fruit fly and the mosquito.[15] The genome sequence revealed several groups of genes, particularly the genes related to circadian rhythms, were closer to vertebrates than other insects. Genes related to enzymes that control other genes were also vertebrate-like.[16]

The genome is unusual in having very few transposons, while they have been present in the evolutionary past (inactive remains were found) and in general evolved slower than in Diptera species.[15]

Pheromones [edit]

Honey bees use special pheromones, or chemical communication, for almost all behaviors of life. Such uses include (but are not limited to): mating, alarm, defense, orientation, kin and colony recognition, food production, and integration of colony activities. Pheromones are thus essential to honey bees for their survival.

Communication [edit]

A large honey bee swarm on a fallen tree trunk

Honey bees are an excellent animal species to study with regard to behavior because they are abundant and familiar to most people. Karl von Frisch, who was awarded the Nobel Prize for physiology and medicine in 1973 for his study of honey bee communication, noticed bees communicate through the language of dance. Honey bees are able to direct other bees to food sources through the round dance and the waggle dance. The round dance tells the other foragers that food is within 50 meters of the hive, but it does not provide much information regarding direction. The waggle dance, which may be vertical or horizontal, provides more detail about both the distance and the direction of the located food source. Bees also are thought to rely on their olfactory sense to help locate the food source once the foragers are given directions from the dances.

Another signal for communication is the shaking signal, also known as the jerking dance, vibration dance, or vibration signal. It is a modulatory communication signal because it appears to manipulate the overall arousal or activity of behaviors. The shaking signal is most common in worker communication, but it is also evident in reproductive swarming. A worker bee vibrates its body dorsoventrally while holding another honey bee with its front legs. Jacobus Biesmeijer examined the incidence of shaking signals in a forager's life and the conditions that led to its performance to investigate why the shaking signal is used in communication for food sources. Biesmeijer found that the experienced foragers executed 92.1% of the observed shaking signals. He also observed that 64% of the shaking signals were executed by experienced foragers after they had discovered a food source. About 71% of the shaking signal sessions occurred after the first five foraging success within one day. Then other communication signals, such as the waggle dance, were performed more often after the first five successes. Biesmeijer proved that most shakers are foragers and that the shaking signal is most often executed by foraging bees over pre-foraging bees. Beismeijer concluded that the shaking signal presents the overall message of transfer work for various activities or activity levels. Sometimes the signal serves to increase activity, when bees shake inactive bees. At other times, the signal serves as an inhibitory mechanism such as the shaking signal at the end of the day. However, the shaking signal is preferentially directed towards inactive bees. All three types of communication between honey bees are effective in their jobs with regards to foraging and task managing.

"The general story of the communication of the distance, the situation, and the direction of a food source by the dances of the returning (honey bee) worker bee on the vertical comb of the hive, has been known in general outline from the work of Karl von Frisch in the middle 1950s."

Beekeeping [edit]

A queen bee with workers

The honey bee is a colonial insect that is often maintained, fed, and transported by beekeepers. Honey bees do not survive individually, but rather as part of the colony. Reproduction is also accomplished at the colony level. Colonies are often referred to as superorganisms.

Honey bees collect flower nectar and convert it to honey which is stored in their hives. The nectar is transported in the stomach of the bees, and is converted to honey through the addition of various digestive enzymes, and by being stored in a "honey cell" and then partially dehydrated. Nectar and honey provide the energy for the bees' flight muscles and for heating the hive during the winter period. Honey bees also collect pollen which supplies protein and fat for bee brood to grow. Centuries of selective breeding by humans have created honey bees that produce far more honey than the colony needs. Beekeepers, also known as "apiarists," harvest the honey.

Beekeepers often provide a place for the colony to live and to store honey. There are seven basic types of beehive: skeps, Langstroth hives, top-bar hives, box hives, log gums, D.E. hives and miller hives. All U.S. states require beekeepers to use movable frames to allow bee inspectors to check the brood for disease. This allows beekeepers to keep the Langstroth, top-bar, and D.E. hives freely, but other types of hives require special permitting, such as for museum use. The type of beehive used significantly impacts colony health and wax and honey production.

Modern hives also enable beekeepers to transport bees, moving from field to field as the crop needs pollinating and allowing the beekeeper to charge for the pollination services they provide.

In cold climates some beekeepers have kept colonies alive (with varying success) by moving them indoors for winter. While this can protect the colonies from extremes of temperature and make winter care and feeding more convenient for the beekeeper, it can increase the risk of dysentery (see the Nosema section of diseases of the honey bee) and can create an excessive buildup of carbon dioxide from the respiration of the bees. Recently, inside wintering has been refined by Canadian beekeepers, who build large barns just for wintering bees. Automated ventilation systems assist in the control of carbon dioxide build-up.

Breeding [edit]

Numerous traits are present in the various subspecies of honeybees that are amenable to selection via breeding. This listing covers a small part of the variation present in the honeybee genome.

1. Egg Laying Rate – Queen can lay a few hundred eggs per day up to about 5,000 eggs per day.

2. Egg Viability Rate – Can range from 0 up to 100% of eggs that hatch and develop into bees.

3. Brood Cycle Length – For worker bees ranges from 17 days up to 21 days.

4. Brood Nurturing – This is a measure of how intent the nurse bees are at nurturing brood.

5. Foraging Aggressiveness – This trait determines potential for honey production.

6. Time Of Foraging – Some bees forage earlier in the day and later in the evening than others.

7. Disease Resistance – This is a measure of innate tolerance to brood diseases and adult diseases.

8. Pest Resistance – This is a measure of innate tolerance to pests such as tracheal and varroa mites.

9. Defensive Behavior – Determines aggressiveness and stinging propensity.

10. Swarming Tendency – This determines the timing and success of colony reproduction.

11. Winter Hardiness – Clustering behavior and ability to survive extended low temperatures.

12. Life Span – Ranges from a 22 days up to 305 days for workers with an average of 36 days.

13. Body Size – Small bees are typical in Africa with larger bees typical in colder climates.

14. Sense Of Smell – Ability to detect flower odors and respond to nectar availability.

15. Hygienic Cleaning Behavior – This is a major component of both disease and pest resistance.

16. Time Of Brood Development – Bees must begin brood rearing at least 8 weeks before nectar flows.

17. Thrift – Adjustment of brood production to available food sources for efficient use of resources.

18. Honey Arrangement – Storing honey closer to or further away from the brood next.

19. Pollen Collection – Amount and floral source of pollen are under direct genetic control.

20. Type Of nectar Collected – This has a major impact on honey quality and value.

21. Comb Building – Willingness to build comb and expand the colony.

22. Capping Structure – Ranges from flat and watery to gray to white dome shaped cappings.

23. Propolis Collection – Associated with wintering success, ranges from none to covering all hive surfaces.

24. Brace Comb Construction – Ranges from very little to cross comb throughout the colony.

25. Abdominal Color – Ranges from black to various color stripes in tan, yellow, and orange.

26. Antennae Structure – Number and placement of sensors is inherited, associated with sense of smell.

27. Number of Drones Produced – Ranges from very few up to ¼ of brood combs.

28. Number of Queens Produced – Ranges from a few up to several hundred.

Products [edit]

Honey bees [edit]

One of the primary products is more honeybees. Honey bees are bought and sold as mated queens, in spring packages of a queen with 2 to 5 pounds of bees, as nucleus colonies which include frames of brood, and as full colonies of bees. Commercial sale of bees dates to prehistory. Modern methods of producing queens and dividing colonies for increase date to the late 1800s. Bees are typically produced in temperate to tropical regions and sold to colder areas, as for example packages of bees produced in Florida and sold to beekeepers in Michigan.

Pollination [edit]

Beehives set up for pollination

The honey bee's primary commercial value is as a pollinator of crops. Orchards and fields have grown larger; at the same time wild pollinators have dwindled. In several areas of the world the pollination shortage is compensated by migratory beekeeping, with beekeepers supplying the hives during the crop bloom and moving them after bloom is complete. In many higher latitude locations it is difficult or impossible to winter over enough bees, or at least to have them ready for early blooming plants, so much of the migration is seasonal, with many hives wintering in warmer climates and moving to follow the bloom to higher latitudes.

As an example, in California, the pollination of almonds occurs in February, early in the growing season, before local hives have built up their populations. Almond orchards require two hives per acre (2,000 m² per hive) for maximum yield and so the pollination is highly dependent upon the importation of hives from warmer climates. Almond pollination, which occurs in February and March, is the largest managed pollination event in the world, requiring more than one third of all the managed honey bees in the United States. Massive movement of honey bee are also made for apples in New York, Michigan, and Washington. And despite the inefficiency of honey bees in pollinating blueberries,[17] huge numbers are also moved to Maine for blueberries, because they are the only pollinators that can be relatively easily moved and concentrated for this and other monoculture crops. Commercial beekeepers plan their movements and their wintering locations with prime reference to the pollination services they plan to perform.

Honey bees immersed in yellow beavertail cactus pollen, in the High Desert of California

Bees, as well as some other insects, are particularly beneficial as pollinators to most plants, as they maintain flower constancy, which means they are more likely to transfer pollen to other conspecific plants.[18] Also, flower constancy prevents the loss of pollen during interspecific flights and pollinators from clogging stigmas with pollen of other flower species.[19]

Honey [edit]

Honey is the complex substance made when the nectar and sweet deposits from plants and trees are gathered, modified and stored in the honeycomb by honey bees. Honey is a complex biological mixture that consists mostly of inverted sugars, primarily glucose and fructose. It has antibacterial and antifungal properties and will not rot or ferment when stored under normal conditions. However, honey will crystallize with time. Crystallized honey is not damaged or defective in any way, for human use, but bees will automatically remove crystallized honey from their hive and discard it, since they can only use liquid honey.

The bee carries pollen in a pollen basket back to the hive

Beeswax [edit]

Worker bees of a certain age will secrete beeswax from a series of glands on their abdomen. They use the wax to form the walls and caps of the comb. When honey is harvested, the wax can be gathered to be used in various wax products like candles and seals.

See movie of bee at work collecting pollen. Requires an Ogg Theora enabled browser or player, such as Firefox or VideoLAN.

Pollen [edit]

Bees collect pollen in the pollen basket and carry it back to the hive. There, pollen is used as a protein source necessary during brood-rearing. In certain environments, excess pollen can be collected from the hives. It is often eaten as a health supplement.

An Africanized bee extracts nectar from a flower as pollen grains stick to its body in Tanzania

Propolis [edit]

Propolis is a resinous mixture that honey bees collect from tree buds, sap flows, or other botanical sources. It is used as a sealant for unwanted open spaces in the hive. Propolis is marketed for its alleged health benefits, but may cause severe allergic reactions in some individuals.

Royal jelly [edit]

Royal jelly is a honey bee secretion that is used in the nutrition of the larvae. It is marketed for its alleged health benefits, but may cause severe allergic reactions in some individuals.

Hazards and survival [edit]

European honey bee populations have recently faced threats to their survival. North American and European populations were severely depleted by varroa mite infestations in the early 1990s, and US beekeepers were further affected by colony collapse disorder in 2006 and 2007.[20] Chemical treatments against Varroa mites saved most commercial operations and improved cultural practices. New bee breeds are starting to reduce the dependency on miticides (acaracides) by beekeepers. Feral bee populations were greatly reduced during this period but now are slowly recovering, mostly in areas of mild climate, owing to natural selection for Varroa resistance and repopulation by resistant breeds. Further, insecticides, particularly when used in violation of label directions, have also depleted bee populations[citation needed], while various bee pests and diseases are becoming resistant to medications (e.g. American foulbrood, tracheal mites and Varroa mites).

Environmental hazards [edit]

A bee swarm. Bees are remarkably non-aggressive in this state as they have no hive to protect, and can be captured with ease.

In North America, Africanized bees have spread across the southern United States where they pose a small danger to humans, although they may make beekeeping difficult and potentially dangerous (particularly hobby beekeeping).

As an invasive species, feral honey bees have become a significant environmental problem in places where they are not native. Imported bees may compete with and displace native bees and birds, and may also promote the reproduction of invasive plants that native pollinators do not visit. Also, unlike native bees, they do not properly extract or transfer pollen from plants with poricidal anthers (anthers that only release pollen through tiny apical pores), as this requires buzz pollination, a behavior which honey bees rarely exhibit. For example, honey bees reduce fruiting in Melastoma affine (a plant with poricidal anthers) by robbing stigmas of previously deposited pollen.[21]

Predators [edit]

Insects [edit]

Spiders [edit]

Reptiles and amphibians [edit]

Birds [edit]

Mammals [edit]

Contrary to popular perception, bears and honey badgers are brood predators; honey is only of secondary interest.

Designated state insect [edit]

See also [edit]

References [edit]

  1. ^ "Research upsetting some notions about honey bees". ScienceDaily. December 29, 2006. 
  2. ^ a b Charles W. Whitfield, Susanta K. Behura , Stewart H. Berlocher, Andrew G. Clark, J. Spencer Johnston, Walter S. Sheppard, Deborah R. Smith, Andrew V. Suarez, Daniel Weaver & Neil D. Tsutsui (2006). "Thrice out of Africa: ancient and recent expansions of the honey bee, Apis mellifera" (PDF). Science 314 (5799): 642–645. doi:10.1126/science.1132772. PMID 17068261. 
  3. ^ http://www.youtube.com/watch?v=VBlI1sgczVY
  4. ^ "Apis mellifera". AnAge database. Human Ageing Genomic Resources. Retrieved June 2, 2011. 
  5. ^ Tautz, J. Phaenomen Honigbiene Springer 2003, 280 pages, pg 47
  6. ^ Bernd Heinrich (1996). "How the honey bee regulates its body temperature". Bee World 77: 130–137. 
  7. ^ Bernd Heinrich (1979). "Keeping a cool head: honeybee thermoregulation". Science 205 (4412): 1269–1271. doi:10.1126/science.205.4412.1269. PMID 17750151. 
  8. ^ Wenseleers, T., Helanterä, H., Hart, A. and Ratnieks, F. L. W. (2004), Worker reproduction and policing in insect societies: an ESS analysis. Journal of Evolutionary Biology, 17: 1035–1047. doi: 10.1111/j.1420-9101.2004.00751.x
  9. ^ Ratnieks, F. and P. Kirk Visscher. (1989), Worker policing in the honeybee. Nature, 342: 796-797. doi:10.1038/342796a0
  10. ^ Pirk, C., Neumann, P., Hepburn, R., Moritz, R., and Tautz, J. (2003) Egg viability and worker policing in honey bees. PNAS, 101: 8649-8651. doi: 10.1073/pnas.0402506101
  11. ^ Oldroyd, B., and Francis Ratnieks. (2002) Egg-marking pheromones in honey-bees Apis mellifera. Behavior Ecology and Sociobiology, 51: 590-591. doi: 10.1007/s00265-002-0480-4
  12. ^ Barron, A. , Oldroyd, B, and Ratnieks, F.L.W. (2001) Worker reproduction in honey-bees (Apis) and the anarchic syndrome: a review. Behavior Ecology and Sociobiology, 50: 199-208. doi: 10.1007/s002650100362
  13. ^ Châline, N., Martin, S.J., and Ratnieks, F.L.W. Worker policing persists in a hopelessly queenless honey bee colony (Apis mellifera). (2004) Insectes Soc, 51: 1-4. doi 10.1007/s00040-003-0708-0
  14. ^ Davies, N.R., Krebs, J.R., and West, S.A. An Introduction to Behavioral Ecology. 4th ed. West Sussex: Wiley-Blackwell, 2012. Print. pp. 387-388
  15. ^ a b Honey Bee Genome Sequencing Consortium (2006). "Insights into social insects from the genome of the honeybee Apis mellifera". Nature 443 (7114): 931–949. doi:10.1038/nature05260. PMC 2048586. PMID 17073008. 
  16. ^ Ying Wang, Mireia Jorda, Peter L. Jones, Ryszard Maleszka, Xu Ling, Hugh M. Robertson, Craig A. Mizzen, Miguel A. Peinado & Gene E. Robinson (2006). "Functional CpG methylation system in a social insect". Science 314 (5799): 645–647. doi:10.1126/science.1135213. PMID 17068262. 
  17. ^ S. K. Javorekac, K. E. Mackenziec, S. P. Vander Kloetbc (2002). "Comparative pollination effectiveness among bees (Hymenoptera: Apoidea) on lowbush blueberry (Ericaceae: Vaccinium angustifolium)". Annals of the Entomological Society of America 95 (3): 345–351. doi:10.1603/0013-8746(2002)095[0345:CPEABH]2.0.CO;2. 
  18. ^ Lawrence D. Harder, Neal M. Williams, Crispin Y. Jordan & William A. Nelson (2001). "The effects of floral design and display on pollinator economics and pollen dispersal". In Lars Chittka & James D. Thomson. Cognitive Ecology of Pollination: Animal Behaviour and Floral Evolution. Cambridge University Press. pp. 297–317. doi:10.1017/CBO9780511542268.016. ISBN 978-0-511-54226-8. 
  19. ^ Lars Chittka, James D. Thomson & Nickolas M. Waser (1999). "Flower constancy, insect psychology, and plant evolution" (PDF). Naturwissenschaften 86: 361–377. 
  20. ^ Stefan Lovgren (February 23, 2007). "Mystery bee disappearances sweeping U.S.". National Geographic News. Retrieved March 10, 2007. 
  21. ^ C. L. Gross & D. Mackay (1998). "Honeybees reduce fitness in the pioneer shrub Melastoma affine (Melastomataceae)". Biological Conservation 86 (2): 169–178. doi:10.1016/S0006-3207(98)00010-X. 
  22. ^ "Goldenrod Spider (Misumena vatia)". Royal Alberta Museum. August 31, 2004. Retrieved June 2, 2011. 

Bibliography [edit]

  • A. I. Root's The ABC and XYZ of Beekeeping
  • Molecular confirmation of a fourth lineage in honeybees from the Near East Apidologie 31 (2000) 167-180, accessed Oct 2005
  • Biesmeijer, Jacobus. "The Occurrence and Context of the Shaking Signal in Honey Bees (Apis mellifera) Exploiting Natural Food Sources". Ethology. 2003.
  • Collet, T., Ferreira, K.M., Arias, M.C., Soares, A.E.E. and Del Lama, M.A. (2006). Genetic structure of Africanized honeybee populations (Apis mellifera L.) from Brazil and Uruguay viewed through mitochondrial DNA COI–COII patterns. Heredity 97, 329–335.
  • Lindauer, Martin. "Communication among social bees". Harvard University Press 1971.
  • Myerscough, Mary R.: Dancing for a decision: a matrix model for nest-site choice by honeybees, Proc. Royal Soc. London B 270 (2003) 577-582.
  • Schneider, S. S., P. K. Visscher, Camazine, S. "Vibration Signal Behavior of Waggle-dancers in Swarms of the Honey Bee, Apis mellifera (Hymenoptera: Apidae). Ethology. 1998.
  • "'Honey Bee - Study of Northern Virginia Ecology'". Retrieved 2006-01-01. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Africanized bee

Africanized honey bees, known colloquially as "killer bees," are some hybrid varieties of the Western honey bee species, (Apis mellifera), produced originally by cross-breeding of the African honey bee A. m. scutellata, with various European honey bees such as the Italian bee A. m. ligustica and the Iberian bee A. m. iberiensis. The hybrid bees are far more defensive than any of the various European subspecies. Small swarms of Africanized bees are capable of taking over European honey bee hives by invading the hive and establishing their own queen after killing the European queen.[1]

Contents

History [edit]

Western honey bees differentiated into geographic races as they spread from Africa into Eurasia. Migrating bee populations formed the original colonies of bee in western Europe, landing to eventually populate the continent from Africa across the Straits of Gibraltar.[2] There are currently 28 recognized subspecies of Apis mellifera based largely on these geographic variations. All subspecies are cross fertile. Geographic isolation led to numerous local adaptations. These adaptations include brood cycles synchronized with the bloom period of local flora, forming a winter cluster in colder climates, migratory swarming in Africa, enhanced foraging behavior in desert areas, and numerous other inherited traits.

The Africanized honey bees in the Western Hemisphere are of mixed descent from 26 Tanganyikan queen bees of A. m. scutellata, accidentally released by a replacement bee-keeper in 1957 near Rio Claro, São Paulo, in the southeast of Brazil, from hives operated by biologist Warwick E. Kerr, who had interbred honey bees from Europe and southern Africa. Hives containing these particular queens were noted to be especially defensive. Kerr was attempting to breed a strain of bees that would produce more honey and be better adapted to tropical conditions (i.e., more productive) than the European subspecies of honey bee used in South America and southern North America. The hives the bees were released from had special excluder grates to prevent the larger queen bees and drones from getting out and mating with local queens and drones of European descent. However, following the accidental release, the African queens and drones mated with domesticated local non-African queens and drones, and their descendants have since spread throughout the Americas.

The Africanized bees have become the dominant type of honey bee for beekeeping in Central America and in tropical areas of South America due to them out competing the European sub species, and there are claims that they have improved productivity. Unfortunately, the extreme tendency of Africanized bees to swarm has had a significant impact of honey production in managed colonies and in most areas the Africanized bees tend to have certain behavioral traits that make them less desirable for managed beekeeping. Specifically, as compared with the European bee types, the Africanized bee:

  • Tends to swarm more frequently and go farther than other types of honey bees.
  • Is more likely to migrate as part of a seasonal response to lowered food supply.
  • Is more likely to "abscond"—the entire colony leaves the hive and relocates—in response to stress.
  • Has greater defensiveness when in a resting swarm, compared to other honey bee types.
  • Lives more often in ground cavities than the European types.
  • Guards the hive aggressively, with a larger alarm zone around the hive.
  • Has a higher proportion of "guard" bees within the hive.
  • Deploys in greater numbers for defense and pursues perceived threats over much longer distances from the hive.
  • Cannot survive extended periods of forage deprivation, preventing introduction into areas with harsh winters or extremely dry late summers.

Geographic spread [edit]

Map showing the spread of Africanized honey bees in the United States from 1990 to 2003

As of 2002, the Africanized honeybees had spread from Brazil south to northern Argentina and north to Central America, Trinidad (West Indies), Mexico, Texas, Arizona, Nevada, New Mexico, Florida, and southern California. Their expansion stopped for a time at eastern Texas, possibly due to the large population of honey bee hives in the area. However, discoveries of the Africanized bees in southern Louisiana indicate this subspecies has penetrated this barrier,[3] or has come as a swarm aboard a ship. In June 2005, it was discovered that the bees had penetrated the border of Texas and had spread into southwest Arkansas. On September 11, 2007, Commissioner Bob Odom of the Department of Agriculture and Forestry said that Africanized honey bees established themselves in the New Orleans area.[4] In February 2009, Africanized honeybees were found in southern Utah.[5][6] In October 2010, a 73-year-old man was killed by a swarm of Africanized honey bees while clearing brush on his south Georgia property, as determined by Georgia's Department of Agriculture. In 2012 state officials reported that a colony was found for the first time in a bee keepers colony in Monroe County, eastern Tennessee.[7]

In tropical climates they compete effectively against European bees and, at their peak rate of expansion, they spread north at a rate of almost two kilometers (about one mile) a day. There were discussions about slowing the spread by placing large numbers of docile European-strain hives in strategic locations, particularly at the Isthmus of Panama, but various national and international agricultural departments were unable to prevent the bees' expansion. Current knowledge of the genetics of these bees suggests that such a strategy, had it been attempted, would not have been successful.[8]

As the Africanized honeybee migrates further north, colonies are interbreeding with European honeybees. There are now relatively stable geographic zones in which either African bees dominate, a mix of African and European bees is present, or only non-African bees are found, as in southern South America or northern North America.

African honeybees abscond, abandon the hive and any food store to start over in a new location, more readily than European honeybees. This is not necessarily a severe loss in tropical climates where plants bloom all year but in more temperate climates it can leave the colony with insufficient stores to survive the winter. Thus Africanized bees are expected to be a hazard mostly in the Southern States of the United States, reaching as far north as the Chesapeake Bay in the east. The cold-weather limits of the African bee have driven some professional bee breeders from Southern California into the harsher wintering locales of the northern Sierra Nevada and southern Cascade Range. This is a more difficult area to prepare bees for early pollination placement in, such as is required for the production of almonds. The reduced available winter forage in northern California means that bees must be fed for early spring buildup.

The arrival of honeybees in Central America is a threat to the ancient art of keeping stingless bees in log gums even though they do not interbreed or directly compete with the stingless bees. The honey productivity of the honey bees exceeds the productivity of the native stingless bees so much that economic pressures force beekeepers to switch.

African honeybees are considered an invasive species in many regions.

Morphology and genetics [edit]

An Africanized bee extracts nectar from a flower as pollen grains stick to its body in Tanzania

The popular term 'Killer bee' has only limited scientific meaning today because there is no generally accepted fraction of genetic contribution used to establish a cut-off. While the native African scutellata are smaller, and build smaller comb cells than the European bees, their hybrids are not smaller. Africanized bees have slightly shorter wings, which can be reliably recognized only by performing a statistical analysis on micro-measurements of a substantial sample. One problem with this test is that there are also others subspecies, the first Americas naturalized Apis mellifera iberiensis with shorter wings too, is having from ancient hybridated haplotypes that presents six different lineages, five of them correspond to evolutionary lineages from Africa. Some belong to Apis mellifera intermissa but others are having an indeterminate origin; the Egyptian honeybee (Apis mellifera lamarckii), present in small numbers in the southeastern United States, has the same morphology. Currently testing techniques have moved away from external measurements to DNA analysis, but this means the test can only be done by a sophisticated laboratory. Molecular diagnostics using the mitochondrial DNA (mtDNA) cytochrome b gene can differentiate A. m. scutellata from other A. mellifera lineages, though mtDNA only allows one to detect an Africanized colony that has an Africanized queen, and not colonies where a European queen has mated with Africanized drones.[9]

The Western honey bee is native to the continents of Europe, Asia, and Africa. As of the early 1600s, the insect was introduced to North America, with subsequent introductions of other European subspecies two centuries later.[10] Since then, they have spread throughout the Americas. The 28 subspecies can be assigned to one of four major branches based on work by Ruttner and subsequently confirmed by analysis of mitochondrial DNA. African subspecies are assigned to branch A, northwest European subspecies to branch M, southwest European subspecies to branch C, and Mideast subspecies to branch O. The subspecies are grouped and listed. There are still regions with localized variations that may become identified subspecies in the near future, such as A. m. pomonella from the Tian Shan mountains, which would be included in the Mideast subspecies branch.

The Western honey bee is the third insect to have its genome mapped, and is unusual in having very few transposons. According to the scientists who analysed its genetic code, the western honey bee originated in Africa and spread to Eurasia in two ancient migrations.[11] They have also discovered that the number of genes in the honey bees related to smell outnumber those for taste.[12] The genome sequence revealed several groups of genes, particularly the genes related to circadian rhythms, were closer to vertebrates than other insects. Genes related to enzymes that control other genes were also vertebrate-like.[13]

Besides, A. m. iberica haplotype is present in the honey bees of the western United States,[14] Mexico and South America, where the honey bees are not native and they were introduced from Spain during the conquest of America, from populations with African haplotypes, whose origin is indeterminate. Apis mellifera iberica is having hybridization between the north of African and European bees, Apis mellifera mellifera, and Apis mellifera intermissa.[15] Presents six haplotypes different, five of them correspond to an evolutionary lineage from Africa and one from Western Europe. From this, infer the hybrid nature of this subspecies, is similar to that of African populations in the number of alleles detected and the values of genetic diversity. Additionally A.m.intermissa genoma, present in A.m.iberica belongs to a group shown by experiment to have similar mtDNA, this including A. m. monticola, A. m. scutellata, A. m. adansonii and A. m. capensis .[16][17][18]

Several researchers and beekeepers describe a general trait of the African subspecies Apis mellifera scutellata, classified by Lepeletier, 1836 - (African honey bee) Central and West Africa, which is absconding, where the Africanized honeybee colonies abscond the hive in times when food-stores are low, unlike the European colonies which tend to die in the hive.

There are two lineages of African subspecies Apis mellifera scutellata in the Americas: actual matrilinial descendants of the original escaped queens and a much smaller number that are African through hybridization. The matrilinial descendants carry African mtDNA, but partially European nuclear DNA, while the bees that are African through hybridization carry European mtDNA, and partially African nuclear DNA. The matrilinial descendants are in the vast majority. This is supported by DNA analyses performed on the bees as they spread northwards; those that were at the "vanguard" were over 90% African mtDNA, indicating an unbroken matriline (Smith et al., 1989), but after several years in residence in an area interbreeding with the local European strains, as in Brazil, the overall representation of African mtDNA drops to some degree. However, these latter hybrid lines (with European mtDNA) do not appear to propagate themselves well or persist.[19] Population genetics analysis of Africanized honey bees in the United States, using a materially inherited genetic marker, found 12 distinct mitotypes, and the amount of genetic variation observed supports the idea that there have been multiple introductions of AHB into the United States.[20]

Consequences of selection [edit]

The chief difference between the European races or subspecies of bees kept by beekeepers and the African stock is attributable to selective breeding. The Africanized honey bee varieties produced a reversion of behaviour similar to non-domesticated species. The most common race used in the United States today is the Italian bee, Apis mellifera ligustica, which has been used for several thousand years in some parts of the world and in the Americas since the arrival of the European colonists. Beekeepers have tended to eliminate the fierce strains, and the entire race of bees has thus been gentled by selective breeding, from bee species naturally selected by the environment.

In central and southern Africa, the bees had to adapt to the environment of sub-saharan Africa—surviving prolonged droughts and having to defend themselves against other aggressive insects, as well as animals like the honey badger, that also will destroy hives if the bees are not sufficiently defensive. In addition, there was formerly no tradition of beekeeping, only bee robbing.

Defensiveness [edit]

African bees are characterized by greater defensiveness in established hives than European honey bees. They are more likely to attack a perceived threat and, when they do so, attack relentlessly in larger numbers. Also, they have been known to pursue their threat for over a mile. This aggressively protective behavior has been termed by scientists as hyper-defensive behavior. This defensiveness has earned them the nickname "killer bees," the aptness of which is debated. Over the decades, several deaths in the Americas have been attributed to African bees. The venom of an African bee is no more potent than that of a European honey bee, but since the former tends to sting in greater numbers, the number of deaths from them are greater than from the European honey bee.[citation needed] However, allergic reaction to bee venom from any bee can kill a person, and it is difficult to estimate how many more people have died due to the presence of African bees.

Most human incidents with African bees occur within two or three years of the bees' arrival and then subside. Beekeepers can greatly reduce this problem by killing the queens of aggressive strains to breed gentler stock. Beekeepers in South Africa keep A. m. scutellata using common beekeeping practices without excessive problems.

Fear factor [edit]

The African bee is widely feared by the public, a reaction that has been amplified by sensationalist movies (such as The Swarm) and some of the media reports. Stings from African bees kill one or two people per year in the United States.[21]

As the bee spreads through Florida, a densely populated state, officials worry that public fear may force misguided efforts to combat them.

News reports of mass stinging attacks will promote concern and in some cases panic and anxiety, and cause citizens to demand responsible agencies and organizations to take action to help ensure their safety. We anticipate increased pressure from the public to ban beekeeping in urban and suburban areas. This action would be counter-productive. Beekeepers maintaining managed colonies of domestic European bees are our best defense against an area becoming saturated with AHB. These managed bees are filling an ecological niche that would soon be occupied by less desirable colonies if it were vacant.
 
— Florida African Bee Action Plan[22]

Misconceptions [edit]

The sting of the Africanized Honey Bee is no more potent than another variety of honey bee, and they have a similar appearance. What makes Africanized honey bees more dangerous is that they are more easily provoked, quick to swarm, attack in greater numbers, and pursue their victims for greater distances. An Africanized bee colony can remain agitated longer and may attack up to a quarter of a mile away from the hive.[citation needed]

Queen management in African bee areas [edit]

In Mexico, where African bees are well established, pollination beekeepers have found that a purchased and pre-bred non-African queen may be used to locally create a first generation of virgin queens that are then bred in an uncontrolled fashion with the local wild African drones. These first generation African queens produce worker bees that are manageable, not exhibiting the intense and massive defense reactions of subsequent generations.

Impact on existing apiculture [edit]

In areas of suitable temperate climate, the survival traits of African queens and colonies outperform western honey bee colonies. This competitive edge leads to the dominance of African traits. In Brazil, the African hybrids are known as Assassin Bees, for their habit of taking over an existing hive of European bees; this habit is most evident when the hive being attacked has a weakened queen, so not all hives are equally vulnerable, and overall rates of hive usurpation can reach 20%.[1]

Gentle African bees [edit]

Not all African hives show overly defensive behavior; some colonies are quiet, which gives a beginning point for beekeepers to breed a gentler stock.[23] This has been done in Brazil, where bee incidents are much less common than they were during the first wave of the African bees' colonization. Now that the African bee has been "re-domesticated", it is considered the bee of choice for beekeeping in Brazil.

References [edit]

  1. ^ a b S. S. Schneider, T. Deeby, D. C. Gilley and G. DeGrandi-Hoffman, 2004. Seasonal nest usurpation of European colonies by African swarms in Arizona, USA. Insectes Sociaux 51: 356–364.
  2. ^ Pierre Franck, Lionel Garnery, Michel Solignac and Jean-Marie Cornuet (1997) JSTOR The Origin of West European Subspecies of Honeybees (Apis mellifera): New Insights from Microsatellite and Mitochondrial Data EvolutionVol. 52, No. 4 (Aug., 1998), pp. 1119-1134 (article consists of 16 pages) Published by: Society for the Study of Evolution [Retrieved 2011-12-22]
  3. ^ "United States Department of Agriculture, 'African Honey Bees'". Ars.usda.gov. Archived from the original on 18 October 2010. Retrieved October 19, 2010. 
  4. ^ "'Killer bees' descend on New Orleans". Digitaljournal.com. Retrieved October 19, 2010. 
  5. ^ 'African bees found in Utah for the first time'[dead link]
  6. ^ "Utah Department of Agriculture and Food". Ag.utah.gov. Archived from the original on 20 October 2010. Retrieved October 19, 2010. 
  7. ^ "Africanized bees found in East Tennessee". Bloomsburg. 2012-04-10. Retrieved 2012-04-11. 
  8. ^ "University of Florida IFAS Extension, 'African Honey Bee: What You Need to Know'". Edis.ifas.ufl.edu. Archived from the original on 2008-06-23. Retrieved 2011-01-05. 
  9. ^ Szalanski, A.L., and J.A. McKern. 2007. Multiplex PCR-RFLP diagnostics of the African honey bee (Hymenoptera: Apidae). Sociobiology 50: 939–945.[1]
  10. ^ "Research upsetting some notions about honey bees". ScienceDaily. December 29, 2006. 
  11. ^ Charles W. Whitfield, Susanta K. Behura , Stewart H. Berlocher, Andrew G. Clark, J. Spencer Johnston, Walter S. Sheppard, Deborah R. Smith, Andrew V. Suarez, Daniel Weaver & Neil D. Tsutsui (2006). "Thrice out of Africa: ancient and recent expansions of the honey bee, Apis mellifera" (PDF). Science 314 (5799): 642–645. doi:10.1126/science.1132772. PMID 17068261. 
  12. ^ Honey Bee Genome Sequencing Consortium (2006). "Insights into social insects from the genome of the honeybee Apis mellifera". Nature 443 (7114): 931–949. doi:10.1038/nature05260. PMC 2048586. PMID 17073008. 
  13. ^ Ying Wang, Mireia Jorda, Peter L. Jones, Ryszard Maleszka, Xu Ling, Hugh M. Robertson, Craig A. Mizzen, Miguel A. Peinado & Gene E. Robinson (2006). "Functional CpG methylation system in a social insect". Science 314 (5799): 645–647. doi:10.1126/science.1135213. PMID 17068262. 
  14. ^ Carcaterització genètica de les abelles
  15. ^ http://www.uco.es/dptos/zoologia/Apicultura/Conservacion_abejas.html
  16. ^ Garnery L, Cornuet JM, Solignac M (October 1992). "Evolutionary history of the honey bee Apis mellifera inferred from mtDNA analysis". Mol. Ecol. 1 (3): 145–54. PMID 1364272. 
  17. ^ John E. Dews, Eric Milner books.google.co.uk Breeding Better Bees (80 pages) WritersPrintShop, 2004 ISBN 1-904623-18-2 [Retrieved 2011-12-19]
  18. ^ M.Chouchene, N. Barbouche, M.Garnery, L.Baylac openstarts.units.it Nimis P.L. Vignes Lebbe R (eds.) Tools for Identifying Biodiversity: Progress and Problems p.343 Molecular and ecophysiological characterisation of the Tunisian bee : Apis mellifera intermissa ISBN 978-88-8303-295-0 EUT,2010[Retrieved 2011-12-20]
  19. ^ "ENY-114/MG113: African Honey Bee: What You Need to Know". Edis.ifas.ufl.edu. Retrieved 2011-01-05. 
  20. ^ Szalanski, A.L., and R. Magnus. 2010. Mitochondrial DNA characterization of Africanized honey bee (Apis mellifera L.) populations from the USA. Journal of Apicultural Research and Bee World 49(2): 177-185.[2]
  21. ^ Warner, Amanda (April 21, 2009). "Beekeepers warn of summer threat". Times Record News. Wichita Falls, Texas. Accessed May 17, 2010.
  22. ^ "Florida African bee Action Plan". Florida Department of Agriculture and Consumer Services. Retrieved 2011-01-05. 
  23. ^ "Beesource Beekeeping » Preparing for the "Africanized" Honey Bee: A Program for Arizona". Beesource.com. Retrieved October 19, 2010. 

Further reading [edit]

  • Collet T., Ferreira K.M., Arias M.C., Soares A.E.E., Del Lama M.A. (2006). "Genetic structure of African honeybee populations (Apis mellifera L.) from Brazil and Uruguay viewed through mitochondrial DNA COI–COII patterns". Heredity 97: 329–335. doi:10.1038/sj.hdy.6800875. 
  • Smith D.R., Taylor O.R., Brown W.M. (1989). "Neotropical African honey bees have African mitochondrial DNA". Nature 339: 213–215. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Buckfast bee

The Buckfast bee is a strain of honey bee. It is a hybrid, a cross of many strains of bees, developed by "Brother Adam", (born Karl Kehrle on 3 August 1898 in Germany), who was in charge of beekeeping at Buckfast Abbey, where the bees are still bred today. Most of the breeding work in Europe is done by breeders belonging to the breeders accociation "Gemeinschaft der Europäischen Buckfastimker". This organisation is maintaining a pedigree for Buckfast bees, originating from Brother Adam's years.

Contents

Origin

In the early 20th century bee populations were being decimated by Isle of Wight disease. This condition, later called "acarine" disease, after the acarine parasitic mite that invaded the bees' tracheal tubes and shortened their lives, was killing off thousands of colonies in the British Isles in the early part of the 20th century.[1]

In 1916 there were only 16 surviving colonies in the Abbey. All of them were either pure Ligurian (Italian) or of Ligurian origin, hybrids between Ligurian and the English black bee A.m. mellifera. Brother Adam also imported some more Italian queens. From these he began to develop what would come to be known as the Buckfast bee.

Heritage

The Buckfast contains heritage from mainly A.m. ligurica (North Italian), A.m. mellifera (English), A.m. mellifera (French), A.m. anatolica (Turkish) and A.m. cecropia (Greek). The Buckfast bee of today also contains heritage from two rare and docile African stocks A. m. sahariensis and the A.m. monticola, but not the "Africanized" A. m. scutellata. "[2]

History

Brother Adam moved the bees he discovered to the isolated valley of Dartmoor which became a mating station for selective breeding. With no other bees within range, Brother Adam could maintain their genetic integrity and develop desirable traits.

Brother Adam investigated various honey bee races and made many long journeys in Europe, Africa and the Middle-East searching for pure races and interesting local stocks. The book In Search of the Best Strains of Bee tells about his travels in search of genetic building blocks. Brother Adam imported more bees to cross with his developing Buckfast bee.

Every new bee strain or bee race was first crossed with the existing Buckfast Bee. In most cases, the new desired qualities were passed on to the new generation and the new combination was then made stable with further breeding work. Every crossing with a new race took about 10 years before the desired genes were fixed in the strain. Over seventy years, Brother Adam managed to develop a vigorous, healthy, and fecund honey bee which he christened the Buckfast bee.

The Buckfast bee is popular among beekeepers and is available from bee breeders in Germany, Ireland, the United Kingdom, France, and more. Most of the Buckfast bee's qualities are very favorable. They are extremely gentle and highly productive. Brother Adam, in his book, Beekeeping at Buckfast Abbey writes that in 1920 they obtained "an average of no less than 192 lbs surplus per colony and individual yields exceeding 3 cwt [approx. 336 lbs]. "[3] In the 1986 BBC-affiliated documentary, The Monk and the Honey Bee, more than 400 pounds of honey are reported to have been produced by a single Buckfast colony. According to Brother Adam, "The average annual honey yield over the last thirty years has been 30 kg (66 lb.) per colony. Thus we have a favourable balance compared with the average production in America or in Europe. "[4][5]

The stock has been imported into the United States (eggs, semen, and adult queens via Canada) and they are easily available.[6]

Buckfast Breeding Program

The qualities and characteristics desired in Brother Adam's breeding can be divided into three groups; Primary, Subsidiary, and 3rd, those that have bearing on management.

Primary

Primary qualities are those qualities essential for any maximum honey production.

  • Fecundity - maintaining at least 9 frames of brood May - July
  • Foraging zeal - a boundless capacity for foraging work, close inbreeding to intensify this quality can be counter-productive.
  • Resistance to disease
  • Disinclination to swarm

Subsidiary

  • Longevity
  • Wing-power
  • Keen sense of smell
  • Defensive characteristics
  • Hardiness and ability to over winter
  • Spring development
  • Thrift
  • Instinct of self provisioning
  • Arrangement of honey stores
  • Wax production and comb building
  • Gathering of pollen
  • Tongue-reach

Qualities which Influence Management

  • Good temper
  • Calm behavior
  • Disinclination to propolize
  • No brace combs
  • Cleanliness
  • Honey capping
  • Sense of orientation[7][8]

Characteristics

Strong Points

  • Good honey producer
  • Prolific queens (lay many eggs)
  • Overwinters well
  • Frugal - Low amount of brood during fall (uses less honey stores during winter)
  • Packs brood nest with honey for good wintering
  • Curtails egg laying during dearths
  • Brood rearing ceases during late fall
  • Extremely gentle, with low sting instinct
  • Low swarm instinct
  • High Tracheal Mite Tolerant
  • Low incidence of chalkbrood and wax moths due to good housecleaning techniques
  • Very hygienic
  • Build-up rapidly once started
  • Produces little propolis/brace comb[9]
  • Does well in cold/wet spring

Weak Points

  • Low amount of brood during Winter
  • Less honey or pollen due to erratic spring weather conditions
  • Possibility of second generation defensiveness if not requeened
    • This is not due to being a "second generation" hybrid. The Buckfast is a mix of many, many generations with many different species. A likely cause of "hot" hives in subsequent generations is the introduction of Africanized bee genetics being introduced either to the mother queen or to the daughter queen via local Africanized drones. Buckfast bees in cooler regions where Africanized bees have not arrived do not have this problem.

Significance

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!