Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.0 of 5

Physical Description

Type Information

Holotype for Andrena ceanothi Viereck, 1917
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Year Collected: 1901
Locality: Lehigh Gap, Pa, Pennsylvania, United States
  • Holotype: 1917. Transactions of the American Entomological Society. 43: 404.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Andrena ceanothi in Illinois

Andrena ceanothi Viereck: Andrenidae (Andreninae), Hymenoptera
(observations are from Krombein et al. and Mehrhoff; insect activity is mostly unspecified)

Asteraceae: Leucanthemum vulgare (Kr), Taraxacum officinale (Kr); Brassicaceae: Barbarea vulgaris (Kr); Ericaceae: Vaccinium angustifolium (Kr); Fabaceae: Amorpha canescens (Kr); Orchidaceae: Isotria verticillata exp (Mhr); Rhamnaceae: Ceanothus americanus (Kr); Rosaceae: Prunus serotina (Kr)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrena ceanothi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TAGGAGCCTCACTAAGATTTATTATTCGAATAGAACTGAGAAATCCAGGTAGATGAATCAATAATGATCAAATTTATAATTCAATCGTAACCTCTCACGCTTTCATTATAATTTTTTTCATAGTAATGCCATTCATAATCGGAGGTTTCGGAAACTGACTCACACCGTTAATATTAGGAGCGCCCGACATGGCTTTCCCACGAATAAACAATATAAGGTTCTGACTACTCCCTCCATCAATTTTAATTATCTTATTTAGAATAATTTTAAATTCAGGATCAGGTACAGGATGAACAGTATATCCACCTTTATCATCATACTCCTATCATCCATCCTCATCAGTTGATTTAACAATTTTTTCATTACATATTGCAGGAGTGTCATCAATTATAGGAGCAATTAATTTCATTGTAACAATTCTTAGTATAAAAAATATTTCAATAAACTATGATCAACTCCCACTATTCCCATGATCAGTATTTATTACCACAATCTTATTATTAATTTCTCTACCAGTTTTAGCTGGAGCCATCACAATACTACTATCAGACCGTAATTTAAATTCATCATTCTTTGACCCAATAGGAGGAGGAGACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Andrena ceanothi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!