Overview

Brief Summary

New York State Invasive Species Information

Background and Introduction

This predatory cladoceran zooplanktor, commonly known as the spiny waterflea (Bythotrephes longimanus)[formerly identified as Bythotrephes cederstroemi], is a crustacean (a relative of crayfish and shrimp). A native of the Ponto-Caspian region of Eastern Europe and Western Asia, Bythotrephes was first found in North America in December 1984 in Lake Huron. Spread through the Great Lakes was rapid, with the species being found in Lake Ontario in September 1985, Lake Erie in October 1985, Lake Michigan in September 1986, and Lake Superior in August 1987.This species is believed to be an international shipping ballast water introduction. Its rapid spread throughout the lakes most likely is the result of currents, inter- and intra-lake ballast transfers, and recreational boating on the lakes.

Biology and Impacts

Bythotrephes is planktivorous, consuming up to 20 prey zooplanktors per day. One major target species of Bythotrephes is Daphnia (another small water flea). Research has shown that a dramatic decrease in Daphnia abundance coincided with the introduction of Bythotrephes in Lake Michigan. Density of a native predatory zooplanktor, Leptodora, also dropped off coincident with the appearance of Bythotrephes, possibly because Bythotrephes was outcompeting it for Daphnia. It has been theorized that declines in the abundance of Daphnia and other Bythotrephes prey may alter the food web in the Great Lakes, reducing the number of young plankton-eating fish which survive their first year. Researchers have observed that chinook salmon, walleye, white bass, alewife, yellow and white perch, emerald and spottail shiner, and lake whitefish consume Bythotrephes. It is not known, however, how nutritional this water flea is for fish, given the amount of its mass made up by exoskeleton and the long tail spine. It is too soon to know the ultimate impact of Bythotrephes on Great Lakes ecosystems. If the water flea is found to be a preferred (and nutritious) food source for perch and other fishes, its impact on fish populations may be beneficial. If predation by Bythotrephes results in reduced populations of preferred prey, such as Daphnia, the water flea may result in negative consequences to native Great Lakes fish populations. Is has been theorized that the decline of alewife in Lakes Ontario, Erie, Huron, and Michigan may be related to the introduction of Bythotrephes.

  • Barbiero, RP and DC Rockwell. 2008. Changes in the crustacean communities of the central basin of Lake Erie during the first full year of the Bythotrephes longimanus invasion. Journal of Great Lakes Research 34(1):109-121.
  • Barbiero, RP and ML Tuchman. 2004. Changes in the crustacean communities of Lakes Michigan, Huron, and Erie following the invasion of the predatory cladoceran Bythotrephes longimanus. Canadian Journal of Fisheries and Aquatic Sciences 61:2111-2125.
  • Berg, DJ and DW Garton. 1988. Seasonal abundance of the exotic predatory cladoceran, Bythotrephes cederstroemi, in western Lake Erie. Journal of Great Lakes Research 14(4):479-488.
  • Bourdeau, PE, KL Pangle, and SD Peacor. 2011. The invasive predator Bythotrephes induces changes in the vertical distribution of native copepods in Lake Michigan. Biological Invasions 13(11):2533-2545.
  • Branstrator, DK 1995. Ecological interactions between Bythotrephes cederstroemi and Leptodora kindtii and the implications for species replacement in Lake Michigan. Journal of Great Lakes Research 21:670-679.
  • Branstrator, DK and JT Lehman. 1996. Evidence for predation by young-of-the-year alewife and bloater chub on Bythotrephes cederstroemi in Lake Michigan. Journal of Great Lakes Research 22:917-924.
  • Foster, SE and WG Sprules. 2009. Effects of the Bythotrephes invasion on native predatory invertebrates. Limnology and Oceanography 54(3):757-769.
  • Lehman, JT and CE Cáceres. 1993. Food-web responses to species invasion by a predatory invertebrate: Bythotrephes in Lake Michigan. Limnology and Oceanography 38(4):879-891.
  • Strecker, AL and SE Arnott. 2008. Invasive predator, Bythotrephes, has varied effects in ecosystem function in freshwater lakes. Ecosystems 11(3):490-503.
  • Vanderploeg, HA, TF Nalepa, DJ Jude, EL Mills, KT Holeck, JR Liebig, IA Grigorovich, and H Ojaveer. 2002. Dispersal and emerging ecological impacts of Ponto-Caspian species in the Laurentian Great Lakes. Canadian Journal of Fisheries Aquatic Sciences 59:1209-1228.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The New York Invasive Species Clearinghouse, Cornell University Cooperative Extension

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Great Britain and northern Europe. Introduced into the Great Lakes and associated waterwasy in North America (found in Lake Huron in 1984) (Howells 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bythotrephes longimanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGATAGTAGGAACTGCTCTGAGTATACTTATTCGAGCTGAGTTGGGACAGGCAGGGAGACTTATTGGGGAC---GACCAAATCTATAATGTTGTCGTGACTGCACATGCTTTTGTCATAATCTTTTTTATAGTAATACCTACTATAATCGGAGGGTTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCCCCCGATATAGCATTCCCTCGACTAAATAACTTAAGTTTCTGATTTCTCCCCCCAGCCCTTACCCTTCTACTTGTAGGAGGGGCCGTAGAGAGTGGAGCAGGAACTGGCTGAACAGTTTACCCCCCACTTTCTGCAGGTATTGCTCATGCAGGAGCTTCAGTAGACTTAAGAATCTTTTCTCTTCATCTAGCAGGTATTTCATCCATCTTAGGGGCAATCAATTTTATCACTACAATTATCAATATGCGCTCACAAGGAATGACTTTAGACCGGATTCCCCTCTTTATCTGAGCTGTCGGTATTACAGCCCTCCTTTTATTATTAAGACTTCCAGTTTTAGCTGGAGCTATTACTATACTCCTTACAGATCGTAACCTTAATACTTCTTTCTTTGATCCTGCAGGAGGAGGAGATCCTATTTTGTATCAACATCTATTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bythotrephes longimanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: A widespread species that is native to Great Britain and northern Europe and has been introduced into the Great Lakes in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bythotrephes longimanus

Bythotrephes longimanus (also Bythotrephes cederstroemi), or the spiny water flea, is a planktonic crustacean less than 15 millimetres (0.6 in) long. It is native to fresh waters of Northern Europe and Asia, but has been accidentally introduced and widely distributed in the Great Lakes area of North America since the 1980s.[1][2] Bythotrephes is typified by a long abdominal spine with several barbs which protect it from predators.

Contents

Description and taxonomy

Bythotrephes longimanus is a cladoceran crustacean (water flea) recognizable with its straight tail spine averaging about 70% of its length. Adult individuals have three to four barbs on the spine while juveniles have only one pair. The animal has one large eye that is usually black or red. It also possesses a pair of swimming antennae and four pairs of legs, of which the first pair is used to catch prey. Mandibles are used for consumption of prey.

The spiny water flea is similar to another introduced cladoceran of the same family, the fishhook waterflea Cercopagis pengoi, which however has a more slender spine featuring a prominent loop-like hook at its end (see figure).[2] There is also variation in the shape of the more robust spine of Bythotrephes itself. Specimens arising from sexually produced eggs have a completely straight and relatively shorter spine. In parthenogenetically produced animals the spine features a kink in the middle (figure). Previously, the kinked-spined animals were thought to be a separate species Bythotrephes cederstroemi.[2]

Diet

The spiny water flea preys on smaller planktonic organisms. Its diet consists mostly of zooplankton including Daphnia and smaller crustaceans. Bythotrephes can consume 10–20 prey organisms a day. It may also eat other small organisms it comes across.

Geographical range

The spiny water flea is native to northern Europe and Asia, and some parts of central Europe. However the water flea has spread in recent years to many areas throughout Europe including some ports and inland lakes outside its natural range.

In 1982 the crustacean was found in Lake Ontario and soon spread to the other Great Lakes and some inland lakes within the Midwest, including over 60 inland lakes in Ontario. It is thought to have been introduced by untreated ballast water from international ships. Concern has increased to the impact of this invasive species in the Great lakes region and other areas it might have been accidentally introduced. The spiny water flea, eggs and larvae may be caught up in fishing line, downriggers, fishing nets, and other fishing equipment which has caused the spread of the water flea to inland lakes and rivers.

Impact in introduced areas

Bythotrephes competes with several fish including panfish and perch for prey. These smaller fish are not able to feed on the spiny water flea itself because of the barbs the flea possesses. The spiny water flea's diet consists mostly of Daphnia zooplankton, leading to competition with small and baby fish, and also with native water flea species. Daphnia zooplankton populations have declined in recent years though there is no conclusive evidence as to the cause.

The spiny water flea, is causing serious concerns in the lakes of Canada. The problem is that it feeds on zooplankton and can actually eliminate zooplankton species. As zooplankton is the backbone of aquatic food chains, this tiny crustacean presents a serious risk to the ecosystem. The eggs survive even after being dried out or eaten by fish.[3]

Invasion by the spiny water flea has also correlated with ecological changes in the Great Lakes. Since the species' introduction to the Great Lakes in the mid-1980s there has been a decrease in species richness, as well as decreases in the late summer densities of several other Cladocera species, including Daphnia pulicaria and Daphnia retrocurva.[4]

References

  1. ^ a b USDA National Invasive Species Information Center: Spiny Water Flea
  2. ^ a b c Bythotrephes longimanus USGS NAS – Nonindigenous Aquatic Species
  3. ^ Robert Roy Britt (2005). "Invasive Creatures Attack Like Internet Viruses". LiveScience.com. 
  4. ^ Richard P. Barbiero & Marc L. Tuchman (2004). "Changes in the crustacean communities of Lakes Michigan, Huron, and Erie following the invasion of the predatory cladoceran Bythotrephes longimanus". Canadian Journal of Fisheries and Aquatic Sciences 61 (11): 2111–2125. doi:10.1139/f04-149. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Bythotrephes longimanus, cited extensively as an invasive species in the Great Lakes, is a junior synonym of B. longimanus (McLaughlin et al. 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!