Overview

Brief Summary

Biology

Due to the uncertain nature of the ponds in which this species occurs, it has an extremely fast life-cycle, and develops from an egg to an adult in just two or three weeks (depending on temperature) after the pond becomes wet again (3). When the pond dries out, the resistant eggs can remain dormant for decades before hatching when the pond is re-flooded (2). The tadpole shrimp digs in the sediment with its shield to find food (5), it feeds on small invertebrates, microscopic particles and plants (3). It usually swims with its shield upwards (4), but when oxygen levels become very low they may swim 'upside-down' with their legs close to the surface of the water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Triops cancriformis is a living fossil; it has not changed in appearance since the Triassic period, 220 million years ago, and is therefore the oldest living animal species known (2). With its flattened shield that covers the head- and leg-bearing parts of the body, Triops resembles a small horseshoe crab. The segmented abdomen bears two projections (4). All notostracans (tadpole shrimps) have 2 internal compound eyes plus the larval nauplius eye (Triops means 'three eyes'). In females, the 11th pair of legs is modified and carries the eggs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The species is widely distributed in Europe through to Russia, and from the Middle East to India. In Great Britain it was recorded during the 18th and 19th centuries from Kent, Bristol, Dorset and Worcestershire, and until September 2004 it was thought to be restricted to just one pond in the New Forest in Hampshire. However, it was then found in pools in Caerlaverock in southwest Scotland (6). Genetic studies on the species may reveal that the species found in Britain has great international importance (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

This species lives in temporary ponds that dry out in summer (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Triops cancriformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 95 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACGTTGACTTTATTCAACAAATCATAAGGATATTGGAACACTTTATTTAATCTTTGGGGCATGAGCTGGAATAGTAGGAACAGCACTAAGTCTTTTAATTCGAGCAGAATTAGGACAACCTGGAAGACTAATTGGAGAT---GATCAAATCTATAATGTAGTTGTTACAGCTCATGCATTCATTATAATTTTCTTTATAGTTATACCAATTTTGATTGGAGGATTCGGTAATTGATTAGTACCTCTTATATTAGGAGCTCCTGACATAGCCTTTCCCCGCCTTAATAATATAAGATTCTGACTTCTTCCTCCCGCATTAACCTTATTATTATCAGGAGGAGCCGTAGAAAGAGGAGCTGGAACAGGATGAACTGTTTATCCTCCTTTGTCAAGAGGCATTGCCCATGCTGGCGCCTCTGTCGATTTAAGAATCTTTTCACTTCATTTAGCAGGAATTTCATCAATTTTAGGTGCCATTAACTTTATCACAACAATCATTAATATGCGAACTAGAGGAATATCTCTAGATCGGATCCCATTATTTGTGTGAGCTGTGGGAATTACTGCTCTTCTCCTTTTACTGTCACTTCCCGTTCTAGCAGGAGCTATTACTATATTATTAACAGACCGAAATCTTAATACATCATTTTTTGACCCAGCTGGAGGAGGGGACCCTATCCTGTATCAACATTTATTTTGATTTTTCGGTCACCCGGAAGTTTATATTTTAATTTTGCCAGGATTCGGAATAATCTCTCACATTATTAGACAAGAAAGTGGGAAAAAGGAAGCCTTCGGAACGTTAGGAATAATTTACGCCATATTAGCTATTGGGGTGCTAGGATTTGTGGTGTGAGCGCACCATATATTTACAGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Triops cancriformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 96
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Classified as Endangered in Great Britain, and fully protected under the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is very sensitive to veterinary compounds that are released into the water from livestock dung. Predation by introduced predators such as ducks and fish, as well as pollution and the introduction of alien plants are also likely to have affected this species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The tadpole shrimp is targeted as a priority species for conservation action under the UK Biodiversity Action Plan (UK BAP). The Species Action Plan produced as a result, aims to maintain the population in the New Forest and develop captive populations to allow research, increase public awareness and appreciation into the species, and in the long-term enable potential reintroductions of the tadpole shrimp into parts of its former range (3). Measures taken to conserve this species will also be likely to benefit other species that inhabit temporary ponds, such as the dung beetle Aphodius niger (3). The New Forest is an SSSI (Site of Special Scientific Interest), an SPA (Special Protection Area), a RAMSAR site (a Wetland of International Importance) and a candidate SAC (Special Area for Conservation). English Nature's Species Recovery Programme is guiding research into the species, which is promoted by the Triops Conservation Group (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Triops cancriformis

Triops cancriformis, or tadpole shrimp, is a species of tadpole shrimp found in Europe, the Middle East and Japan.

Due to habitat destruction, many populations have recently been lost across its European range, so, the species is considered endangered in the United Kingdom and in several European countries.[2] In captivity they commonly grow up to 6 centimetres (2.4 in); in the wild they can achieve sizes of 11 cm (4.3 in).[2]

In the UK, there are just two known populations: in a pool and adjacent area in the Caerlaverock Wetlands in Scotland, and a temporary pond in the New Forest.[3] The species is legally protected under Schedule 5 of the Wildlife and Countryside Act 1981 (as amended).

This species is considered to be one of the oldest living species on the planet at around 200 million years old. Fossils of this species from the Upper Triassic (Norian) period appear virtually unchanged compared to modern day members of the species.[4]

Life cycle

Triops cancriformis has a very fast life cycle, and individuals become mature in about two weeks after hatching. Their populations can be gonochoric, hermaphroditic or androdioecious. The latter is a very rare reproductive mode in animals, in which populations are made of hermaphrodites, with a small proportion of males. Due to this lack of males, early researchers thought Triops were parthenogenetic. The presence of testicular lobes scattered amongst their ovaries confirmed they were in fact hermaphroditic. Fertilized females of hermaphrodites produce diapausing eggs or cysts, able to survive decades in the sediment of the ponds and lakes they inhabit. These eggs are resistant to drought and temperature extremes.

Taxonomic history

In 1801, Louis Augustin Guillaume Bosc made the first officially recognised species description of Triops cancriformis.[5] He named this species Apus cancriformis. Other authors used the name Apus cancriformis over the years but often with the wrong original author of this name.[5]

In 1909, Ludwig Keilhack used the correct name "Triops cancriformis (Bosc)" in a field identification key of the freshwater fauna of Germany. He took up the genus name proposed by Schrank and suggested that the genus name Apus be replaced with Triops Schrank. However, other authors disagreed with him and the controversy continued until the 1950s.[5]

In 1955, Alan Longhurst provided the original author of T. cancriformis as "Triops cancriformis (Bosc, 1801)" with a full history of synonymy to support it.[6] This was in a taxonomic review of the Notostraca that also supported using the genus name Triops instead of Apus. In 1958, the International Commission on Zoological Nomenclature (ICZN) recognised the name Triops cancriformis (Bosc, 1801–1802) (ICZN name no. 1476) as officially the oldest. They also recognised the genus name Triops Schrank instead of Apus. They followed Longhurst in these decisions.[5]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!