Ecology

Associations

Flowering Plants Visited by Ammophila sp. in Illinois

Ammophila sp. Kirby: Sphecidae (Sphecinae), Hymenoptera
(this observation is from Thomson et al.)

Araliaceae: Aralia hispida sn (TMP)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ammophila sp. aff. sabulosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ammophila sp. JC134

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CATAAAGATATTGGAATATTATATTTTATCTTTAGAATATGAGCAGGTATATATGGAGCTTCATTAAGAATAATTATTCGAATAGAACTAGGTACACCTGGAAGATTAATTGGAAAT---GATCAAATTTACAATAGAATTGTTACAGCCCACGCATTTATTATAATTTTTTTTATAATTATACCATTTATAATTGGAGGTTTCGGAAATTGATTGATTCCATTAATACTAGGAGCACCAGACATAGCTTATCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCCTTATTCTTATTAATCTCTAGAAGAATTGTGGATTCAGGAACAGGGACAGGATGGACAGTCTATCCTCCTTTATCTTCAAATTTATTCCATAATGGAATATCTGTAGACCTAAGAATCTTATCCCTTCATTTAGCTGGAGCTTCATCTTTAATAGGTACAATTAATTTTATTGCAACAATTATAAATATAAAAAATTCTAACTTATCAATAGAAAAAATTCCTTTATTTTCTTGATCAATTTTAATCACTACATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ammophila sp. JC134

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ammophila (wasp)

Ammophila is the type genus of the subfamily Ammophilinae of the hunting wasp family Sphecidae. Ammophila is a large and cosmopolitan genus, with over 200 species, mostly occurring in the warmer regions of all continents apart from Antarctica.

Vernacular names[edit]

They sometimes are referred to as "Thread-waisted wasps", but the name is not definitive, because many other members of the Sphecidae are thread-waisted too, and referred to as such. Sometimes Ammophiline wasps are referred to as "sand wasps"; this may be better because it is consistent with the name Ammophila, which derives from the Greek for "sand lover", presumably because many species dig their nests in sand. However, as is frequent in dealing with common names, there is no definitive common name for the Ammophilinae; entomologists usually confine themselves to the technical names for convenience and clarity.

Morphology and habits[edit]

As is frequent in large genera, there is considerable variation in their habits and appearance, but predominantly they are medium-sized wasps of strikingly slender build, with antennae about as long as the head plus thorax.

The jaws are not large, but are strong and apart from feeding and digging, often are used for unexpected functions such as holding a pebble with which the wasp hammers down soil to seal a nest,[2] or to grip the stem of a plant at night, holding its body at right-angles to the stem, its legs folded and all the weight taken up by the mandibles. This habit is not unique to Ammophilinae — some bees, such as Amegilla also overnight in that way, and Fabre documented some others.[3]

Nesting[edit]

Nesting is generally by digging an unbranched tunnel in sandy soil, but provisioning can be progressive, the mother bringing prey as the larva requires it, or mass provisioning, where each nest is provided with a single large prey item,[4] or as many small prey items as should be required.[2]

Species[edit]

Listed alphabetically.[1]

See also[edit]

References[edit]

  1. ^ a b "Ammophila". Integrated Taxonomic Information System. 
  2. ^ a b Peckham, George W, Peckham, Elizabeth G.; Wasps, Social and Solitary, Pub. Constable 1905
  3. ^ Fabre, Jean-Henri; The wonders of instinct; Pub: Century, New York 1918
  4. ^ Barbara J. Hager and Frank E. Kurczewski; Nesting Behavior of Ammophila harti (Fernald) (Hymenoptera: Sphecidae); American Midland Naturalist Vol. 116, No. 1 (Jul., 1986); Pub: University of Notre Dame
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!